Research Article |
Corresponding author: Xingyue Liu ( xingyue_liu@yahoo.com ) Academic editor: Shaun Winterton
© 2018 Pan Yi, Pei Yu, Jingyi Liu, Huan Xu, Xingyue Liu.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Yi P, Yu P, Liu J, Xu H, Liu X (2018) A DNA barcode reference library of Neuroptera (Insecta, Neuropterida) from Beijing. ZooKeys 807: 127-147. https://doi.org/10.3897/zookeys.807.29430
|
Neuroptera (lacewings) is one of the ancient holometabolous insect groups, but some extant species stand as important natural enemies for biological control. As the capital city of China, Beijing has a rich fauna of Neuroptera, previously with 47 species recorded and sorted in 32 genera of seven families. In this study, DNA barcoding based on sequences of COI gene fragments is used to discriminate lacewing species from Beijing. 217 DNA barcode sequences belonging to 49 species were successfully obtained. The COI barcode data worked well for identification of almost all lacewing species herein examined except Pseudomallada prasinus (Burmeister), in which cryptic species may exist. Twenty species of Neuroptera are newly recorded from Beijing. Besides, Nothochrysinae is first recorded from Beijing. Chrysopidia ciliata (Wesmael) and Drepanepteryx algida (Erichson) are first recorded from China.
China, cytochrome c oxidase subunit I, mitochondrial DNA, lacewings, taxonomy
Neuroptera (lacewings) is the most species-rich order of the superorder Neuropterida. Hitherto, there are about 6000 described species worldwide in 16 families (
Because of the predatory feeding habits, some lacewing species, e.g., the species of Chrysopidae, Hemerobiidae, and Coniopterygidae, are economically important and have been used for the biocontrol of agricultural pest insects (
DNA barcoding has become the most popular approach for the species identification and the assignment of specimens throughout all life stages to described species (
Beijing, as the capital city of China, is located at northern China and surrounded by Hebei Province, belonging to the eastern Palaearctic region. To the west of Beijing is Mt. Xishan, forming the eastern flank of the Taihang Mountains range, which runs north-south up the spine of Hebei province. Mt. Xishan covers nearly all of Fangshan and Mentougou Districts west of the city. The mountains north of Beijing including Mt. Wulingshan, Mt. Jundushan, and Mt. Fenghuanling all belong to the Yanshan range, which runs east-west, across northern Hebei Province. Climate of Beijing is typical humid continental monsoon climate with hot and rainy summers, cold and dry winters. The majority flora of Beijing is temperate deciduous forest. Despite high-speed increase of economic development and population, relatively well-preserved natural environment still remains in Beijing, particularly in the aforementioned mountainous areas.
Concerning Neuroptera, Beijing has relatively rich fauna of lacewing species, currently with 47 species recorded based on the recently published catalogue of the Chinese Neuropterida (
Here we present a preliminary DNA barcode library for the lacewing species from Beijing. A total of 217 barcode sequences were amplified, and this dataset comprises the barcodes of 49 species (including seven undetermined species). Twenty species are newly recorded from Beijing, and two of them are first recorded from China (Figures
The lacewing specimens herein studied were collected between 2013 and 2017 using sweeping net and light trap. The collecting areas mainly comprise the Xiaolongmen Forestry Park, Mentougou District, northwestern Beijing, the Wulingshan National Nature Reserve that is located across Miyun District in northeastern Beijing and Xinglong County in Hebei Province, an organic orchard in Wangjiayuan Village, Changping District, northern Beijing, and the Olympic Forest Park, Chaoyang District in the metropolitan area of Beijing. The specimens were preserved in ethanol (95%) and identified based on the morphological characteristics using the keys to the species (
Total genomic DNA was isolated from mid legs using the TIANamp Genomic DNA Kit (TIANGEN Inc., Beijing, China) according to the manufacturer’s instructions. The barcoding fragments of COI were amplified by Polymerase chain reactions (PCR). The reaction was conducted in a final volume of 25 μL consisting of 14.5 μL of ddH2O, 1 μL (10 μM) of each of the primers, 2 μL of dNTP, 0.5 μL of polymerase and 1 μL DNA template (~30 ng). For Chrysopidae, the COI gene fragments were amplified with specific primers, i.e., COIa–F (5’–TACAATTTATCGCCTAAACTTCAGCC–3’) and COIa–R (5’–CCCGGTAAAATTAAAATATAAACTTC–3’) because the universal primers (i.e., LCO1490 and HCO2198; see
The final consensus COI sequences were obtained after overlapping both forward and reverse sequences by ContigExpress. All sequence data are deposited in GenBank (see Accession number in File S1). All sequences were aligned using Clustal W (
The present study generated 217 sequences of 639 bp each, with an average nucleotide composition of 39.5% thymine (T), 15.8% cytosine (C), 28.4% adenine (A), and 16.3% guanine (G). Base frequencies analysis revealed low GC-contents (average: 31.1%) for the barcode fragment. The above COI barcode sequences were found to belong to 49 species of Neuroptera. A full list of these species and their collecting information are presented in the Suppl. material
Seven species of Coniopterygidae from Beijing were studied, including two species newly recorded from Beijing, i.e., Conwentzia sinica Yang, 1974 and Semidalis bicornis Liu & Yang, 1993, and two undetermined species of Coniopteryx with a minimum mean distance 10.9% (Suppl. material
The present analysis resulted in 18 species of Chrysopidae from Beijing. Three of them could not be identified to species. Among them, there are 10 species newly recorded from Beijing, including Chrysopa intima McLachlan, 1893, Chrysoperla furcifera (Okamoto, 1914), Chrysopidia ciliata (Wesmael, 1841), Mallada flavimaculus Yang & Yang, 1991, Pseudomallada cognatellus (Okamoto, 1914), Pseudomallada prasinus (Burmeister, 1839), Pseudomallada qinlingensis (Yang & Yang, 1989), Nineta grandis Navás, 1915, Nineta shaanxiensis Yang & Yang, 1989 and Nothochrysa sinica Yang, 1986. Furthermore, Nothochrysa sinica represents the first record of the subfamily Nothochrysinae from Beijing, while Chrysopidia ciliata is first recorded from China.
Habitus photographs of species of Chrysopidae newly recorded from Beijing. A Nothochrysa sinica Yang, 1986 B Chrysopa intima McLachlan, 1893 C Chrysoperla furcifera (Okamoto, 1914) D Chrysopidia ciliata (Wesmael, 1841) E Mallada flavimaculus Yang & Yang, 1991 F Pseudomallada cognatellus (Okamoto, 1914) G Pseudomallada qinlingensis (Yang & Yang, 1989) H Nineta grandis Navás, 1915 I Nineta shaanxiensis Yang & Yang, 1989. Scale bar: 1 mm.
For testing the present identification, we also compare the barcode sequences of several green lacewing species [i.e., BINS: ACF7085 (Chrysopa formosa); AAB0373 (Chrysoperla nipponensis); AAJ3493 (Chrysopidia ciliata); ABU9179, ACF9046 (Pseudomallada prasinus); GenBank: KJ592516 (Chrysopa pallens)] obtained from the Barcoding of Life Data systems (BOLD, http://www.barcodinglife.org/) and the National Center Biotechnology Information (NCBI, https://www.ncbi.nlm.nih.gov/) by using a neighbor-joining cluster analysis based on the K2P distances with MEGA v. 5.0. Most of these sequences were respectively clustered with those of same species herein sequenced, verifying our identification (Suppl. material
Habitus photographs of species of Hemerobiidae newly recorded from Beijing. A Drepanepteryx algida (Erichson, 1851) B Hemerobius bispinus Banks, 1940 C Hemerobius exoterus Navás, 1936 D Hemerobius humulinus Linnaeus, 1758 E Hemerobius japonicus Nakahara, 1915 F Hemerobius marginatus (Stephens, 1836) G Hemerobius subtriangulus Yang, 1987 H Sympherobius manchuricus Nakahara, 1960. Scale bar: 1 mm.
Among the green lacewing species herein studied, the bPTP_ML and bPTP_BS analyse resulted in 21 and 20 MOTUs, respectively (Figure
Neighbor-joining tree and result of molecular species delimitation based on COI barcodes. AConiopterygidaeBChrysopidaeCHemerobiidaeDMyrmeleontidae and Ascalaphidae. The terminal nodes in the tree are collapsed for each morphological species, the width of triangles shows the sequence divergence. Only bootstrap supports (1,000 replicates) > 0.95 are labelled.
Photographs of habitus and genitalia of Pseudomallada prasinus (Burmeister, 1839). Type A (A–H); type B (I–P); photographs of habitus (A, I); apex of abdomen in male (B, J); apex of abdomen in female (C, K); the complex of gonocoxites, gonapophyses and gonostyli 9, dorsal view (D, L); gonocoxites 10, dorsal view (E, M); spermatheca, lateral view (F, N); labial palps (G, O); maxillary palps (H, P). Scale bar: 1mm (A, I); 0.25 mm (B–F, J–N).
The study resulted in 16 species of Hemerobiidae from Beijing although two species of them are undetermined. Eight species are newly recorded from Beijing, i.e., Drepanepteryx algida (Erichson, 1851), Hemerobius bispinus Banks, 1940, Hemerobius exoterus Navás, 1936, Hemerobius humulinus Linnaeus, 1758, Hemerobius japonicus Nakahara, 1915, Hemerobius marginatus (Stephens, 1836), Hemerobius subtriangulus Yang, 1987 and Sympherobius manchuricus Nakahara, 1960. Seven species of them, except D. algida, were recorded from Beijing in an unpublished doctoral thesis (
Hemerobius humulinus and Hemerobius japonicus possess a minimum mean interspecific distance 5.3% (Suppl. material
The study obtained COI barcodes from two species of Mantispidae, i.e., Eumantispa harmandi (Navás, 1909) and Mantispa styriaca (Poda, 1761), and from one species of Dilaridae (Dilar hastatus Zhang, Liu, H. Aspöck & U. Aspöck, 2014;
Four species of Myrmeleontidae, i.e., Dendroleon pantherinus (Fabricius, 1787), Distoleon nigricans (Matsumura, 1905), Euroleon coreanus (Okamoto, 1926) and Myrmeleon bore (Tjeder, 1941) and one species of Ascalaphidae [Protidricerus japonicus (McLachlan, 1891)] from Beijing were studied. The consequence of two species delimitation methods is consistent with our identification based on morphology.
Within the past few years, DNA sequence-based approaches have become more and more popular for the assessment of biodiversity and identification of species, in particular where the traditional morphology-based identification is hard to apply (
The present DNA barcode library of Neuroptera from Beijing stands an important step not only for the molecular identification of lacewing species from Beijing but also for the future construction of DNA barcode database of Neuroptera from China. In light of obvious gap between intraspecific and interspecific genetic distance, the present COI barcode data allow unambiguous identification of almost all lacewing species from Beijing herein examined. Nevertheless, it should be noted that some other methods we tested for species delimitation (i.e., ABGD and bPTP) based on present barcode data may result in some problematic identification (see above results on Semidalis aleyrodiformis, Pseudomallada spp., and Neuronema sp. 1)
According to the updated catalogue of Neuroptera from China (
Beijing is located at the eastern Palaearctic region. Among the 67 lacewing species from Beijing, 30 species (44.8% of total species) are distributed only from the Palaearctic region, while the remaining 37 species (55.2% of total species) occur in both Palaearctic and Oriental regions. The species of Chrysopidae and Hemerobiidae account for a great proportion (38.2% and 34.0% respectively) of Neuroptera in this study. They also represent substantial species numbers based on the checklist of Neuroptera from Beijing (28.4% and 25.4% respectively). Due to lack of specimens, species of Aleuropteryginae and many tribes of Myrmeleontidae were not studied here, but will be supplemented in our dataset in near future.
Our study provided the first DNA barcode library of Neuroptera from Beijing, including 49 species (73% of all lacewing species recorded in Beijing). It is clearly indicated that the use of DNA barcodes for the identification of lacewing species is promising. The present dataset will be the first step toward the DNA barcoding of Chinese Neuroptera. It is also useful for the identification of immature stages and/or females of the lacewing species from Beijing. In future study, the DNA barcoding could be applied for comparison and assessment of lacewing species diversity and its dynamic change among different types of ecosystems and regions in Beijing for understanding the effect of urbanization on this important insect group.
We are grateful to Mr. Jiangang Guo, Mr. Lianxiang Zhao, and Dr. Hu Li for their kind help in collecting activities. This research was supported by the Beijing Natural Science Foundation (No. 5162016), and Pilot Program of Biodiversity Survey and Assessment (2016HB2096001006).
Figure S1. Photographs of male genitalia of species of Coniopterygidae newly recorded from Beijing
Figure S2. Photographs of male genitalia of species of Chrysopidae newly recorded from Beijing
Figure S3. Photographs of male genitalia of species of Hemerobiidae newly recorded from Beijing
Figure S4. Neighbor-joining tree based on the COI sequence dataset of Chrysopidae
File S1. List of all specimens used in this study, including GenBank accession numbers
File S2. Checklist of the species of Neuroptera from Beijing
Table S1. Intraspecific and interspecific divergence of Coniopterygidae based on COI barcode sequences (%)
Table S2. Intraspecific and interspecific divergence of Chrysopidae based on COI barcode sequences (%)
Table S3. Intraspecific and interspecific divergence of Hemerobiidae based on COI barcode sequences (%)
Table S4. Intraspecific and interspecific divergence of Myrmeleontidae and Ascalaphidae based on COI barcode sequences (%)