Research Article
Print
Research Article
The incredible diversity of Labiobaetis Novikova & Kluge in New Guinea revealed by integrative taxonomy (Ephemeroptera, Baetidae)
expand article infoThomas Kaltenbach§, Jean-Luc Gattolliat§
‡ Museum of Zoology, Lausanne, Switzerland
§ University of Lausanne, Lausanne, Switzerland
Open Access

Abstract

Material collected between 1999 and 2011 in Papua New Guinea and the Papua Province of Indonesia unveiled the enormous diversity of Labiobaetis on this island. Twenty-six new species were identified and delimited by integrative taxonomy using genetic distance (COI, Kimura-2-parameter) and morphology. These new species are described and illustrated based on larvae, augmenting the total number of Labiobaetis species on the island of New Guinea to 32. Seven morpho-groups of species are proposed based on morphological characters and a key to all New Guinea species is provided. The generic attributes of the larvae are summarised and slightly modified based on the examinations of the new species. Results on the genetics of most species (COI) are also provided. The interspecific K2P distances are between 13% and 32%, the intraspecific distances usually between 0% and 2%. Possible reasons for the remarkable richness of this genus in New Guinea are discussed.

Keywords

COI, Indonesia, morphology, new species, Papua New Guinea, species delimitation

Introduction

The family Baetidae has the highest species diversity among mayflies, comprising more than 1000 species in 104 genera, which is approximately one quarter of all mayfly species worldwide (Gattolliat and Nieto 2009, Sartori and Brittain 2015). It has a cosmopolitan distribution with the exception of Antarctica and New Zealand. Investigations of the molecular phylogeny of the Order Ephemeroptera revealed the relatively primitive status of the family (Ogden and Whiting 2005, Ogden et al. 2009).

The genus Labiobaetis Novikova & Kluge, 1987 is one of the richest genera of Baetidae with 79 described species (Barber-James et al. 2013, Webb 2013, Shi and Tong 2014, Kubendran et al. 2014, 2015, Gattolliat et al. 2018). However, 19 species have been described based on adults only, which are providing too limited characteristics for a clear differentiation of species and may cause difficulties to associate larval and imaginal stages at a later point in time. The distribution of Labiobaetis is nearly worldwide, with the exception of the Neotropical realm and New Caledonia, and it is extremely diversified in the Afrotropical (28 species) and Oriental realms (23 species) (Gattolliat and Nieto 2009). The status and validity of the genus has often been the subject of controversy during the last two decades (Lugo-Ortiz and McCafferty 1997, Lugo-Ortiz et al. 1999, Gattolliat 2001, Fujitani et al. 2003, Fujitani 2008, Gattolliat and Staniczek 2011; Kluge 2012; Kubendran et al. 2015, Kluge and Novikova 2016). Furthermore, molecular reconstructions indicated that the concept of Labiobaetis is most probably at least diphyletic (Monaghan et al. 2005, Gattolliat et al. 2008).

Originally Labiobaetis was established as a subgenus of Baetis Leach (Novikova and Kluge 1987) and later elevated to generic rank by McCafferty and Waltz (1995). Some of the species were originally described as and for a long time remained classified in the genus Baetis (Agnew 1961, Gillies 1993, 1994, Müller-Liebenau and Soldán 1981, Müller-Liebenau 1982, Müller-Liebenau 1984a, b, Müller-Liebenau and Hubbard 1985). Some characters of Labiobaetis, especially a process at the outer apical margin of the antennal scape and a distomedial excavation at maxillary palp segment II of the larvae, were already recognised as diagnostic characters by Müller-Liebenau (1969) when she established the atrebatinus group of species within the genus Baetis from Europe. Later, Morihara and McCafferty (1979b) introduced the propinquus group of Baetis species from North America, based on the same characters and Müller-Liebenau (1984a) proposed the molawinensis group of Baetis species from the Oriental Region, based on the above and some additional characters. Müller-Liebenau (1984a) also proposed the atrebatinus complex comprising the atrebatinus, propinquus and molawinensis groups of species. The concept of Labiobaetis as proposed by McCafferty and Waltz (1995) encompassed the whole atrebatinus complex (and as a consequence the three species groups) and therefore had a distribution including North America, Europe and Asia. Lugo-Ortiz and McCafferty (1997) increased the distribution of the genus by describing six new species of Labiobaetis from the Afrotropics and transferring eight Afrotropical species to this genus. Later the genus was reorganised under the name Pseudocloeon with Labiobaetis as junior synonym by Lugo-Ortiz et al. (1999) based on adult morphology. However, Gattolliat (2001) contradicted this opinion by the reason that the larval stage of the type-species P. kraepelini Klapálek remained unknown and a complete analysis of the generic situation was therefore not possible, in the meantime, he also proposed to restrict the concept of Pseudocloeon to the type-species P. kraepelini, which is in line with a previous proposal of Waltz and McCafferty (1985,1987) and to wait with the final generic assignment of all the species until a global revision of these genera could be done based on material from their whole distribution range. This proposal is today generally followed by most authors (Fujitani et al. 2003, McCafferty et al. 2010, Kluge and Novikova 2011, 2014, 2016, Kubendran et al. 2014, Shi and Tong 2014). Recently, Kluge and Novikova (2016) established a new tribe Labiobaetini including the genera Labiobaetis and Pseudopannota Waltz & McCafferty, 1987, based on a unique combination of imaginal and larval characters. They also formally transferred all the species of Pseudocloeon to Labiobaetis, except the type species Pseudocloeon kraepelini.

Up to now there was only one study on Labiobaetis s. l. under the genus name Pseudocloeon Klapálek, 1905 from New Guinea (Lugo-Ortiz et al. 1999) with descriptions of six new species: P. involutum Lugo-Ortiz & McCafferty, P. petersorum Lugo-Ortiz & McCafferty, P. tuberpalpus Lugo-Ortiz & McCafferty, P. vitile Lugo-Ortiz & McCafferty, P. vultuosum Lugo-Ortiz & McCafferty and P. xeniolum Lugo-Ortiz & McCafferty. Here we are describing 26 new species of Labiobaetis based on recently collected larvae from different locations in New Guinea, including both Papua New Guinea and the Papua Province of Indonesia. Thereby we are considering Labiobaetis in a broad sense, even if we presume that the genus is probably polyphyletic. We are currently still missing morphological characters and especially genetic evidence to split the genus into monophyletic lineages. Genetic studies on species from all realms involving nuclear genes are necessary to unveil the generic delimitation of Labiobaetis at a later point in time.

Materials and methods

The specimens were mainly collected by Michael Balke (Zoologische Staatssammlung München, ZSM, Germany) and members of his local team in Papua New Guinea and Indonesia (Papua Province). Further specimens were collected by L. Čížek (Institute of Entomology, Biology Centre CAS, České Budějovice) and Katayo Sagata (University of Papua New Guinea).

The specimens were preserved in 70%–96% ethanol. The dissection of larvae was done in Cellosolve (2-Ethoxyethanol) under Olympus SZX7 stereomicroscope and mounted on slides with Euparal liquid.

The DNA of part of the specimens was extracted by using non-destructive methods, which allows for subsequent morphological analysis (see Vuataz et al. 2011 for details). We amplified a 658 bp fragment of the mitochondrial gene cytochrome oxidase subunit 1 (COI) using the primers LCO 1490 (GGTCAACAAATCATAAAGATATTGG) and HCO 2198 (TAAACTTCAGGGTGACCAAAAAATCA) (Folmer et al. 1994). The polymerase chain reaction was conducted with an initial denaturation temperature of 98 °C for 30 sec followed by a total of 37 cycles with denaturation temperature of 98 °C for 10 sec, an annealing temperature of 50 °C for 30 sec and an extension at 72 °C for 30 sec, final extension at 72 °C for 2 min. Sequencing was done with Sanger’s method (Sanger et al. 1977). The genetic variability between specimens was estimated using Kimura-2-parameter distances (K2P, Kimura 1980) as well as p-distances, both of which were calculated with the program MEGA 7 (Kumar et al. 2016, http://www.megasoftware.net). The GenBank accession numbers are given in Table 1, nomenclature and ranking for genetic sequences was done according to Chakrabarty et al. 2013.

Drawings were made using an Olympus BX43 microscope. Photographs of larvae were taken with a Canon EOS 6D camera and the Visionary Digital Passport imaging system (http://www.duninc.com) and processed with the programs Adobe Photoshop Lightroom (http://www.adobe.com) and Helicon Focus version 5.3 (http://www.heliconsoft.com). Photographs were subsequently enhanced with Adobe Photoshop Elements 13.

The distribution map was generated with the program Simple Mapper (http://research.amnh.org/pbi/maps), the program GEOLocate (http://www.museum.tulane.edu/geolocate/web/WebGeoref.aspx) as well as Google Earth (http://www.google.com/earth/download/ge/) were used to attribute approximate GPS coordinates to sample locations of Lugo-Ortiz et al. (1999) and of L. inopinatus sp. n.

The taxonomic descriptions and the key presented herein were generated with a DELTA (Dallwitz 1980, Dallwitz et al. 1999) database containing the morphological states of characters of Labiobaetis species of New Guinea.

The new species described in this study were all compared to paratypes (on slides) of the six known species from New Guinea (deposited in Purdue University, West Lafayette, Indiana, USA).

For the terminology, we are referring to Hubbard (1995) and Morihara and McCafferty (1979a).

Table 1.

Sequenced specimens.

Species Locality Specimen catalog # GenBank # (COI) GenSeq Nomenclature
L. balkei sp. n. Papua New Guinea, Central Prov. GBIFCH 00465156 MH619492 genseq-1 COI
GBIFCH 00465157 MH619493 genseq-2 COI
L. lobatus sp. n. Papua New Guinea, Central Prov. GBIFCH 00508141 MH619503 genseq-1 COI
L. michaeli sp. n. Papua New Guinea, Eastern Highlands GBIFCH 00508129 MH619477 genseq-1 COI
GBIFCH 00508130 MH619478 genseq-2 COI
GBIFCH 00508134 MH619484 genseq-2 COI
L. claudiae sp. n. Papua New Guinea, Madang Prov. GBIFCH 00508144 MH619479 genseq-1 COI
L. stagnum sp. n. Indonesia, Papua Prov. GBIFCH 00465168 MH619491 genseq-2 COI
L. orientis sp. n. Papua New Guinea, Eastern Highlands GBIFCH 00465169 MH619496 genseq-1 COI
L. papuaensis sp. n. Indonesia, Papua Prov. GBIFCH 00465170 MH619502 genseq-1 COI
L. gladius sp. n. Papua New Guinea, Western Highlands GBIFCH 00465179 MH619486 genseq-4 COI
L. janae sp. n. Indonesia, Papua Prov. GBIFCH 00465181 MH619483 genseq-1 COI
GBIFCH 00465182 MH619489 genseq-2 COI
L. branchiaesetis sp. n. Papua New Guinea, Eastern Highlands GBIFCH 00465183 MH619480 genseq-1 COI
L. planus sp. n. Indonesia, Papua Prov. GBIFCH 00508149 MH619485 genseq-2 COI
GBIFCH 00508150 MH619487 genseq-2 COI
L. podolakae sp. n. Papua New Guinea, Eastern Highlands GBIFCH 00465194 MH619500 genseq-2 COI
L. schwanderae sp. n. Papua New Guinea, Gulf Prov. GBIFCH 00465197 MH619501 genseq-1 COI
L. altus sp. n. Papua New Guinea, Enga Prov. GBIFCH 00508131 MH619481 genseq-2 COI
L. gindroi sp. n. Indonesia, Papua Prov. GBIFCH 00465203 MH619490 genseq-2 COI
L. paravitilis sp. n. Papua New Guinea, Madang Prov. GBIFCH 00508148 MH619482 genseq-2 COI
L. paravultuosus sp. n. Papua New Guinea, Enga Prov. GBIFCH 00465213 MH619498 genseq-1 COI
GBIFCH 00465214 MH619499 genseq-2 COI
L. centralensis sp. n. Papua New Guinea, Central Prov. GBIFCH 00465215 MH619495 genseq-1 COI
GBIFCH 00465216 MH619494 genseq-2 COI
L. elisae sp. n. Papua New Guinea, Western Highlands GBIFCH 00465219 MH619497 genseq-1 COI
L. vallus sp. n. Papua New Guinea, Madang Prov. GBIFCH 00465226 MH619488 genseq-1 COI

Results

New species descriptions

Abbreviations:

MZLMuseum of Zoology Lausanne (Switzerland)

ZSMZoologische Staatssammlung München (Germany)

MZBMuseum Zoologicum Bogoriense (Indonesia)

List of species

balkei group

1. L. balkei sp. n.

2. L. lobatus sp. n.

3. L. michaeli sp. n.

claudiae group

4. L. claudiae sp. n.

5. L. stagnum sp. n.

orientis group

6. L. orientis sp. n.

7. L. papuaensis sp. n.

petersorum group

8. L. petersorum

9. L. gladius sp. n.

10. L. janae sp. n.

tuberpalpus group

11. L. tuberpalpus

12. L. branchiaesetis sp. n.

13. L. magnovaldus sp. n.

14. L. planus sp. n.

15. L. podolakae sp. n.

16. L. rutschmannae sp. n.

17. L. schwanderae sp. n.

vitilis group

18. L. vitilis

19. L. altus sp. n.

20. L. gindroi sp. n.

21. L. paravitilis sp. n.

22. L. wilhelmensis sp. n.

vultuosus group

23. L. vultuosus

24. L. paravultuosus sp. n.

not assigned to a group

25. L. centralensis sp. n.

26. L. dendrisetis sp. n.

27. L. elisae sp. n.

28. L. inopinatus sp. n.

29. L. involutus

30. L. pindaundensis sp. n.

31. L. vallus sp. n.

32. L. xeniolus

Figure 1. 

Labiobaetis, states of selected characters: a-f setae of the labrum dorsal, submarginal arc of setae a simple b feathered c dendritic d spatulate e lanceolate f lanceolate with apical pectination; g–k labial palp, distomedial protuberance of segment II and shape of segment III, g lobed and slightly pentagonal h compact, rounded and conical i hook-like and slightly pentagonal j thumb-like elongated and about semicircular k short thumb-like and oblong; l-m left mandible, l outermost denticle blade-like m denticles unmodified; n–p maxillary palp segment II, n with distolateral excavation o with slight distolateral excavation p without distolateral excavation; q–s paraproct, q distally expanded r distally slightly expanded s distally not expanded.

L. balkei group of species

The group is characterised by a large, lobed, distomedial protuberance of labial palp segment II and a dorsal, submarginal arc of setae of the labrum composed of spatulate, apically pectinate setae.

Labiobaetis balkei sp. n.

Figures 2, 3, 58a, 64a

Diagnosis

Larva. Following combination of characters: A) labrum dorsal submarginal arc of setae composed of 10–11 spatulate, apically pectinate setae; B) labial palp segment II with a large, lobed distomedial protuberance; C) fore femur length ca. 3× maximum width, dorsally with a row of ca. 17 curved, spine-like setae on margin and a few curved, spine-like setae near proximal margin ; D) tibia dorsally with stout, spatulate, apically rounded setae along margin; E) claw with a row of 11–12 denticles; F) paraproct distally expanded.

Description

Larva (Figs 2, 3, 58a). Body length 5.3 mm.

Colouration. Head, thorax and abdomen dorsally brown, thorax with brighter, faint pattern as in Fig. 58a. Head and thorax with bright median, dorsal suture. Thorax and abdomen ventrally colourless, femur with brown, distomedial spot, dorsal margin of femur brown, legs otherwise colourless, caudal filaments colourless.

Antenna with scape and pedicel sub-cylindrical, without distolateral process at scape; flagellum with lanceolate spines on apex of each segment.

Labrum (Fig. 2a, b). Rectangular, length 0.7× maximum width. Distal margin with medial emargination and a small process. Dorsally with medium, fine, simple setae scattered over surface; submarginal arc of setae composed of 10–11 long, spatulate, apically pectinate setae. Ventrally with marginal row of setae composed of lateral and anterolateral long, feathered setae and medial long, bifid setae; ventral surface with 12 short, spine-like setae near lateral and anterolateral margin.

Figure 2. 

Labiobaetis balkei sp. n., larva morphology: a Labrum b Labrum dorsal, submarginal seta c Right mandible d Right prostheca e Left mandible f Left prostheca gHypopharynxh Maxilla i Labium.

Right mandible (Fig. 2c, d). Incisors fused. Outer and inner sets of denticles with 4 + 3 denticles plus one small intermediate denticle. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically denticulate. Margin between prostheca and mola slightly convex, with minute denticles. Tuft of setae at apex of mola present.

Left mandible (Fig. 2e, f). Incisors fused. Outer and inner sets of denticles with 4 + 3 denticles. Prostheca robust, apically with small denticles and comb-shape structure. Margin between prostheca and mola straight, with minute denticles towards subtriangular process. Subtriangular process long and slender, above level of area between prostheca and mola. Denticles of mola apically constricted. Tuft of setae at apex of mola present.

Both mandibles with lateral margins almost straight. Basal half with fine, simple setae scattered over dorsal surface.

Hypopharynx (Fig. 2g). Lingua shorter than superlingua. Lingua longer than broad; medial tuft of stout setae present; distal half not expanded. Superlingua rounded; lateral margin rounded; fine, long, simple setae along distal margin.

Maxilla (Fig. 2h). Galea-lacinia with two simple, robust apical setae under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one spine-like seta and five long, simple setae. Maxillary palp 1.2× as long as length of galea-lacinia; two segmented. Palp segment II 1.8× length of segment I. Setae on maxillary palp fine and simple, scattered over surface of segments I and II. Apex of last segment rounded, with excavation at inner distolateral margin.

Labium (Fig. 2i). Glossa basally broad, narrowing toward apex; shorter than paraglossa; inner margin with seven spine-like setae increasing in length distally; apex with three long, robust, pectinate setae; outer margin with five long, spine-like setae; ventral surface scattered with fine, simple setae. Paraglossa sub-rectangular, curved inward; apex rounded, ventrally with three rows of long, robust, apically pectinate setae; dorsally with a row of four medium, simple setae; ventrally with three long, spine-like setae near inner margin. Labial palp with segment I 0.6× length of segments II and III combined. Segment I covered with short, fine, simple setae ventrally and micropores dorsally. Segment II with a large, lobed distomedial protuberance; distomedial protuberance 0.9× width of base at segment III; inner and outer margin both with short, fine, simple setae; dorsally with two long, spine-like, simple setae. Segment III slightly pentagonal; apex slightly pointed; length 1.1× width; ventrally covered with long and medium spine-like, simple setae and short, fine, simple setae.

Hind wing pads absent.

Foreleg (Fig. 3a, b, c). Ratio of foreleg segments 1.1:1.0:0.4:0.2. Femur. Length ca. 3× maximum width. Dorsal marign with a row of 17–18 curved, spine-like setae and 1–4 curved, spine-like setae near proximal area, length of setae 0.15× maximum width of femur. Apex rounded with one pair of curved, spine-like setae and many short, stout, apically rounded setae. Many stout, lanceolate setae and a few fine, simple setae scattered along the ventral marign; femoral patch poorly developed. Tibia. Dorsal margin with stout, lanceolate, apically rounded setae and very fine, simple setae scattered. Ventral margin with a row of curved, spine-like setae and some longer, spine-like, bipectinate setae and a tuft of long, fine, simple setae on apex. Anterior surface scattered with many stout, lanceolate setae. Tibio-patellar suture present on basal 1/2. Tarsus. Dorsal margin with a row of fine, simple setae. Ventral marign with a row of curved, spine-like setae. Tarsal claw with one row of 11–12 denticles; distally pointed; with four stripes; subapical setae absent.

Figure 3. 

Labiobaetis balkei sp. n., larva morphology: aForelegb Tibia dorsal seta c Fore claw dTergum IV e Gill IV fParaproct.

Tergum (Fig. 3d). Surface with irregular rows of slightly W-shaped scale bases and scattered fine, simple setae and micropores; scales short, apically rounded. Posterior margin of tergum IV with triangular spines, wider than long.

Gills (Fig. 3e). Present on segments II–VII. Margin with small denticles intercalating fine simple setae. Tracheae extending from main trunk to inner and outer margins. Gill IV as long as length of segments V and 2/3 VI combined. Gill VII as long as length of segments VIII and 1/2 IX combined.

Paraproct (Fig. 3f). Distally expanded, with many marginal, stout spines. Surface with U-shaped scale bases and scattered fine, simple setae and micropores. Postero-lateral extension (cercotractor) with small marginal spines.

Etymology

Dedicated to Michael Balke (Zoologische Staatssammlung München, ZSM), who collected most of the fantastic material treated in this study.

Distribution

New Guinea.

Biological aspects

The specimens were collected at an altitude of 1400 m a.s.l.

Type-material

Holotype. Nymph (on slide, GBIFCH 00465156), Papua New Guinea, Central, Kokoda Trek, 1400 m, Jan 2008, 09°01.95'S, 147°44.46'E, Posman (PNG 172). Deposited in ZSM. Paratypes. 37 nymphs (2 on slides, GBIFCH 00465157, GBIFCH 00465158, 20 in alcohol, GBIFCH 00515225, deposited in MZL; 15 in alcohol, GBIFCH 00515226, deposited in ZSM), same data as holotype.

Labiobaetis lobatus sp. n.

Figures 4, 5, 58b, 64a

Diagnosis

Larva. Following combination of characters: A) labrum dorsal, submarginal arc of setae composed of 15 spatulate, apically pectinate setae; B) labial palp segment II with a large, lobed distomedial protuberance; C) fore femur length ca. 4× maximum width, dorsal margin with a row of ca. 16 curved, spine-like setae and a few spine-like setae near margin; D) fore claw with a row of 13–14 denticles; E) paraproct distally expanded.

Description

Larva (Figs 4, 5, 58b). Body length 5.3 mm; antenna: approximately 2.5× as long as head length.

Figure 4. 

Labiobaetis lobatus sp. n., larva morphology: a Labrum b Labrum dorsal, submarginal seta c Right mandible d Right prostheca e Left mandible f Left prostheca gHypopharynxh Maxilla i Labium.

Colouration. Head, thorax and abdomen dorsally brown, thorax with bright, faint pattern as in Fig. 58b. Head and thorax with brighter median, dorsal suture, forewing pads with bright striation. Head, thorax and abdomen ventrally light brown, legs and caudal filaments light brown.

Figure 5. 

Labiobaetis lobatus sp. n., larva morphology: aForelegb Fore claw cTergum IV d Gill IV eParaproct.

Antenna with scape and pedicel sub-cylindrical, without distolateral process at scape; flagellum with lanceolate spines and fine, simple setae on apex of each segment.

Labrum (Fig. 4a, b). Rectangular, length 0.7× maximum width. Distal margin with medial emargination and a small process. Dorsally with medium, fine, simple setae scattered over surface; submarginal arc of setae composed of 15 long, spatulate, apically pectinate setae. Ventrally with marginal row of setae composed of lateral and anterolateral long, feathered setae and medial long, bifid setae; ventral surface with eight short, spine-like setae near lateral and anterolateral margin.

Right mandible (Fig. 4c, d). Incisors fused. Outer and inner sets of denticles with 4 + 4 denticles. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically denticulate. Margin between prostheca and mola slightly convex, with minute denticles. Tuft of setae at apex of mola present.

Left mandible (Fig. 4e, f). Incisors fused. Outer and inner sets of denticles with 4 + 3 denticles. Prostheca robust, apically with small denticles and comb-shape structure. Margin between prostheca and mola straight, with minute denticles towards subtriangular process. Subtriangular process long and slender, above level of area between prostheca and mola. Denticles of mola apically constricted. Tuft of setae at apex of mola present.

Both mandibles with lateral margins almost straight. Basal half with fine, simple setae scattered over dorsal surface.

Hypopharynx (Fig. 4g). Lingua about as long as superlingua. Lingua longer than broad; medial tuft of stout setae present; distal half not expanded. Superlingua straight; lateral margin rounded; fine, long, simple setae along distal margin.

Maxilla (Fig. 4h). Galea-lacinia with two simple, robust apical setae under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one bipectinate, spine-like seta and six long, simple setae. Maxillary palp 1.5× as long as length of galea-lacinia; two segmented. Palp segment II about as long as segment I. Surface of maxillary palp scattered with fine and simple setae. Apex of last segment rounded, with excavation at inner distolateral margin.

Labium (Fig. 4i). Glossa basally broad, narrowing toward apex; shorter than paraglossa; inner margin with nine spine-like setae increasing in length distally; apex with two long, robust, pectinate setae, one medium and one short, robust seta; outer margin with six long spine-like setae increasing in length distally; ventral surface with fine, simple setae. Paraglossa sub-rectangular, curved inward; apex rounded; with three rows of long, robust, apically pectinate setae; dorsally with 4–5 medium, simple setae; ventrally with three long, spine-like setae near inner margin. Labial palp with segment I 0.7× length of segments II and III combined. Segment I covered with short, fine, simple setae ventrally and micropores dorsally. Segment II with a large, lobed distomedial protuberance; distomedial protuberance 0.9× width of base at segment III; inner and outer margin both with short, fine, simple setae; dorsally with two long, spine-like, simple setae. Segment III slightly pentagonal; apex slightly pointed; length 1.2× width; ventrally covered with medium spine-like, simple setae and short, fine, simple setae.

Hind wing pads absent.

Foreleg (Fig. 5a, b). Ratio of foreleg segments 1.2:1.0:0.5:0.2. Femur. Length ca. 3.5× maximum width. Dorsal margin with a row of ca. 16 curved, spine-like setae and a few stout, pointed setae near margin; length of setae 0.18× maximum width of femur. Apex rounded; with one pair of curved, spine-like setae and some short, stout, apically rounded setae. Many stout, lanceolate setae and a few fine, simple setae scattered along the ventral margin; femoral patch poorly developed. Tibia. Dorsal margin with a row of short, curved, spine-like setae. Ventral margin with a row of curved, spine-like setae and some bipectinate, spine-like setae on apex. Anterior surface scattered with stout, lanceolate setae. Tibio-patellar suture present on basal 1/2. Tarsus. Dorsal margin almost bare. Ventral margin with a row of curved, spine-like setae. Tarsal claw with one row of 13–14 denticles; distally pointed; with six stripes; subapical setae absent.

Tergum (Fig. 5c). Surface scattered with U-shaped scale bases and micropores. Posterior margin of tergum IV with triangular spines, wider than long.

Gills (Fig. 5d). Present on segments II–VII. Margin with small denticles intercalating fine simple setae. Tracheae extending from main trunk to inner and outer margins. Gill IV as long as length of segments V and 2/3 VI combined. Gill VII as long as length of segments VIII and 2/3 IX combined.

Paraproct (Fig. 5e). Distally expanded, with many marginal, stout spines. Surface with U-shaped scale bases and scattered fine, simple setae and micropores. Postero-lateral extension (cercotractor) with small marginal spines.

Etymology

Refers to the large, lobed, distomedial protuberance of labial palp segment II.

Distribution

New Guinea.

Biological aspects

The specimens were collected at an altitude of 1390 m a.s.l.

Type-material

Holotype. Nymph (on slide, GBIFCH 00508141), Papua New Guinea, Central, Kokoda Trek, 1390 m, Jan 2008, 09°00.34'S, 147°44.25'E, Posman (PNG 173). Deposited in ZSM. Paratypes. 34 nymphs (2 on slides, GBIFCH 00465161, GBIFCH 00465162, 20 in alcohol, GBIFCH 00515232, deposited in MZL; 12 in alcohol, GBIFCH 00515233, deposited in ZSM), same data as holotype.

Labiobaetis michaeli sp. n.

Figures 6, 7, 58c, 64a

Diagnosis

Larva. Following combination of characters: A) labrum dorsal, submarginal arc of setae composed of 14–16 spatulate, apically pectinate setae; B) labial palp segment II with a large, lobed distomedial protuberance; C) fore femur rather broad, length ca. 3× maximum width, dorsal margin with a row of ca. 19 curved, spine-like setae and a few spine-like setae near margin; D) fore claw with 11–12 denticles; E) paraproct distally slightly expanded.

Description

Larva (Figs 6, 7, 58c). Body length 7.5 mm; antenna: approximately twice as long as head length.

Figure 6. 

Labiobaetis michaeli sp. n., larva morphology: a Labrum b Seta of the labrum dorsal submarginal arc c Right mandible d Right prostheca e Left mandible f Left prostheca gHypopharynxh Maxilla i Labium.

Figure 7. 

Labiobaetis michaeli sp. n., larva morphology: aForelegb Fore claw cTergum IV d Gill IV eParaproct.

Colouration. Head, thorax and abdomen dorsally brown, thorax with bright, faint pattern as in Fig. 58c. Head and thorax with bright median, dorsal suture, forewing pads with bright striation. Head, thorax and abdomen ventrally light brown, legs light brown with brown spots distomedially on femur and proximally on tibia, caudal filaments light brown.

Antenna with scape and pedicel sub-cylindrical, without distolateral process at scape; flagellum with lanceolate spines and fine, simple setae on apex of each segment.

Labrum (Fig. 6a, b). Rectangular, length 0.7× maximum width. Distal margin with medial emargination and a small process. Dorsally with medium, fine, simple setae scattered over surface; submarginal arc of setae composed of 14–16 long, spatulate, apically pectinate setae.. Ventrally with marginal row of setae composed of lateral and anterolateral long, feathered setae and medial long, bifid, pectinate setae; ventral surface with eight short, spine-like setae near lateral and anterolateral margin.

Right mandible (Fig. 6c, d). Incisors fused. Outer and inner sets of denticles with 4 + 4 denticles. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically denticulate. Margin between prostheca and mola straight, with minute denticles. Tuft of setae at apex of mola present.

Left mandible (Fig. 6e, f). Incisors fused. Outer and inner sets of denticles with 4 + 4 denticles. Prostheca robust, apically with small denticles and comb-shape structure. Margin between prostheca and mola straight, with minute denticles towards subtriangular process. Subtriangular process long and slender, above level of area between prostheca and mola. Denticles of mola apically constricted. Tuft of setae at apex of mola present.

Both mandibles with lateral margins almost straight. Basal half with fine, simple setae scattered over dorsal surface.

Hypopharynx (Fig. 6g). Lingua about as long as superlingua. Lingua longer than broad; medial tuft of stout setae present; distal half not expanded. Superlingua straight; lateral margin rounded; fine, long, simple setae along distal margin.

Maxilla (Fig. 6h). Galea-lacinia with two simple, robust apical setae under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one bipectinate, spine-like seta and 5–6 long, simple setae. Maxillary palp 1.4× as long as length of galea-lacinia; two segmented. Palp segment II about as long as segment I. Setae on maxillary palp fine and simple, scattered over surface of segments I and II. Apex of last segment rounded, with excavation at inner distolateral margin.

Labium (Fig. 6i). Glossa basally broad, narrowing toward apex; shorter than paraglossa; inner margin with nine spine-like setae increasing in length distally; apex with two long and one medium, robust, pectinate setae; outer margin with six long spine-like setae increasing in length distally; ventral surface with short, fine, simple setae. Paraglossa sub-rectangular, curved inward; apex rounded; with three rows of long, robust, apically pectinate setae; dorsally with 6–8 medium, simple setae; ventrally with three long, spine-like setae near inner margin. Labial palp with segment I 0.8× length of segments II and III combined. Segment I covered with short, fine, simple setae ventrally and micropores dorsally. Segment II with large, lobed distomedial protuberance; distomedial protuberance 0.9× width of base at segment III; inner and outer margin both with short, fine, simple setae; dorsally with two long, spine-like, simple setae. Segment III slightly pentagonal; apex slightly pointed; length 1.3× width; ventrally covered with medium spine-like, simple setae and short, fine, simple setae.

Hind wing pads absent.

Foreleg (Fig. 7a, b). Ratio of foreleg segments 1.3:1.0:0.6:0.1. Femur. Length ca. 3× maximum width. Dorsal margin with a row of ca. 19 curved, spine-like setae and with some stout, pointed setae near margin; length of setae 0.2× maximum width of femur. Apex rounded; with one pair of curved, spine-like setae and some short, stout, pointed setae. Many stout, lanceolate setae and a few fine, simple setae scattered along the ventral margin; femoral patch poorly developed. Tibia. Dorsal margin with a row of short, curved, spine-like setae and fine, simple setae. Ventral margin with a row of curved, spine-like setae and some longer, spine-like, bipectinate setae and a tuft of long, fine, simple setae on apex. Anterior surface scattered with stout, lanceolate setae. Tibio-patellar suture present on basal 1/2. Tarsus. Dorsal margin almost bare. Ventral margin with a row of curved, spine-like setae. Tarsal claw with one row of 11–12 denticles; distally pointed; with 4–5 stripes; subapical setae absent.

Tergum (Fig. 7c). Surface with irregular rows of U-shaped scale bases and scattered fine, simple setae and micropores, scales short, apically rounded. Posterior margin of tergum IV with rounded or pentagonal spines, wider than long.

Gills (Fig. 7d). Present on segments II - VII. Margin with small denticles intercalating fine simple setae. Tracheae extending from main trunk to inner and outer margins. Gill IV as long as length of segments V and 1/2 VI combined. Gill VII as long as length of segments VIII and 1/3 IX combined.

Paraproct (Fig. 7e). Distally slightly expanded, with many marginal, stout spines. Surface with U-shaped scale bases and scattered fine, simple setae and micropores. Postero-lateral extension (cercotractor) with small marginal spines.

Etymology

Dedicated to Michael Balke (Zoologische Staatssammlung München, ZSM), who collected most of the fantastic material treated in this study.

Distribution

New Guinea.

Biological aspects

The specimens were collected at an altitude of 2200 m a.s.l.

Type-material

Holotype. Nymph (on slide, GBIFCH 00508129), Papua New Guinea, Eastern Highlands, Akameku-Brahmin, Bismarck Range, 2200 m, 23 Nov 2006, 05°56.80'S, 145°22.24'E, Balke & Kinibel (PNG 106). Deposited in ZSM. Paratypes. 9 nymphs (3 on slides, GBIFCH 00465163, GBIFCH 00465164, GBIFCH 00508130, 4 in alcohol, GBIFCH 00515230, GBIFCH 00508134, deposited in MZL; 2 in alcohol, GBIFCH 00515231, deposited in ZSM), same data as holotype.

L. claudiae group of species

The group is characterised by an elongated, thumb-like protuberance of labial palp segment II and a dorsal, submarginal arc of setae composed of simple setae. Additionally, the gills have both longer and shorter fine, simple setae at the margin and the femoral patch is well developed.

Labiobaetis claudiae sp. n.

Figures 8, 9, 58d, 64a

Diagnosis

Larva. Following combination of characters: A) labrum dorsal submarginal arc of setae composed of one plus five long, simple setae; B) labial palp segment II with an elongated thumb-like distomedial protuberance, segment III subrectangular; C) fore femur rather broad, length ca. 3× width, dorsal margin with a row of ca. 27 curved, spine-like setae; D) gills with small denticles and both medium and long, fine simple setae on margin; E) paraproct distally not expanded, with ca. 18 marginal, stout spines.

Description

Larva (Figs 8, 9, 58d). Body length 5.3 mm; antenna: approximately twice as long as head length.

Figure 8. 

Labiobaetis claudiae sp. n., larva morphology: a Labrum b Right mandible c Right prostheca d Left mandible e Left prostheca fHypopharynxg Maxilla h Labium.

Figure 9. 

Labiobaetis claudiae sp. n., larva morphology: aForelegb Fore claw cTergum IV d Gill IV eParaproct.

Colouration. Head, thorax and abdomen dorsally brown, head and thorax with bright median, dorsal suture, thorax with bright pattern as in Fig. 58d, abdominal segments I, V, VI, IX and X light brown, other segments dark brown. Head, thorax and abdomen ventrally light brown, legs transparent with brown spots distomedially on femur and proximally on tibia and tarsus, caudal filaments brown.

Antenna with scape and pedicel sub-cylindrical, without distolateral process at scape; flagellum with broad, lanceolate spines and fine, simple setae on apex of each segment.

Labrum (Fig. 8a). Rectangular, length 0.6× maximum width. Distal margin with medial emargination and a small process. Dorsally with medium, fine, simple setae scattered over surface; submarginal arc of setae composed of one plus five long, simple setae. Ventrally with marginal row of setae composed of anterolateral long, feathered setae and medial long, bifid, pectinate setae; ventral surface with seven short, spine-like setae near lateral and anterolateral margin.

Right mandible (Fig. 8b, c). Incisors fused. Outer and inner sets of denticles with 4 + 4 denticles. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically denticulate. Margin between prostheca and mola straight. Tuft of setae at apex of mola present.

Left mandible (Fig. 8d, e). Incisors fused. Outer and inner sets of denticles with 3 + 3 denticles and one minute intermediate denticle. Prostheca robust, apically with small denticles and comb-shape structure. Margin between prostheca and mola straight. Subtriangular process long and slender, above level of area between prostheca and mola. Denticles of mola apically constricted. Tuft of setae at apex of mola present.

Both mandibles with lateral margins almost straight. Basal half with fine, simple setae scattered over dorsal surface.

Hypopharynx (Fig. 8f). Lingua shorter than superlingua. Lingua longer than broad; medial tuft of stout setae present; distal half laterally expanded. Superlingua straight; lateral margin straight; fine, long, simple setae along distal margin.

Maxilla (Fig. 8g). Galea-lacinia with one simple, robust apical seta under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one bipectinate, spine-like seta and 5–6 long, simple setae. Maxillary palp slightly longer than length of galea-lacinia; two segmented. Palp segment II 1.3× length of segment I. Setae on maxillary palp fine and simple, scattered over surface of segments I and II. Apex of last segment constricted, without excavation at inner distolateral margin.

Labium (Fig. 8h). Glossa basally broad, narrowing toward apex; shorter than paraglossa; inner margin with six spine-like setae increasing in length distally; apex with three long, robust setae; outer margin with 4–5 long, spine-like setae increasing in length distally; ventral surface with fine, simple, scattered setae. Paraglossa sub-rectangular, curved inward, apex rounded; ventrally with three rows of long, robust, distally pectinate setae in apical area and a row of 3–4 medium, simple setae in anteromedial area; dorsally with a row of 3–4 long, spine-like setae near inner margin. Labial palp with segment I 0.8× length of segments II and III combined. Segment I covered with short, fine, simple setae ventrally and micropores dorsally. Segment II with an elongated, thumb-like distomedial protuberance; distomedial protuberance 0.4× width of base of segment III; inner and outer margin both with short, fine, simple setae; dorsally with row of three long, spine-like setae in anteromedial area. Segment III subrectangular; apex truncate; length 0.9× width; ventrally covered with medium spine-like, simple setae and short, fine, simple setae.

Hind wing pads absent.

Foreleg (Fig. 9a, b). Ratio of foreleg segments 1.3:1.0:0.6:0.2. Femur. Length ca. 3× maximum width. Dorsal margin with a row of ca. 27 curved, spine-like setae; length of setae 0.16× maximum width of femur. Apex rounded; with two pairs of curved, spine-like setae and some short, stout setae. Many stout, lanceolate setae scattered along the ventral margin; femoral patch well developed. Tibia. Dorsal margin with a row of stout, lanceolate setae and very fine, simple setae. Ventral margin with a row of curved, spine-like setae, on apex one stout, spine-like seta and a tuft of long, fine, simple setae. Anterior surface scattered with stout, lanceolate setae. Tibio-patellar suture present on basal 2/3 area. Tarsus. Dorsal margin with a row of short, curved, spine-like setae. Ventral margin with a row of curved, spine-like setae. Tarsal claw with one row of 12–13 denticles; distally pointed; with eight stripes; subapical setae absent.

Tergum (Fig. 9c). Surface with irregular rows of U-shaped scale bases and scattered micropores. Posterior margin of tergum IV with triangular spines, longer than wide.

Gills (Fig. 9d). Present on segments II–VII. Margin with small denticles intercalating both medium and long, fine, simple setae. Tracheae extending from main trunk to inner and outer margins. Gill IV as long as length of segments V and 2/3 VI combined. Gill VII as long as length of segments VIII and IX combined.

Paraproct (Fig. 9e). Distally not expanded, with ca. 18 marginal, stout spines. Surface scattered with U-shaped scale bases and fine, simple setae and micropores. Postero-lateral extension (cercotractor) with small marginal spines.

Etymology

Dedicated to Claudia Kaltenbach, the wife of one of the authors (TK) for her constant support during the study.

Distribution

New Guinea.

Biological aspects

The specimens were collected in a ford at an altitude of 80 m a.s.l.

Type-material

Holotype. Nymph (on slide, GBIFCH 00508144), Papua New Guinea, Madang, highway nr Madang, ford, 80 m, 26 Nov and 2–3 Dec 2006, 05°24.41'S, 145°38.21'E, Binatang Boys (PNG 117). Deposited in ZSM. Paratypes. 4 nymphs (2 on slide, GBIFCH 00508145, GBIFCH 00465165, 2 in alcohol, GBIFCH 00515229, deposited in MZL), same data as holotype.

Labiobaetis stagnum sp. n.

Figures 10, 11, 59a, 64a

Diagnosis

Larva. Following combination of characters: A) labrum dorsal submarginal arc of setae composed of one plus six long, simple setae; B) maxillary palp about as long as length of galea-lacinia; C) labial palp segment II with an elongated, thumb-like distomedial protuberance; D) fore femur rather broad, length ca. 3× maximum width, dorsal margin with a row of ca. 18 curved, spine-like setae on margin and a few stout, pointed setae near margin; E) fore claw with 10–12 denticles.

Description

Larva (Figs 10, 11, 59a). Body length 4.5 mm; antenna: approximately twice as long as head length.

Figure 10. 

Labiobaetis stagnum sp. n., larva morphology: a Labrum b Right mandible c Right prostheca d Left mandible e Left prostheca fHypopharynxg Maxilla h Labium.

Figure 11. 

Labiobaetis stagnum sp. n., larva morphology: aForelegb Fore claw cTergum IV d Gill IV eParaproct.

Colouration. Head, thorax and abdomen dorsally brown, head and thorax with bright median, dorsal suture, head, thorax and abdomen with bright pattern as in Fig. 59a, forewing pads with brown striation. Head, thorax and abdomen ventrally light brown, legs light brown with a brown spot distomedially on femur and medially on tibia, dorsal margin of femur brown, tarsus proximally brown. Caudal filaments light brown with a dark brown section at 3/4 of length of cerci, cerci with 2nd dark brown section near the tip.

Antenna with scape and pedicel sub-cylindrical, without distolateral process at scape; flagellum with broad, lanceolate spines and fine, simple setae on apex of each segment.

Labrum (Fig. 10a). Rectangular, length 0.6× maximum width. Distal margin with medial emargination and a small process. Dorsally with many medium to long, fine, simple setae in posterior area; submarginal arc of setae composed of one plus 5–6 long, simple setae. Ventrally with marginal row of setae composed of lateral and anterolateral long, pectinate setae and medial long, bifid, pectinate setae; ventral surface with six short, spine-like setae near lateral and anterolateral margin.

Right mandible (Fig. 10b, c). Incisors fused. Outer and inner sets of denticles with 4 + 4 denticles. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically denticulate. Margin between prostheca and mola slightly convex. Tuft of setae at apex of mola present.

Left mandible (Fig. 10d, e). Incisors fused. Outer and inner sets of denticles with 4 + 3 (sometimes four) denticles. Prostheca robust, apically with small denticles and comb-shape structure. Margin between prostheca and mola slightly convex. Subtriangular process long and slender, above level of area between prostheca and mola. Denticles of mola apically constricted. Tuft of setae at apex of mola present.

Both mandibles with lateral margins almost straight. Basal half with fine, simple setae scattered over dorsal surface.

Hypopharynx (Fig. 10f). Lingua shorter than superlingua. Lingua about as broad as long; medial tuft of stout setae present; distal half laterally expanded. Superlingua rounded; lateral margin straight; fine, long, simple setae along distal margin.

Maxilla (Fig. 10g). Galea-lacinia with two simple, robust apical setae under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one bipectinate, spine-like seta and 5–6 long, simple setae. Maxillary palp slightly longer than length of galea-lacinia; two segmented. Palp segment II 1.9× length of segment I. Setae on maxillary palp fine and simple, scattered over surface of segments I and II. Apex of last segment constricted, without excavation at inner distolateral margin.

Labium (Fig. 10h). Glossa basally broad, narrowing toward apex; shorter than paraglossa; inner margin with 8–9 spine-like setae increasing in length distally; apex with two long and one short, robust, pectinate setae; outer margin with seven spine-like setae increasing in length distally; ventral surface with fine, simple, scattered setae. Paraglossa sub-rectangular, curved inward; apex rounded; with three rows of long, robust, apically pectinate setae: dorsally with three medium, simple setae; ventrally with five long, spine-like setae near inner margin. Labial palp with segment I 0.8× length of segments II and III combined. Segment I covered with short, fine, simple setae ventrally and micropores dorsally. Segment II with an elongated, thumb-like distomedial protuberance; distomedial protuberance 0.6× width of base of segment III; inner and outer margin both with short, fine, simple setae; dorsally with row of 4–5 long, spine-like, simple setae. Segment III semicircular; apex rounded; length 0.8× width; ventrally covered with short and medium spine-like, simple setae and short, fine, simple setae.

Hind wing pads absent.

Foreleg (Fig. 11a, b). Ratio of foreleg segments 1.2:1.0:0.5:0.2. Femur. Length ca. 3× maximum width. Dorsal margin with a row of ca. 17 curved, spine-like setae and a few stout, pointed setae near margin; length of setae 0.14× maximum width of femur. Apex rounded; with one pair of spine-like setae and some short, stout, pointed or apically rounded setae. Many stout, lanceolate setae and a few fine, simple setae along ventral margin; femoral patch well developed. Tibia. Dorsal margin with row of short, curved, spine-like setae and long, fine, simple setae and a row of stout, lanceolate setae near margin; one larger, robust, pointed seta on apex. Ventral margin with a row of curved, spine-like setae and some longer, spine-like, bipectinate setae and a tuft of long, fine, simple setae on apex. Anterior surface scattered with stout, lanceolate setae. Tibio-patellar suture present on basal 1/2. Tarsus. Dorsal margin with a row of short, curved, spine-like setae. Ventral margin with a row of curved, spine-like setae. Tarsal claw with one row of 10–12 denticles; distally pointed; with four stripes; subapical setae absent.

Tergum (Fig. 11c). Surface with irregular rows of U-shaped scale bases and scattered with fine, simple setae, scales short and apically rounded. Posterior margin of tergum IV with triangular spines, longer than wide.

Gills (Fig. 11d). Present on segments II–VII. Margin with small denticles intercalating both medium and long, fine, simple setae. Tracheae extending from main trunk to inner and outer margins. Gill IV as long as length of segments V and 2/3 VI combined. Gill VII as long as length of segments VIII and 1/2 IX combined.

Paraproct (Fig. 11e). Distally expanded, with many marginal, stout spines. Surface with U-shaped scale bases and scattered fine, simple setae and micropores. Postero-lateral extension (cercotractor) with small marginal spines.

Etymology

Latin word for pool, refers to the appearance in stream pools.

Distribution

New Guinea.

Biological aspects

The specimens were collected in stream pools at an altitude of 115 m a.s.l.

Type-material

Holotype. Nymph (on slide, GBIFCH 00465166), Indonesia, Papua, Setani-Maribu, stream pools, 115 m, 14 Oct 2011, 02°30.51'S, 140°22.83'E, Balke (PAP01). Temporary deposited in MZL before definitely housed in MZB. Paratypes. 9 nymphs (2 on slides, GBIFCH 00465167, GBIFCH 00465168, deposited in MZL, 5 in alcohol, GBIFCH 00515227, deposited in MZL; 2 in alcohol, GBIFCH 00515228, deposited in ZSM), same data as holotype.

L. orientis group of species

The group is characterised by a large, lobed, distomedial protuberance of labial palp segment II and a dorsal, submarginal arc of setae of the labrum composed of feathered setae.

Labiobaetis orientis sp. n.

Figures 12, 13, 64a

Diagnosis

Larva. Following combination of characters: A) labrum dorsal submarginal arc of setae composed of 14 long, feathered setae; B) labial palp segment II with a large, lobed distomedial protuberance and with segment III slightly pentagonal and slightly pointed on apex; C) hind femur slender, length ca. 4× maximum width, dorsal margin with a row of ca. 18 curved, spine-like setae and a few stout, pointed setae near margin; D) femur and tibia of hind leg ventrally with stout, bipectinate, pointed setae; E) hind tarsal claw with 14 denticles.

Description

Larva (Figs 12, 13).

Figure 12. 

Labiobaetis orientis sp. n., larva morphology: a Labrum b Right mandible c Right prostheca d Left mandible e Left prostheca fHypopharynxg Maxilla h Labium.

Figure 13. 

Labiobaetis orientis sp. n., larva morphology: a Hind leg b Femur ventral seta c Tibia ventral seta d Hind claw eTergum IV f Gill V gParaproct.

Colouration. Unknown.

Antenna with scape and pedicel sub-cylindrical, without distolateral process at scape; flagellum with lanceolate spines and fine, simple setae on apex of each segment.

Labrum (Fig. 12a). Rectangular, length 0.7× maximum width. Distal margin with medial emargination and a small process. Dorsally with many medium to long, fine, simple setae; submarginal arc of setae composed of 14 long, feathered setae. Ventrally with marginal row of setae composed of lateral and anterolateral long, feathered setae and medial long, bifid, pectinate setae; ventral surface with five short, spine-like setae near lateral and anterolateral margin.

Right mandible (Fig. 12b, c). Incisors fused. Outer and inner sets of denticles with 4 + 4 denticles. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically denticulate. Margin between prostheca and mola slightly convex. Tuft of setae at apex of mola present.

Left mandible (Fig. 12d, e). Incisors fused. Outer and inner sets of denticles with 4 + 4 denticles. Prostheca robust, apically with small denticles and comb-shape structure. Margin between prostheca and mola straight, with few minute setae. Subtriangular process long and slender, above level of area between prostheca and mola. Denticles of mola apically constricted. Tuft of setae at apex of mola present.

Both mandibles with lateral margins almost straight. Basal half with fine, simple setae scattered over dorsal surface.

Hypopharynx (Fig. 12f). Lingua about as long as superlingua. Lingua longer than broad; medial tuft of stout setae present; distal half laterally expanded. Superlingua rounded; lateral margin rounded; fine, long, simple setae along distal margin.

Maxilla (Fig. 12g). Galea-lacinia with two simple, robust apical setae under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one spine-like seta and six long, simple setae. Maxillary palp unknown.

Labium (Fig. 12h). Glossa basally broad, narrowing toward apex; shorter than paraglossa; inner margin with seven spine-like setae increasing in length distally; apex with two long and one medium, robust, pectinate setae; outer margin with eight long, spine-like setae; ventral surface with short, fine, simple setae. Paraglossa sub-rectangular, curved inward; apex rounded; with three rows of long, robust, apically pectinate setae; dorsally with three medium, simple setae; ventrally with three long, spine-like setae near inner margin. Labial palp with segment I 0.7× length of segments II and III combined. Segment I covered with short and medium, fine, simple setae ventrally and with micropores dorsally. Segment II with a large, lobed distomedial protuberance; distomedial protuberance 0.8× width of base of segment III; inner and outer margin both with short, fine, simple setae; dorsally with two long, spine-like, simple setae. Segment III slightly pentagonal; apex slightly pointed; length 1.1× width; ventrally covered with medium spine-like, simple setae and short, fine, simple setae.

Hind wing pads absent.

Hind leg (Fig. 13a, b, c, d). Ratio of hind leg segments 1.3:1.0:0.5:0.2. Hind femur. Length ca. 4× maximum width. Dorsal margin with a row of ca. 18 curved, spine-like setae and with a few stout, pointed setae near margin; length of setae 0.16× maximum width of femur. Apex rounded; with some curved spine-like setae and many short, stout setae. Many stout, lanceolate, bipectinate setae and a few fine, simple setae along ventral margin; femoral patch poorly developed. Tibia. Dorsal margin with a few curved, spine-like setae. Ventral margin with a row of curved, spine-like setae and some longer, spine-like, bipectinate setae and a tuft of long, fine, simple setae on apex. Anterior surface scattered with stout, lanceolate, bipectinate setae (pectination difficult to see). Tibio-patellar suture present on basal 1/3 area. Tarsus. Dorsal margin bare. Ventral margin with a row of curved, spine-like setae. Tarsal claw with one row of 14 denticles; tapering distally; with five stripes; subapical setae absent.

Tergum (Fig. 13e). Surface with irregular rows of U-shaped scale bases and scattered micropores. Posterior margin of tergum IV with triangular spines, wider than long.

Gills (Fig. 13f). Present on segments II–VII. Margin with small denticles and long, fine, simple setae. Tracheae extending from main trunk to inner and outer margins. Gill IV unknown, gill V as long as length of segments VI and 1/2 VII combined. Gill VII as long as length of segments VIII and 1/2 IX combined.

Paraproct (Fig. 13g). Distally expanded, with many marginal, stout spines. Surface with U-shaped scale bases and scattered fine, simple setae and micropores. Postero-lateral extension (cercotractor) with small marginal spines.

Etymology

Refers to the type locality, which is in the Eastern Highlands of Papua New Guinea.

Distribution

New Guinea.

Biological aspects

The specimen was collected at an altitude of 1700–1800 m a.s.l.

Type-material

Holotype. Nymph (on slide, GBIFCH 00465169), Papua New Guinea, Eastern Highlands, Marawaka, Ande, 1700–1800 m, 09 Nov 2006, nr 07°01.70'S, 145°49.81'E, Balke & Kinibel (PNG 87). Deposited in ZSM.

Labiobaetis papuaensis sp. n.

Figures 14, 15, 59b, 64a

Diagnosis

Larva. Following combination of characters: A) labrum dorsal submarginal arc of setae composed of 14–17 feathered setae, B) labial palp segment II with a large, lobed distomedial protuberance; C) labial palp segment III slightly pentagonal, apically slightly pointed; D) fore femur very slender, length ca. 5× maximum width, dorsal margin with a row of ca. 13 robust, slightly spatulate, apically blunt setae; E) tibia dorsal margin with a row of stout, lanceolate, apically rounded setae.

Description

Larva (Figs 14, 15, 59b). Body length 5.4 mm.

Figure 14. 

Labiobaetis papuaensis sp. n., larva morphology: a Labrum b Labrum dorsal, submarginal seta c Right mandible d Right prostheca e Left mandible f Left prostheca g Maxilla h Labium.

Figure 15. 

Labiobaetis papuaensis sp. n., larva morphology: aForelegb Femur dorsal seta c Tibia dorsal seta d Fore claw eTergum IV f Gill IV gParaproct.

Colouration. Head, thorax and abdomen dorsally brown, with bright pattern as in Fig. 59b. Head and thorax with bright median, dorsal suture, forewing pads with bright striation. Head, thorax and abdomen ventrally light brown, legs and caudal filaments light brown, femur dorsal margin brown.

Antenna with scape and pedicel sub-cylindrical, without distolateral process at scape; flagellum with lanceolate spines on apex of each segment.

Labrum (Fig. 14a, b). Rectangular, length 0.7× maximum width. Distal margin with medial emargination and a small process. Dorsally with medium, fine, simple setae scattered over surface; submarginal arc of setae composed of 14–17 long, feathered setae. Ventrally with marginal row of setae composed of lateral and anterolateral long, feathered setae and medial long, bifid, pectinate setae; ventral surface with eight short, spine-like setae near lateral and anterolateral margin.

Right mandible (Fig. 14c, d). Incisors fused. Outer and inner sets of denticles with 4 + 3 denticles. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically denticulate. Margin between prostheca and mola slightly convex. Tuft of setae at apex of mola present.

Left mandible (Fig. 14e, f). Incisors fused. Outer and inner sets of denticles with 4 + 4 denticles. Prostheca robust, apically denticulate. Margin between prostheca and mola straight, with minute denticles towards subtriangular process. Subtriangular process long and slender, above level of area between prostheca and mola. Denticles of mola apically constricted. Tuft of setae at apex of mola present.

Both mandibles with lateral margins almost straight. Basal half with fine, simple setae scattered over dorsal surface.

Hypopharynx. Unknown.

Maxilla (Fig. 14g). Galea-lacinia with two simple, robust apical setae under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one bipectinate, spine-like seta and four long, simple setae. Maxillary palp about as long as length of galea-lacinia; two segmented. Palp segment II 1.8× length of segment I. Setae on maxillary palp fine and simple, scattered over surface of segment II. Apex of last segment rounded, with an excavation at inner distolateral margin.

Labium (Fig. 14h). Glossa basally broad, narrowing toward apex; shorter than paraglossa; inner margin with nine spine-like setae increasing in length distally; apex with three long, robust, pectinate setae; outer margin with seven spine-like setae increasing in length distally; ventral surface with short, fine, simple setae. Paraglossa sub-rectangular, curved inward; apex rounded; with three rows of long, robust, apically pectinate setae; dorsally with row of six medium, simple setae; ventrally with three long, spine-like setae near inner margin. Labial palp with segment I 0.7× length of segments II and III combined. Segment I covered with micropores dorsally and ventrally with fine, simple setae along margins. Segment II with a large, lobed distomedial protuberance; distomedial protuberance 0.6× width of base of segment III; inner margin with few fine, simple setae; outer margin with few short, fine, simple setae; dorsally with a row of three long, spine-like setae. Segment III slightly pentagonal; apex slightly pointed; length 1.2× width; ventrally covered with medium spine-like, simple setae and short, fine, simple setae.

Hind wing pads absent.

Foreleg (Fig. 15a–d). Ratio of foreleg segments 1.1:1.0:0.4:0.1. Femur. Length ca. 5× maximum width. Dorsal margin with a row of ca. nine robust, slightly spatulate, apically rounded setae and four spine-like, apically pointed setae on basal area length of setae 0.17× maximum width of femur. Apex rounded; with one pair of robust, slightly spatulate, apically rounded setae and some short, stout, apically rounded setae. Many stout, broad lanceolate, apically rounded setae along ventral margin; femoral patch absent. Tibia. Dorsal margin with a row of stout, broad lanceolate, apically rounded setae. Ventral margin with a row of curved, spine-like setae and some longer, spine-like, bipectinate setae and a tuft of long, fine, simple setae on apex. Anterior surface scattered with stout, lanceolate setae. Tibio-patellar suture present on basal 1/3. Tarsus. Dorsal margin bare with a tuft of long, fine, simple setae on apex (Fig. 15d). Ventral margin with a row of curved, spine-like setae. Tarsal claw with one row of 12–13 denticles; distally pointed; with four stripes; subapical setae absent.

Tergum (Fig. 15e). Surface with irregular rows of U-shaped scale bases and scattered micropores. Posterior margin of tergum IV with rounded or triangular spines, wider than long.

Gills (Fig. 15f). Present on segments II–VII. Margin with small denticles and long, fine, simple setae. Tracheae extending from main trunk to inner and outer margins. Gill IV as long as length of segments V and VI combined. Gill VII as long as length of segments VIII, IX and 1/2 X combined.

Paraproct (Fig. 15g). Distally expanded, with many marginal, stout spines. Surface with U-shaped scale bases and scattered fine, simple setae and micropores. Postero-lateral extension (cercotractor) with small marginal spines.

Etymology

Refers to the type locality in the Papua Province of Indonesia.

Distribution

New Guinea.

Biological aspects

The specimens were collected at an altitude of 774 m a.s.l.

Type-material

Holotype. Nymph (on slide, GBIFCH 00465170), Indonesia, Papua, Road Nabire-Enarotali KM 55, 774 m, 22 Oct 2011, 03°29.80'S, 135°43.89'E, Balke (PAP09). Temporary deposited in MZL before definitely housed in MZB. Paratype. 1 nymph (on slide, GBIFCH 00465171, deposited in MZL), same data as holotype.

L. petersorum group of species

The group is characterised by mandibles with an outermost blade-like enlarged denticle, a short and rounded distomedial protuberance of labial palp segment II and a dorsal, submarginal arc of setae of the labrum composed of simple setae.

Labiobaetis petersorum (Lugo-Ortiz & McCafferty, 1999)

Figures 16, 64b

Diagnosis

Larva. Following combination of characters: A) labrum dorsal arc of setae composed of one plus 6–7 long, simple setae; B) both mandibles with outermost denticle blade-like; C) labial palp as Fig. 16c, segment II with short thumb-like distomedial protuberance; D) fore femur broad, length 2.6× maximum width, dorsal margin with a row of >40 curved, spine-like setae; E) spines at posterior margin of tergum IV triangular, pointed, longer than wide; F) paraproct distally not expanded.

Figure 16. 

Labiobaetis petersorum, larva morphology: a Right mandible b Left mandible c Labial palp dTergum IV.

Examined material

Paratypes. 4 nymphs (on slides, PERC 0 012 564, PERC 0 012 565, PERC 0 012 566, PERC 0 012 567), Papua New Guinea, Bulolo R, 2950 ft, E of Wau, 15 Oct 1964, W.L. and J.G. Peters.

Labiobaetis gladius sp. n.

Figures 17, 18, 59c, 64b

Diagnosis

Larva. Following combination of characters: A) labrum dorsal arc of setae composed of one plus 9–11 long, simple setae; B) both mandibles with outermost denticles blade-like; C) hypopharynx with concave distal margin of superlingua; D) maxillary palp somewhat longer than length of galea-lacinia; E) fore femur broad, length 2.5× maximum width, dorsal margin with a row of ca. 37 curved, spine-like setae and distally with some stout, pointed setae near margin; F) gills margin serrate with alternating smaller and bigger denticles intercalating long, fine, simple setae; G) spines at posterior margin of tergum IV rounded, wider than long; H) paraproct distally not expanded.

Description

Larva (Figs 17, 18, 59c). Body length 6.7 mm; cerci: 3.7 mm; terminal filament: 2.8 mm.

Figure 17. 

Labiobaetis gladius sp. n., larva morphology: a Labrum b Right mandible c Right prostheca d Left mandible e Left prostheca fHypopharynxg Maxilla h Labium.

Figure 18. 

Labiobaetis gladius sp. n., larva morphology: aForelegb Fore claw cTergum IV d Gill IV eParaproct.

Colouration. Head, thorax and abdomen dorsally brown, head and thorax with bright median, dorsal suture, forewing pads with slightly darker striation. Head, thorax and abdomen ventrally light brown, legs light brown and with brown marks as in Fig. 59c, caudal filaments light brown.

Antenna with scape and pedicel sub-cylindrical, without distolateral process at scape; flagellum with broad, apically blunt spines and fine, simple setae on apex of each segment.

Labrum (Fig. 17a). Rectangular, length 0.7× maximum width. Distal margin with medial emargination and a small process. Dorsally with short to medium, fine simple setae and some short, robust, simple setae on posterior area; submarginal arc of setae composed of one plus 9–11 long, simple setae. Ventrally with marginal row of setae composed of lateral and anterolateral long, feathered setae and medial long, pectinate setae, centrally bifid; ventral surface with seven short, spine-like setae near lateral and anterolateral margin.

Right mandible (Fig. 17b, c). Incisors fused. Outer and inner sets of denticles with 3 + 4 denticles, outermost denticle blade-like. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically with small denticles and comb-shape structure. Margin between prostheca and mola straight. Tuft of setae at apex of mola present.

Left mandible (Fig. 17d, e). Incisors fused. Outer and inner sets of denticles with 3 + 4 denticles plus one minute intermediate denticle, outermost denticle blade-like. Prostheca robust, apically with small denticles and comb-shape structure. Margin between prostheca and mola straight. Subtriangular process long and slender, above level of area between prostheca and mola. Denticles of mola apically constricted. Tuft of setae at apex of mola present.

Both mandibles with lateral margins almost straight. Basal half with fine, simple setae scattered over dorsal surface.

Hypopharynx (Fig. 17f). Lingua longer than superlingua. Lingua longer than width; medial tuft of stout setae present; distal half laterally expanded. Superlingua concave; lateral margin straight; fine, long, simple setae along distal margin.

Maxilla (Fig. 17g). Galea-lacinia with two simple, robust apical setae under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one bipectinate, spine-like seta and eight long, simple setae. Maxillary palp slightly longer than length of galea-lacinia; two segmented. Palp segment II 1.3× length of segment I. Setae on maxillary palp fine and simple, scattered over surface of segments I and II. Apex of last segment slightly pointed, without excavation at inner distolateral margin.

Labium (Fig. 17h). Glossa basally broad, narrowing toward apex; shorter than paraglossa; inner margin with nine spine-like setae increasing in length distally; apex with three long, robust setae; outer margin with six long spine-like setae increasing in length distally; ventral surface with few short, fine, simple setae. Paraglossa sub-rectangular, curved inward; apex rounded; with three rows of long, robust, apically pectinate setae; dorsally with row of four medium, simple setae; ventrally with four long, spine-like setae near inner margin. Labial palp with segment I 0.7× length of segments II and III combined. Segment I covered with micropores dorsally and ventrally with fine, simple setae along margins. Segment II with a short, thumb-like distomedial protuberance; distomedial protuberance 0.4× width of base of segment III; inner and outer margin both with fine, simple setae; dorsally with row of 5–6 spine-like, simple setae, decreasing in length distally. Segment III oblong; apex slightly pointed; length 1.3× width; ventrally covered with long and medium spine-like, simple setae and short, fine, simple setae.

Hind wing pads absent.

Foreleg (Fig. 18a, b). Ratio of foreleg segments 1.6:1.0:0.7:0.3. Femur. Length 2.5× maximum width. Dorsal margin with a row of ca. 37 curved, spine-like setae and distally with some stout, pointed setae near margin; length of setae 0.18× maximum width of femur. Apex rounded; with one pair of curved, spine-like setae and many short, stout, apically rounded setae. Many stout, lanceolate setae and a few fine, simple setae along ventral margin; femoral patch poorly developed. Tibia. Dorsal margin with a row of short, curved, spine-like setae and long, fine, simple setae, apically with two longer, curved, spine-like setae. Ventral margin with a row of short, spine-like setae and one stout, spine-like seta and a tuft of long, fine, simple setae on apex. Anterior surface scattered with many stout, lanceolate setae and fine, simple setae. Tibio-patellar suture present on basal 3/4. Tarsus. Dorsal margin with a row of short, spine-like setae and some long, fine, simple setae. Ventral margin with a row of curved, spine-like setae on margin. Tarsal claw with one row of eleven denticles; tapering distally; with six stripes; subapical setae absent.

Tergum (Fig. 18c). Surface with irregular rows of U-shaped scale bases and scattered fine, simple setae and micropores, scales oblong. Posterior margin of tergum IV with rounded spines, wider than long.

Gills (Fig. 18d). Present on segments II–VII. Margin with alternating smaller and bigger denticles intercalating long, fine, simple setae. Tracheae extending from main trunk to inner and outer margins, pigmentation limited to main trunk and extensions to inner margin. Gill IV as long as length of segments V and 1/2 VI combined. Gill VII as long as length of segments VIII and 1/3 IX combined.

Paraproct (Fig. 18e). Distally not expanded, with ca. 22 marginal, stout spines. Surface with U-shaped scale bases and scattered fine, simple setae and micropores. Postero-lateral extension (cercotractor) with small marginal spines.

Etymology

Latin word for sword, refers to the blade-like outermost denticle of the mandibles.

Distribution

New Guinea.

Biological aspects

The specimens were collected at altitudes of 1800–3210 m a.s.l.

Type-material

Holotype. Nymph (on slide, GBIFCH 00465172), Papua New Guinea, Simbu Prov., 05°49.96'S, 145°06.129'E, (GPS), Mt. Wilhelm, Pindaunde Creek, 2350 m a.s.l. (7915 ft), S5 (oria.6), 18 Aug 1999, leg. L. Čížek . Deposited in MZL. Paratypes. 7 nymphs (3 on slides, GBIFCH 00465173, GBIFCH 00465177, GBIFCH 00465178, 4 in alcohol, GBIFCH 00515241, deposited in MZL), same data as holotype; 44 nymphs (2 on slides, GBIFCH 00465174, GBIFCH 00465175, 27 in alcohol, GBIFCH 00515242, GBIFCH 00508132, deposited in MZL; 15 in alcohol, GBIFCH 00515243, deposited in ZSM), Papua New Guinea, Simbu Prov., 05°48.050'S, 145°04.150'E, (GPS), Mt. Wilhelm, Pindaunde Creek, 3210 m a.s.l., (10895 ft), S2 (oria.3), 17 Aug 1999, L. Čížek leg; 52 nymphs (1 on slide, GBIFCH 00465176, 32 in alcohol, GBIFCH 00515239, GBIFCH 00508124, GBIFCH 00508133, deposited in MZL; 20 in alcohol, GBIFCH 00515240, deposited in ZSM), Papua New Guinea, Simbu Prov., 05°49.033'S, 145°5.271'E, (GPS), Mt. Wilhelm, Pindaunde Creek, 2600 m a.s.l. (near fish farm), (9181 ft GPS), S4 (oria.5), 18 Aug 1999, L. Čížek leg.

Additional material

5 nymphs (1 on slide, GBIFCH 00465179, 4 in alcohol, GBIFCH 00515275, GBIFCH 00508135, deposited in MZL), Papua New Guinea, Western Highlands, Simbai, 1800–2000 m, 26 Feb 2007, 05°15.87'S, 144°32.72'E, Kinibel (PNG 134); 2 nymphs (1 on slide, GBIFCH 00465180, 1 in alcohol, GBIFCH 00515261, deposited in MZL), Papua New Guinea, Eastern Highlands, Akameku-Brahmin, Bismarck Range, 2200 m, 23 Nov 2006, 05°56.80'S, 145°22.24'E, Balke & Kinibel (PNG 106).

Labiobaetis janae sp. n.

Figures 19, 20, 59d, 64b

Diagnosis

Larva. Following combination of characters: A) labrum dorsal arc of setae with one plus 6–7 long, simple setae; B) both mandibles with outermost denticle blade-like; C) hypopharynx with slightly concave distal margin of superlingua; D) maxillary palp somewhat longer than length of galea-lacinia; E) fore femur rather broad, length 2.6× maximum width, dorsal margin with a row of ca. 34 curved, spine-like setae and with some stout, pointed setae near margin; F) gills long, gill IV as long as length of segments V to VII combined, gill VII somewhat longer than length of segments VIII to X combined.

Description

Larva (Figs 19, 20, 59d). Body length 8–9 mm.

Figure 19. 

Labiobaetis janae sp. n., larva morphology: a Labrum b Right mandible c Right prostheca d Left mandible e Left prostheca fHypopharynxg Maxilla h Labium.

Figure 20. 

Labiobaetis janae sp. n., larva morphology: aForelegb Fore claw cTergum IV d Gill IV eParaproct.

Colouration. Head, thorax and abdomen dorsally grey-brown, abdominal segments VI, IX and X brighter, head and thorax with bright median, dorsal suture, forewing pads with bright striation. Head, thorax and abdomen ventrally light grey-brown, legs colourless with brown medial spot and dorsal margin on femur, caudal filaments light brown.

Antenna with scape and pedicel sub-cylindrical, without distolateral process at scape; flagellum with lanceolate spines on apex of each segment.

Labrum (Fig. 19a). Rectangular, length 0.7× maximum width. Distal margin with medial emargination and small process. Dorsally with medium, fine, simple setae scattered over surface; submarginal arc of setae composed of one plus 6–7 long, simple setae. Ventrally with marginal row of setae composed of lateral and anterolateral long, feathered setae and medial long, pectinate setae, centrally bifid; ventral surface with eight short, spine-like setae near lateral and anterolateral margin.

Right mandible (Fig. 19b, c). Incisors fused. Outer and inner sets of denticles with 3 + 3 denticles plus one minute intermediate denticle, outermost denticle blade-like. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically and distolaterally denticulate. Margin between prostheca and mola straight. Tuft of setae at apex of mola present.

Left mandible (Fig. 19d, e). Incisors fused. Outer and inner sets of denticles with 3 + 4 denticles, outermost denticle blade-like. Prostheca robust, apically with small denticles and comb-shape structure. Margin between prostheca and mola straight, with few minute setae, and with minute denticles toward subtriangular process. Subtriangular process long and slender, above level of area between prostheca and mola. Denticles of mola apically constricted. Tuft of setae at apex of mola present.

Both mandibles with lateral margins almost straight. Basal half with fine, simple setae scattered over dorsal surface.

Hypopharynx (Fig. 19f). Lingua about as long as superlingua. Lingua about as broad as long; medial tuft of stout setae present; distal half not expanded. Superlingua slightly concave; lateral margin rounded; fine, long, simple setae along distal margin.

Maxilla (Fig. 19g). Galea-lacinia with two simple, robust apical setae under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one bipectinate, spine-like seta and seven long, simple setae. Maxillary palp slightly longer than length of galea-lacinia; two segmented. Palp segment II 2.2× length of segment I. Setae on maxillary palp fine and simple, scattered over surface of segments I and II. Apex of last segment slightly pointed, without excavation at inner distolateral margin.

Labium (Fig. 19h). Glossa basally broad, narrowing toward apex; shorter than paraglossa; inner margin with 7–8 spine-like setae increasing in length distally; apex with three long, robust, pectinate setae; outer margin with five long, spine-like setae; ventral surface with few short, fine, simple setae. Paraglossa sub-rectangular, curved inward; apex rounded; with three rows of long, robust, apically pectinate setae; dorsally with three medium, simple setae; ventrally with three long, spine-like setae near inner margin. Labial palp with segment I 0.8× length of segments II and III combined. Segment I covered with micropores dorsally. Segment II with a short, thumb-like distomedial protuberance; distomedial protuberance 0.4× width of base of segment III; inner and outer margin both with short, fine, simple setae; dorsally with row of five long, spine-like, simple setae. Segment III oblong; apex slightly pointed; length 1.1× width; ventrally covered with long and medium spine-like, simple setae and short, fine, simple setae.

Hind wing pads absent.

Foreleg (Fig. 20a, b). Ratio of foreleg segments 1.5:1.0:0.6:0.3. Femur. Length ca. 3× maximum width. Dorsal margin with a row of ca. 34 curved, spine-like setae and some stout, pointed setae near margin; length of setae 0.15× maximum width of femur. Apex rounded; with two pairs of curved, spine-like setae and many short, stout, pointed setae. Many stout, lanceolate setae and a few fine, simple setae along ventral margin; femoral patch absent. Tibia. Dorsal margin with few short, curved, spine-like setae and a pair of longer, curved, spine-like setae on apex. Ventral margin with a row of curved, spine-like setae and some longer, stout, pointed setae on apex. Anterior surface scattered with many stout, lanceolate setae. Tibio-patellar suture present on basal 2/3. Tarsus. Dorsal margin with some short, spine-like setae and fine simple setae. Ventral margin with a row of curved, spine-like setae. Tarsal claw with one row of 12 denticles; distally pointed; with three stripes; subapical setae absent.

Tergum (Fig. 20c). Surface with many micropores and scattered W-shaped scale bases, scales oblong. Posterior margin of tergum IV with rounded or triangular spines, wider than long.

Gills (Fig. 20d). Present on segments II - VII. Margin with small denticles and long, fine, simple setae. Tracheae extending from main trunk to inner margin and partly to outer margin. Gill IV as long as length of segments V, VI and VII combined. Gill VII somewhat longer than length of segments VIII and X combined.

Paraproct (Fig. 20e). Distally expanded, with many marginal, stout spines. Surface with W-shaped scale bases and many micropores. Postero-lateral extension (cercotractor) with small marginal spines.

Etymology

Dedicated to Janice (“Jan”) Peters (Florida A & M University), who pioneered the collection of mayflies in New Guinea.

Distribution

New Guinea.

Biological aspects

The specimens were collected at an altitude of 3200 m a.s.l.

Type-material

Holotype. Nymph (on slide, GBIFCH 00465181), Indonesia, Papua, Lake Habemma, stream, 3200 m, 19 Oct 2011, 04°07.77'S, 138°40.77'E, Balke (PAP07). Temporary deposited in MZL before definitely housed in MZB. Paratypes. 30 nymphs (1 on slide, GBIFCH 00465182, 19 in alcohol, GBIFCH 00515252, GBIFCH 00508126, deposited in MZL; 11 in alcohol, GBIFCH 00515253, deposited in ZSM), same data as holotype.

L. tuberpalpus group of species

The group is characterised by a compact, rounded distomedial protuberance of labial palp segment II and a dorsal, submarginal arc of setae of the labrum composed of simple setae. In this arc of setae the first and second setae after the central, submedian seta are standing closely together.

Labiobaetis tuberpalpus (Lugo-Ortiz & McCafferty, 1999)

Figures 21, 65a

Diagnosis

Larva. Following combination of characters: A) labrum dorsal arc of setae composed of one plus 4–5 long, simple setae; B) maxillary palp longer than galwa-lacinia, with well-developed excavation at inner distolateral margin of segment II; C) fore femur rather broad, length 2.8× maximum width, foreleg setation as Fig. 21c; D) fore claw with a row of 9–10 denticles; E) spines at posterior margin of tergum IV mostly triangular and pointed, about as long as wide; F) paraproct with ca. 38 marginal spines.

Figure 21. 

Labiobaetis tuberpalpus, larva morphology: a Maxilla b Labial palp cForeleg (femur, tibia) dTergum IV.

Examined material

Paratypes. 1 nymph (on slides, PERC 0 010 571), Papua New Guinea, Bulolo R, E of Wau, 2950 ft, 18 Oct 1964, W.L. and J.G. Peters; 1 nymph (on slide, PERC 0 010 573), Papua New Guinea, Morobe Prov., Clearwater Cr, nr Luau, 15 Sept 1983, J.T. and D.A. Polhemus.

Labiobaetis branchiaesetis sp. n.

Figures 22, 23, 60a, 65a

Diagnosis

Larva. Following combination of characters: A) labrum dorsal submarginal arc of setae composed of one plus eight or nine long, simple setae; B) labial palp segment II with a compact, rounded distomedial protuberance; C) fore femur broad, length ca. 2× maximum width, dorsal margin with a row of ca. 26 curved, spine-like setae and many stout, pointed setae near margin; D) gills margin serrate with small spines intercalating long, fine, simple setae, and with robust, lanceolate setae on margin; E) paraproct surface with scales or scale bases and fine, slightly lanceolate setae as well as fine, simple setae.

Description

Larva (Figs 22, 23, 60a). Body length 7.5 mm; cerci: 7.5 mm; terminal filament: 3.2 mm; antenna: approximately twice as long as head length.

Figure 22. 

Labiobaetis branchiaesetis sp. n., larva morphology: a Labrum b Right mandible c Right prostheca d Left mandible e Left prostheca fHypopharynxg Maxilla h Labium.

Figure 23. 

Labiobaetis branchiaesetis sp. n., larva morphology: aForelegb Fore claw cTergum IV d Gill IV e Seta on gill margin fParaproct.

Colouration. Head, thorax and abdomen dorsally dark brown, abdominal segment X light brown, head and thorax with bright median, dorsal suture. Head, thorax and abdomen ventrally brown, femur dorsal and ventral margins brown, legs otherwise colourless, caudal filaments light brown.

Antenna with scape and pedicel sub-cylindrical, without distolateral process at scape; flagellum with lanceolate spines and fine, simple setae on apex of each segment.

Labrum (Fig. 22a). Rectangular, length 0.6× maximum width. Distal margin with medial emargination and a small process. Dorsally with many short to medium, fine, simple setae; submarginal arc of setae composed of one plus 8–9 long, simple setae. Ventrally with marginal row of setae composed of lateral and anterolateral long, feathered setae and medial long, bifid setae; ventral surface with seven short, spine-like setae near lateral and anterolateral margin.

Right mandible (Fig. 22b, c). Incisors fused. Outer and inner sets of denticles with 3 + 3 denticles. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically denticulate. Margin between prostheca and mola slightly convex, with minute denticles. Tuft of setae at apex of mola present.

Left mandible (Fig. 22d, e). Incisors fused. Outer and inner sets of denticles with 3 + 4 denticles. Prostheca robust, apically denticulate. Margin between prostheca and mola slightly convex, with minute denticles toward subtriangular process. Subtriangular process long and slender, above level of area between prostheca and mola. Denticles of mola apically constricted. Tuft of setae at apex of mola present.

Both mandibles with lateral margins slightly convex. Basal half with fine, simple setae scattered over dorsal surface.

Hypopharynx (Fig. 22f). Lingua about as long as superlingua. Lingua longer than broad; medial tuft of stout setae present; distal half not expanded. Superlingua rounded; lateral margin rounded; fine, long, simple setae along distal margin.

Maxilla (Fig. 22g). Galea-lacinia with two simple, robust apical setae under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one bipectinate, spine-like seta and seven long, simple setae. Maxillary palp 1.2× as long as length of galea-lacinia; two segmented. Palp segment II 1.5× length of segment I. Setae on maxillary palp fine and simple, scattered over surface of segments I and II. Apex of last segment rounded, with a slight excavation at inner distolateral margin.

Labium (Fig. 22h). Glossa basally broad, narrowing toward apex; shorter than paraglossa; inner margin with nine spine-like setae increasing in length distally; apex with two long and one medium, robust, pectinate setae; outer margin with eight long, spine-like setae increasing in length distally; ventral surface with few short, fine, simple setae. Paraglossa sub-rectangular, curved inward; apex rounded; with three rows of long, robust, apically pectinate setae; dorsally with one medium, simple seta; ventrally with five long, spine-like setae near inner margin. Labial palp with segment I 0.7× length of segments II and III combined. Segment I covered with short, fine, simple setae ventrally and micropores dorsally. Segment II with a compact, rounded distomedial protuberance; distomedial protuberance 0.6× width of base of segment III; inner and outer margin both with short, fine, simple setae; dorsally with a row of five long, spine-like, simple setae. Segment III conical; apex rounded; length 0.9× width; ventrally covered with short, fine, simple setae.

Hind wing pads absent.

Foreleg (Fig. 23a, b). Ratio of foreleg segments 1.3:1.0:0.7:0.2. Femur. Length ca. 2× maximum width. Dorsal margin with a row of ca. 26 curved, spine-like setae and with many stout, pointed setae near margin; length of setae 0.14× maximum width of femur. Apex rounded; with one curved, spine-like seta and many short, stout, pointed setae. Many stout, lanceolate setae and a few fine, simple setae along ventral margin; femoral patch poorly developed. Tibia. Dorsal margin with a row of short, spine-like setae and many stout, lanceolate setae along margin. Ventral margin with a row of curved, spine-like setae, on apex one bipectinate, spine-like seta and a tuft of long, fine, simple setae. Anterior surface scattered with many stout, lanceolate setae. Tibio-patellar suture present on basal 1/2. Tarsus. Dorsal margin with a row of short, spine-like setae and long, simple setae. Ventral margin with a row of curved, spine-like setae. Tarsal claw with one row of 9–10 denticles; distally pointed; with seven stripes; subapical setae absent.

Tergum (Fig. 23c). Surface with irregular rows of U-shaped scale bases and scattered micropores; scales short, apically rounded. Posterior margin of tergum IV with triangular spines, about as long as wide.

Gills (Fig. 23d, e). Present on segments II - VII. Margin with small denticles intercalating long, fine, simple setae, and with robust, lanceolate setae on margin. Tracheae extending from main trunk to inner margin and partly to outer margin. Gill IV as long as length of segments V and 1/2 VI combined. Gill VII as long as length of segments VIII and 1/3 IX combined.

Paraproct (Fig. 23f). Distally slightly expanded, with many marginal, stout spines. Surface with U-shaped scale bases and scattered fine, slightly lanceolate setae as well as fine, simple setae. Postero-lateral extension (cercotractor) with small marginal spines.

Etymology

Latin words for gills and seta, refers to the robust, lanceolate setae on the margin of the gills.

Distribution

New Guinea.

Biological aspects

The specimens were collected in altitudes of 1000 m a.s.l. and 1700 m–1800 m a.s.l.

Type-material

Holotype. Nymph (on slide, GBIFCH 00465183), Papua New Guinea, Eastern Highlands, Marawaka, Ande, 1700–1800 m, 09 Nov 2006, nr 07°01.70'S, 145°49.81'E, Balke & Kinibel (PNG 87). Deposited in ZSM. Paratypes. 24 nymphs (2 on slides, GBIFCH 00465184, GBIFCH 00465185, 14 in alcohol, GBIFCH 00515219, GBIFCH 00508123, deposited in MZL; 8 in alcohol, GBIFCH 00515220, deposited in ZSM), same data as holotype; 3 nymphs (1 on slide, GBIFCH 00465186, 2 in alcohol, GBIFCH 00515286, deposited in MZL), Papua New Guinea, Gulf, Marawaka, nr Ande, 1000 m, 10 Nov 2006, 07°03.60'S, 145°44.38'E, Balke & Kinibel (PNG 89).

Labiobaetis magnovaldus sp. n.

Figures 24, 25, 60b, 65a

Diagnosis

Larva. Following combination of characters: A) labrum dorsal submarginal arc of setae composed of one plus six or seven long, simple setae; B) maxillary palp about as long as galea-lacinia, excavation on inner distal margin of segment II poorly developed; C) labial palp segment II with a compact, rounded distomedial protuberance; D) fore femur rather broad, length ca. 3× maximum width, dorsal margin with a row of ca. 34 curved, spine-like setae and many stout, pointed setae near margin; E) fore claw with one row of 11–12 denticles; F) tracheae of gills restricted to main trunk, without pigmentation; G) paraproct surface with slightly lanceolate setae and fine, simple setae.

Description

Larva (Figs 24, 25, 60b). Body length 6.8 mm; antenna approximately twice as long as head length.

Figure 24. 

Labiobaetis magnovaldus sp. n., larva morphology: a Labrum b Right mandible c Right prostheca d Left mandible e Left prostheca fHypopharynxg Maxilla h Labium.

Figure 25. 

Labiobaetis magnovaldus sp. n., larva morphology: aForelegb Fore claw cTergum IV d Gill IV eParaproctf Seta on paraproct surface.

Colouration. Head, thorax and abdomen dorsally brown, head and thorax with bright median, dorsal suture, forewing pads with bright striation. Head, thorax and abdomen ventrally brown, legs light brown, dorsal magin of femur and tibia brown, caudal filaments brown.

Antenna with scape and pedicel sub-cylindrical, without distolateral process at scape; flagellum with lanceolate spines and fine, simple setae on apex of each segment.

Labrum (Fig. 24a). Rectangular, length 0.6× maximum width. Distal margin with medial emargination and a small process. Dorsally with medium, fine, simple setae and a few slightly lanceolate setae; submarginal arc of setae composed of one plus 6–8 long, simple setae. Ventrally with marginal row of setae composed of lateral and anterolateral long, pectinate setae and medial long, bifid, pectinate setae; ventral surface with seven short, spine-like setae near lateral and anterolateral margin.

Right mandible (Fig. 24b, c). Incisors fused. Outer and inner sets of denticles with 4 + 3 denticles. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically denticulate. Margin between prostheca and mola slightly convex, with minute denticles. Tuft of setae at apex of mola present.

Left mandible (Fig. 24d, e). Incisors fused. Outer and inner sets of denticles with 3 + 3 denticles. Prostheca robust, apically denticulate. Margin between prostheca and mola slightly convex, with minute denticles toward subtriangular process. Subtriangular process long and slender, above level of area between prostheca and mola. Denticles of mola apically constricted. Tuft of setae at apex of mola present.

Both mandibles with lateral margins almost straight. Basal half with fine, simple setae scattered over dorsal surface.

Hypopharynx (Fig. 24f). Lingua longer than superlingua. Lingua about as broad as long; medial tuft of stout setae present; distal half not expanded. Superlingua rounded; lateral margin rounded; fine, long, simple setae along distal margin.

Maxilla (Fig. 24g). Galea-lacinia with three simple, robust apical setae under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one bipectinate, spine-like seta and eight long, simple setae. Maxillary palp about as long as length of galea-lacinia; two segmented. Palp segment II 1.9× length of segment I. Setae on maxillary palp fine and simple, scattered over surface of segments I and II. Apex of last segment rounded, with slight excavation at inner distolateral margin.

Labium (Fig. 24h). Glossa basally broad, narrowing toward apex; shorter than paraglossa; inner margin with 11–12 spine-like setae increasing in length distally; apex with three long, robust, pectinate setae and one short, robust seta; outer margin with seven spine-like setae increasing in length distally; ventral surface with short, fine, simple setae. Paraglossa sub-rectangular, curved inward; apex rounded; with three rows of long, robust, apically pectinate setae; dorsally with 2–3 medium, simple setae; ventrally with five long, spine-like setae near inner margin. Labial palp with segment I 0.7× length of segments II and III combined. Segment I covered with short, fine, simple setae ventrally and micropores dorsally. Segment II with a compact, rounded distomedial protuberance; distomedial protuberance 0.5× width of base of segment III; inner and outer margin both with short, fine, simple setae; dorsally with row of five long, spine-like, simple setae. Segment III conical; apex rounded; length 1.0× width; ventrally covered with short, spine-like, simple setae and short, fine, simple setae.

Hind wing pads absent.

Foreleg (Fig. 25a, b). Ratio of foreleg segments 1.3:1.0:0.7:0.3. Femur. Length ca. 3× maximum width. Dorsal margin with row of ca. 34 curved, spine-like setae and with many stout, pointed setae near margin; length of setae 0.15× maximum width of femur. Apex rounded; with one curved, spine-like seta and many short, stout, pointed setae. Many stout, lanceolate setae and a few fine, simple setae along ventral margin; femoral patch poorly developed. Tibia. Dorsal margin with a row of short, curved, spine-like setae and long, fine, simple setae. Ventral margin with a row of curved, spine-like setae, apically longer and dense and with a tuft of long, fine, simple setae. Anterior surface scattered with many stout, lanceolate setae. Tibio-patellar suture present on basal 1/2. Tarsus. Dorsal margin with a row of short, spine-like setae and long, simple setae. Ventral margin with a row of curved, spine-like setae. Tarsal claw with one row of 11–14 denticles; tapering distally; with 5–7 stripes; subapical setae absent.

Tergum (Fig. 25c). Surface with irregular rows of U-shaped scale bases and scattered fine, simple setae, scales egg-shaped. Posterior margin of tergum IV with rounded spines, about as long as wide.

Gills (Fig. 25d). Present on segments II–VII. Margin with small denticles intercalating long, fine, simple setae. Tracheae restricted to main trunk. Gill IV as long as length of segments V and 1/2 VI combined. Gill VII as long as length of segment VIII.

Paraproct (Fig. 25e). Distally slightly expanded, with many marginal, stout spines. Surface with U-shaped scale bases and scattered fine, slightly lanceolate setae as well as fine, simple setae. Postero-lateral extension (cercotractor) with small marginal spines.

Terminal filament 0.6× length of cerci.

Etymology

Latin for “very high”, refers to the high altitude (2900 m a.s.l.) of the type locality.

Distribution

New Guinea.

Biological aspects

The specimens were collected in altitudes of 2200 m a.s.l. and 2900 m a.s.l. (in forest).

Type-material

Holotype. 1 Nymph (on slide, GBIFCH 00465187), Papua New Guinea, Simbu Prov., 05°49'S, 145°04.5'E, Mt. Wilhelm, Pindaunde Creek, 2900 m a.s.l. (in forest), S3 (oria.4), 18 Aug 1999, leg. L. Čížek. Deposited in MZL. Paratypes. 8 nymphs (2 on slides, GBIFCH 00465188, GBIFCH 00465189, 6 in alcohol, GBIFCH 00515266, GBIFCH 00508122, deposited in MZL), same data as holotype; 7 nymphs (1 on slide, GBIFCH 00465190, 3 in alcohol, GBIFCH 00515267, deposited in MZL; 3 in alcohol, GBIFCH 00515268, deposited in ZSM), Papua New Guinea, Eastern Highlands, Akameku-Brahmin, Bismarck Range, 2200 m, 23 Nov 2006, 05°56.80'S, 145°22.24'E, Balke & Kinibel (PNG 106).

Labiobaetis planus sp. n.

Figures 26, 27, 60c, 65a

Diagnosis

Larva. Following combination of characters: A) labrum dorsal submarginal arc of setae composed of one plus 5–7 long, simple setae; B) maxillary palp much longer than length of galea-lacinia, apically rounded, with very poorly developed excavation at inner distolateral margin; C) labial palp segment II with a compact, rounded distomedial protuberance; D) fore femur rather broad, length ca. 3× maximum width, dorsal margin with a row of ca. 19 curved, spine-like setae and some stout, pointed setae near margin; E) fore claw with 7 – 8 denticles; F) paraproct distally expanded, surface with few slightly spatulate setae.

Description

Larva (Figs 26, 27, 60c). Body length 3.3 mm; antenna: approximately twice as long as head length.

Figure 26. 

Labiobaetis planus sp. n., larva morphology: a Labrum b Right mandible c Right prostheca d Left mandible e Left prostheca fHypopharynxg Maxilla h Labium.

Figure 27. 

Labiobaetis planus sp. n., larva morphology: aForelegb Fore claw cTergum IV d Gill IV eParaproct.

Colouration. Head, thorax and abdomen dorsally brown, head and thorax with bright median, dorsal suture, forewing pads with bright striation. Head, thorax and abdomen ventrally light brown. Legs colourless, femur with large, distomedial, brown spot and brown dorsal margin, caudal filaments light brown.

Antenna with scape and pedicel sub-cylindrical, without distolateral process at scape; flagellum without spines on apex of segments.

Labrum (Fig. 26a). Rectangular, length 0.7× maximum width. Distal margin with medial emargination and a small process. Dorsally with many medium to long, fine, simple setae; submarginal arc of setae composed of one plus 5–7 long, simple setae. Ventrally with marginal row of setae composed of lateral and anterolateral long, feathered setae and medial long, bifid setae; ventral surface with two short, spine-like setae near lateral margin.

Right mandible (Fig. 26b, c). Incisors fused. Outer and inner sets of denticles with 4 + 3 denticles plus one small intermediate denticle. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically denticulate. Margin between prostheca and mola straight. Tuft of setae at apex of mola present.

Left mandible (Fig. 26d, e). Incisors fused. Outer and inner sets of denticles with 4 + 4 denticles. Prostheca robust, apically with small denticles and comb-shape structure. Margin between prostheca and mola straight. Subtriangular process long and slender, above level of area between prostheca and mola. Denticles of mola apically constricted. Tuft of setae at apex of mola present.

Both mandibles with lateral margins almost straight. Basal half with fine, simple setae scattered over dorsal surface.

Hypopharynx (Fig. 26f). Lingua about as long as superlingua. Lingua about as broad as long; medial tuft of stout setae present; distal half not expanded. Superlingua rounded; lateral margin rounded; fine, long, simple setae along distal margin.

Maxilla (Fig. 26g). Galea lacinia with four simple, robust apical setae under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one bipectinate, spine-like seta and five long, simple setae. Maxillary palp 1.6× as long as length of galea-lacinia; two segmented. Palp segment II 1.2× length of segment I. Setae on maxillary palp fine and simple, scattered over surface of segments I and II. Apex of last segment rounded, with very slight excavation at inner distolateral margin.

Labium (Fig. 26h). Glossa basally broad, narrowing toward apex; shorter than paraglossa; inner margin with 7–8 spine-like setae increasing in length distally; apex with two long and one medium, robust, pectinate setae; outer margin with five long, spine-like setae; ventral surface with short, fine, simple, scattered setae. Paraglossa sub-rectangular, curved inward; apex rounded; with three rows of long, robust, apically pectinate setae; dorsally with 2–3 medium, simple setae; ventrally with 3–4 long, spine-like setae near inner margin. Labial palp with segment I 0.8× length of segments II and III combined. Segment I covered with short, fine, simple setae ventrally and micropores dorsally. Segment II with a compact, rounded distomedial protuberance; distomedial protuberance 0.4× width of base of segment III; inner and outer margin both with short, fine, simple setae; dorsally with a row of 3–4 long, spine-like, simple setae. Segment III conical; apex truncate; length 0.9× width; ventrally covered with short and medium spine-like, simple setae and short, fine, simple setae.

Hind wing pads absent.

Foreleg (Fig. 27a, b). Ratio of foreleg segments 1.2:1.0:0.5:0.2. Femur. Length ca. 3× maximum width. Dorsal margin with a row of ca. 19 curved, spine-like setae and with some stout, pointed setae near margin; length of setae 0.2× maximum width of femur. Apex rounded; with one pair of spine-like setae and some short, stout, pointed setae. Many stout, lanceolate setae and a few fine, simple setae along ventral margin; femoral patch poorly developed. Tibia. Dorsal margin with a row of short, curved, spine-like setae and a row of long, fine, simple setae and a row of stout, lanceolate setae near margin. Ventral margin with a row of curved, spine-like setae, on apex one bipectinate, spine-like seta and a tuft of long, fine, simple setae. Anterior surface scattered with stout, lanceolate setae. Tibio-patellar suture present on basal 1/3. Tarsus. Dorsal margin with a row of short, spine-like setae and long, simple setae. Ventral margin with a row of curved, spine-like setae. Tarsal claw with one row of 7–8 denticles; distally pointed; with four stripes; subapical setae absent.

Tergum (Fig. 27c). Surface with irregular rows of U-shaped scale bases and scattered micropores, scales short, apically rounded. Posterior margin of tergum IV with rounded spines, wider than long.

Gills (Fig. 27d). Present on segments II–VII. Margin with small denticles intercalating long, fine, simple setae. Tracheae extending from main trunk to inner and outer margins. Gill IV as long as length of segments V and VI combined. Gill VII as long as length of segments VIII and IX combined.

Paraproct (Fig. 27e). Distally expanded, with many marginal, stout spines. Surface with U-shaped scale bases and scattered fine, slightly lanceolate setae. Postero-lateral extension (cercotractor) with small, marginal spines.

Etymology

Refers to the low altitude (95 m a.s.l.) of the type locality.

Distribution

New Guinea.

Biological aspects

The specimens were collected at an altitude of 95 m a.s.l.

Type-material

Holotype. Nymph (on slide, GBIFCH 00465191), Indonesia, Papua, Sorong, inland, 95 m, 19 Feb 2006, 00°49.35'S, 131°24.20'E, Balke & Tindige (BH 20). Temporary deposited in MZL before definitly housed in MZB. Paratypes. 16 nymphs (2 on slides, GBIFCH 00465192, GBIFCH 00465193, 9 in alcohol, GBIFCH 00515269, GBIFCH 00508149, GBIFCH 00508150, deposited in MZL; 5 in alcohol, GBIFCH 00515270, deposited in ZSM), same data as holotype.

Labiobaetis podolakae sp. n.

Figures 28, 29, 60d, 65a

Diagnosis

Larva. Following combination of characters: A) labrum dorsal submarginal arc of setae composed of one plus six long, simple setae; B) maxillary palp 1.2× length of galea-lacinia; C) labial palp segment II with a compact, rounded distomedial protuberance; D) fore femur rather broad, length ca. 3× maximum width, dorsal margin with a row of ca. 16 curved, spine-like setae and a row of spine-like setae near margin; E) paraproct with three robust, lanceolate setae near distolateral margin.

Description

Larva (Figs 28, 29, 60d). Body length 4.7 mm.

Figure 28. 

Labiobaetis podolakae sp. n., larva morphology: a Labrum b Right mandible c Right prostheca d Left mandible e Left prostheca fHypopharynxg Maxilla h Labium.

Figure 29. 

Labiobaetis podolakae sp. n., larva morphology: aForelegb Fore claw cTergum IV d Gill IV eParaproctf Seta near paraproct margin.

Colouration. Head, thorax and abdomen dorsally brown, head and thorax with bright median, dorsal suture, forewing pads with bright striation. Head, thorax and abdomen ventrally light brown, femur dorsal margin brown, legs otherwise colourless, caudal filaments light brown.

Antenna with scape and pedicel sub-cylindrical, without distolateral process at scape; flagellum with broad spines on apex of each segment.

Labrum (Fig. 28a). Rectangular, length 0.7× maximum width. Distal margin with medial emargination and a small process. Dorsally with many medium to long, fine, simple setae; submarginal arc of setae composed of one plus six long, simple setae. Ventrally with marginal row of setae composed of lateral and anterolateral long, feathered setae and medial long, bifid, pectinate setae; ventral surface with six short, spine-like setae near lateral and anterolateral margin.

Right mandible (Fig. 28b, c). Incisors fused. Outer and inner sets of denticles with 4 + 3 denticles plus one small intermediate denticle. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically denticulate. Margin between prostheca and mola slightly convex, with minute denticles. Tuft of setae at apex of mola present.

Left mandible (Fig. 28d, e). Incisors fused. Outer and inner sets of denticles with 3 + 4 denticles. Prostheca robust, apically with small denticles and comb-shape structure. Margin between prostheca and mola straight, with minute denticles towards subtriangular process. Subtriangular process long and slender, above level of area between prostheca and mola. Denticles of mola apically constricted. Tuft of setae at apex of mola present.

Both mandibles with lateral margins almost straight. Basal half with fine, simple setae scattered over dorsal surface.

Hypopharynx (Fig. 28f). Lingua longer than superlingua. Lingua longer than broad; medial tuft of stout setae present; distal half laterally expanded. Superlingua rounded; lateral margin rounded; fine, long, simple setae along distal margin.

Maxilla (Fig. 28g). Galea-lacinia with two simple, robust apical setae under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one bipectinate, spine-like seta and five long, simple setae. Maxillary palp 1.2× as long as length of galea-lacinia; two segmented. Palp segment II 1.4× length of segment I. Setae on maxillary palp fine and simple, scattered over surface of segments I and II. Apex of last segment rounded, with slight excavation at inner distolateral margin.

Labium (Fig. 28h). Glossa basally broad, narrowing toward apex; shorter than paraglossa; inner margin with six spine-like setae increasing in length distally; apex with two long and one short, robust, pectinate setae; outer margin with five long, spine-like setae increasing in length distally; ventral surface with few short, fine, simple setae. Paraglossa sub-rectangular, curved inward; apex rounded; with three rows of long, robust, apically pectinate setae; dorsally with 2–3 medium, simple setae; ventrally with three long, spine-like setae near inner margin. Labial palp with segment I 0.6× length of segments II and III combined. Segment I covered with micropores dorsally and ventrally with fine, simple setae along margins. Segment II with a compact, rounded distomedial protuberance; distomedial protuberance 0.3× width of base of segment III; inner and outer margin both with short, fine, simple setae; dorsally with a row of four long, spine-like, simple setae. Segment III conical; apex rounded; length 1.1× width; ventrally covered with medium spine-like, simple setae and short, fine, simple setae.

Hind wing pads absent.

Foreleg (Fig. 29a, b). Ratio of foreleg segments 1.2:1.0:0.5:0.2. Femur. Length ca. 3× maximum width. Dorsal margin with row of ca. 16 curved, spine-like setae and a row of stout, pointed setae near margin; length of setae 0.2× maximum width of femur. Apex rounded; with one curved, spine-like seta and many short, stout, pointed setae. Many stout, lanceolate setae and a few fine, simple setae along ventral margin; femoral patch poorly developed. Tibia. Dorsal margin with a row of short, curved, spine-like setae and a row of long, fine, simple setae, and a row of stout, lanceolate setae near margin. Ventral margin with a row of short, spine-like setae, on apex one stout, spine-like seta and a tuft of long, fine, simple setae. Anterior surface scattered with many stout, lanceolate setae. Tibio-patellar suture present on basal 1/2. Tarsus. Dorsal margin with a row of short, spine-like setae and long, simple setae. Ventral margin with a row of curved, spine-like setae. Tarsal claw with one row of nine denticles; distally pointed; with three stripes; subapical setae absent.

Tergum (Fig. 29c). Surface with irregular rows of U-shaped scale bases and scattered fine, simple setae, scales egg-shaped. Posterior margin of tergum IV with rounded spines, wider than long.

Gills (Fig. 29d). Present on segments II–VII. Margin with alternating smaller and bigger denticles intercalating long, fine, simple setae. Tracheae extending from main trunk to inner and outer margins. Gill IV as long as length of segments V and 1/2 VI combined. Gill VII as long as length of segments VIII and 2/3 IX combined.

Paraproct (Fig. 29e, f). Distally expanded, with many marginal, stout spines. Surface with U-shaped scale bases, scattered micropores and fine, simple setae and three robust, lanceolate setae near lateral margin. Postero-lateral extension (cercotractor) with small marginal spines.

Etymology

Dedicated to Marion Podolak (Museum for Zoology Lausanne, MZL) for her valuable support during our study.

Distribution

New Guinea.

Type-material

Holotype. Nymph (on slide, GBIFCH 00465227), Papua New Guinea, Eastern Highlands, Aiyura, 1710 m, 15 Jan 2003, 06°21.41'S, 145°54.34'E, grassland stream, K. Sagata leg. Deposited in ZSM. Paratypes. 2 nymphs (1 on slide, GBIFCH 00465194, 1 in alcohol, GBIFCH 00515276, deposited in MZL), same data as holotype.

Labiobaetis rutschmannae sp. n.

Figures 30, 31, 61a, 65a

Diagnosis

Larva. Following combination of characters: A) labrum dorsal submarginal arc of setae composed of one plus nine long, simple setae ; B) maxillary palp longer than length of galea-lacinia, apically rounded, without excavation at inner distolateral margin; C) labial palp segment II with a compact, rounded distomedial protuberance; D) fore femur rather broad, length ca. 3× maximum width, dorsal margin with a row of ca. 26 curved, spine-like setae and many stout, pointed setae near margin; E) paraproct distally expanded, surface with slightly spatulate setae.

Description

Larva (Figs 30, 31, 61a). Body length 5.2 mm.

Figure 30. 

Labiobaetis rutschmannae sp. n., larva morphology: a Labrum b Right mandible c Right prostheca d Left mandible e Left prostheca fHypopharynxg Maxilla h Labium.

Figure 31. 

Labiobaetis rutschmannae sp. n., larva morphology: aForelegb Fore claw cTergum IV d Gill IV eParaproct.

Colouration. Head, thorax and abdomen dorsally brown, head and thorax with bright median, dorsal suture. Head, thorax and abdomen ventrally light brown. Femur dorsal margin light brown, legs otherwise colourless, caudal filaments basally light brown, otherwise colourless.

Antenna with scape and pedicel sub-cylindrical, without distolateral process at scape; flagellum with broad, lanceolate spines and fine, simple setae on apex of each segment.

Labrum (Fig. 30a). Rectangular, length 0.7× maximum width. Distal margin with medial emargination and a small process. Dorsally with medium, fine, simple setae and a few slightly spatulate setae; submarginal arc of setae composed of one plus nine long, simple setae. Ventrally with marginal row of setae composed of lateral and anterolateral long, feathered setae and medial long, bifid setae; ventral surface with nine short, spine-like setae near lateral and anterolateral margin.

Right mandible (Fig. 30b, c). Incisors fused. Outer and inner sets of denticles with 4 + 3 denticles plus one small intermediate denticle. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically denticulate. Margin between prostheca and mola slightly convex, with minute denticles. Tuft of setae at apex of mola present.

Left mandible (Fig. 30d, e). Incisors fused. Outer and inner sets of denticles with 4 + 4 denticles. Prostheca robust, apically with small denticles and comb-shape structure. Margin between prostheca and mola slightly convex, with minute denticles toward subtriangular process. Subtriangular process long and slender, above level of area between prostheca and mola. Denticles of mola apically constricted. Tuft of setae at apex of mola present.

Both mandibles with lateral margins almost straight. Basal half with fine, simple setae scattered over dorsal surface.

Hypopharynx (Fig. 30f). Lingua shorter than superlingua. Lingua longer than broad; medial tuft of stout setae present; distal half not expanded. Superlingua rounded; lateral margin rounded; fine, long, simple setae along distal margin.

Maxilla (Fig. 30g). Galea-lacinia with three simple, robust apical setae under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one bipectinate, spine-like seta and five long, simple setae. Maxillary palp 1.2× as long as length of galea-lacinia; two segmented. Palp segment II 1.2× length of segment I. Setae on maxillary palp fine and simple, scattered over surface of segments I and II. Apex of last segment rounded, without excavation at inner distolateral margin.

Labium (Fig. 30h, i). Glossa basally broad, narrowing toward apex; shorter than paraglossa; inner margin with 7–8 spine-like setae increasing in length distally; apex with three long, robust setae; outer margin with five long, spine-like setae; ventral surface with short, simple setae. Paraglossa sub-rectangular, curved inward; apex rounded; with three rows of long, robust, apically pectinate setae; dorsally with seven simple setae; ventrally with three long, spine-like setae near inner margin. Labial palp with segment I 0.9× length of segments II and III combined. Segment I covered with micropores dorsally and ventrally with fine, simple setae along margins. Segment II with a compact, rounded distomedial protuberance; distomedial protuberance 0.2× width of base of segment III; inner and outer margin both with short, fine, simple setae; dorsally with row of three long, spine-like setae. Segment III conical; apex rounded; length 0.9× width; ventrally covered with short, fine, simple setae.

Hind wing pads absent.

Foreleg (Fig. 31a, b). Ratio of foreleg segments 1.2:1.0:0.5:0.2. Femur. Length ca. 3× maximum width. Dorsal margin with a row of ca. 26 curved, spine-like setae and with many stout, pointed setae near margin; length of setae 0.16× maximum width of femur. Apex rounded; with some spine-like setae and many short, stout, pointed or apically rounded setae. Many stout, lanceolate setae and a few fine, simple setae along ventral margin; femoral patch poorly developed. Tibia. Dorsal margin with a row of stout, lanceolate setae and very fine, simple setae. Ventral margin with a row of curved, spine-like setae, on apex one stout, spine-like seta and a tuft of long, fine, simple setae. Anterior surface scattered with stout, lanceolate setae. Tibio-patellar suture present on basal 1/2. Tarsus. Dorsal margin with a row of short, spine-like setae and long, simple setae. Ventral margin with a row of curved, spine-like setae. Tarsal claw with one row of 8–10 denticles; distally pointed; with four stripes; subapical setae absent.

Tergum (Fig. 31c). Surface with irregular rows of U-shaped scale bases and scattered fine, simple setae. Posterior margin of tergum IV with rounded or triangular spines, wider than long.

Gills (Fig. 31d). Present on segments II - VII. Margin with small denticles intercalating long, fine, simple setae. Tracheae extending from main trunk to inner and outer margins. Gill IV as long as length of segments V and VI combined. Gill VII as long as length of segments VIII and 1/2 IX combined.

Paraproct (Fig. 31e). Distally expanded, with many marginal, stout spines. Surface with U-shaped scale bases and scattered fine, slightly lanceolate setae, fine, simple setae and micropores. Postero-lateral extension (cercotractor) with small marginal spines.

Etymology

Dedicated to Sereina Rutschmann (University of Vigo, Spain) for her long-lasting support of our group in genetics.

Distribution

New Guinea.

Biological aspects

The specimens were collected in altitudes of 1800 m–2000 m a.s.l.

Type-material

Holotype. Nymph (on slide, GBIFCH 00465195), Papua New Guinea, Western Highlands, Simbai, 1800–2000 m, 01 Mar 2007, 05°14.28'S, 144°28.74'E, Kinibel (PNG 138). Deposited in ZSM. Paratype. Nymph (on slide, GBIFCH 00465196, deposited in MZL), Papua New Guinea, Western Highlands, Simbai, 2000 m, 28 Feb 2007, 05°15.17'S, 144°32.81'E, Kinibel (PNG 136).

Labiobaetis schwanderae sp. n.

Figures 32, 33, 61b, 65a

Diagnosis

Larva. Following combination of characters: A) labrum dorsal arc of setae composed of one plus five long, simple setae; B) maxillary palp 1.3× as long as length of galea-lacinia; segment II apically rounded, with an excavation at inner lateral margin; C) labial palp segment II with a compact, rounded distomedial protuberance, segment III conical; D) fore femur rather broad, length 2.7× maximum width, dorsal margin with a row of ca. 21 curved, spine-like setae and many stout, pointed setae near margin; E) fore claw with a row of 8 denticles; F) spines at posterior margin of tergum IV mostly rounded, about as long as wide; G) paraproct surface with U-shaped scale bases and scattered fine, slightly spatulate setae and micropores.

Description

Larva (Figs 32, 33, 61b). Body length 5 mm; antenna: approximately twice as long as head length.

Figure 32. 

Labiobaetis schwanderae sp. n., larva morphology: a Labrum b Right mandible c Right prostheca d Left mandible e Left prostheca fHypopharynxg Maxilla h Labium.

Figure 33. 

Labiobaetis schwanderae sp. n., larva morphology: aForelegb Fore claw cTergum IV d Gill IV eParaproct.

Colouration. Head, thorax and abdomen dorsally brown, head and thorax with bright median, dorsal suture. Head, thorax and abdomen ventrally colourless. Legs colourless with some brown spots, femur with brown dorsal margin, caudal filaments brown.

Antenna with scape and pedicel sub-cylindrical, without distolateral process at scape; flagellum with broad, lanceolate spines and fine, simple setae on apex of each segment.

Labrum (Fig. 32a). Rectangular, length 0.7× maximum width. Distal margin with medial emargination and a small process. Dorsally with medium, fine, simple setae scattered over surface; submarginal arc of setae composed of one plus five long, simple setae. Ventrally with marginal row of setae composed of lateral and anterolateral long, feathered setae and medial long, bifid, pectinate setae; ventral surface with five short, spine-like setae near lateral and anterolateral margin.

Right mandible (Fig. 32b, c). Incisors fused. Outer and inner sets of denticles with 4 + 3 denticles plus one small intermediate denticle. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically denticulate. Margin between prostheca and mola slightly convex. Tuft of setae at apex of mola present.

Left mandible (Fig. 32d, e). Incisors fused. Outer and inner sets of denticles with 4 + 4 denticles. Prostheca robust, apically with small denticles and comb-shape structure. Margin between prostheca and mola straight, with minute denticles towards subtriangular process. Subtriangular process long and slender, above level of area between prostheca and mola. Denticles of mola apically constricted. Tuft of setae at apex of mola present.

Both mandibles with lateral margins almost straight. Basal half with fine, simple setae scattered over dorsal surface.

Hypopharynx (Fig. 32f). Lingua shorter than superlingua. Lingua longer than broad; medial tuft of stout setae present; distal half laterally expanded. Superlingua rounded; lateral margin rounded; fine, long, simple setae along distal margin.

Maxilla (Fig. 32g). Galea-lacinia with three simple, robust apical setae under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one spine-like seta and six long, simple setae. Maxillary palp 1.3× as long as length of galea-lacinia; two segmented. Palp segment II 1.2× length of segment I. Setae on maxillary palp fine and simple, scattered over surface of segments I and II. Apex of last segment rounded, with excavation at inner distolateral margin.

Labium (Fig. 32h). Glossa basally broad, narrowing toward apex; shorter than paraglossa; inner margin with ten spine-like setae increasing in length distally; apex with two long and one short, robust, pectinate setae; outer margin with six long spine-like setae increasing in length distally; ventral surface with few short, fine, simple setae. Paraglossa sub-rectangular, curved inward; apex rounded; with three rows of long, robust, apically pectinate setae; dorsally with two medium, simple setae; ventrally with four long, spine-like setae near inner margin. Labial palp with segment I 0.6× length of segments II and III combined. Segment I covered with short and medium, fine, simple setae ventrally and with micropores dorsally. Segment II with a compact, rounded distomedial protuberance; distomedial protuberance 0.4× width of base of segment III; inner and outer margin both with short, fine, simple setae; dorsally with row of three long, spine-like setae. Segment III conical; apex rounded; length 0.8× width; ventrally covered with short and medium spine-like, simple setae and short, fine, simple setae.

Hind wing pads absent.

Foreleg (Fig. 33a, b). Ratio of foreleg segments 1.2:1.0:0.6:0.2. Femur. Length ca. 3× maximum width. Dorsal margin with a row of ca. 21 curved, spine-like setae and with many stout, pointed setae near margin; length of setae 0.2× maximum width of femur. Apex rounded; with one pair of curved, spine-like setae and many short, stout, pointed setae. Many stout, lanceolate setae and a few fine, simple setae scattered along ventral margin; femoral patch poorly developed. Tibia. Dorsal margin with a few curved, spine-like setae. Ventral margin with a row of curved, spine-like setae and some longer, spine-like, bipectinate setae and a tuft of long, fine, simple setae on apex. Anterior surface scattered with many stout, lanceolate setae. Tibio-patellar suture present on basal 1/2. Tarsus. Dorsal margin with a row of short, curved, spine-like setae and long, simple setae. Ventral margin with a row of curved, spine-like setae. Tarsal claw with one row of eight denticles; distally pointed; with five stripes; subapical setae absent.

Tergum (Fig. 33c). Surface with irregular rows of U-shaped scale bases and scattered fine, simple setae and micropores, scales egg-shaped. Posterior margin of tergum IV with rounded or triangular spines, about as long as wide.

Gills (Fig. 33d). Present on segments II–VII. Margin with small denticles intercalating long, fine, simple setae. Tracheae extending from main trunk to inner and outer margins. Gill IV as long as length of segments V and 1/2 VI combined. Gill VII as long as length of segments VIII and 1/3 IX combined.

Paraproct (Fig. 33e). Distally slightly expanded, with many marginal, stout spines. Surface with U-shaped scale bases and scattered fine, slightly lanceolate setae and micropores. Postero-lateral extension (cercotractor) with small marginal spines.

Etymology

Dedicated to Tanja Schwander (University of Lausanne, UNIL) for her constant support during a master project of one of the authors (TK) in her lab.

Distribution

New Guinea.

Biological aspects

The specimens were collected at an altitude of 1400 m a.s.l.

Type-material

Holotype. Nymph (on slide, GBIFCH 00465197), Papua New Guinea, Gulf, Marawaka, 1400 m, 11 Nov 2006, 07°05.66'S, 145°44.47'E, Balke & Kinibel (PNG 90). Deposited in ZSM. Paratypes. 2 nymphs (1 on slide, GBIFCH 00465198, 5 in alcohol, GBIFCH 00515234, deposited in MZL; 3 in alcohol, GBIFCH 00515235, deposited in ZSM), same data as holotype.

L. vitilis group of species

The group is characterized by a short, thumb-like protuberance of labial palp segment II and a dorsal, submarginal arc of setae composed of simple setae. Additionally, there is no distolateral excavation at maxillary palp segment II.

Labiobaetis vitilis (Lugo-Ortiz & McCafferty, 1999)

Figures 34, 65b

Diagnosis

Larva. Following combination of characters: A) labrum dorsal arc of setae composed of one plus eight long, simple setae, 5 setae standing closely together; B) right mandible with 3+3 denticles; C) left mandible with 3+3 denticles; D) maxillary palp longer than galea-lacinia, without excavation at inner distolateral margin; E) labial palp segment II with short thumb-like protuberance, segment III slightly pentagonal; F) fore femur rather broad, length ca. 3× as long as maximum width; G) fore leg setation as Fig. 34f.

Figure 34. 

Labiobaetis vitilis, larva morphology: a Labrum b Right mandible c Left mandible d Labial palp e Maxilla fForeleg.

Examined material

Paratype. 1 nymph (on slide, PERC 0 012 576), Papua New Guinea, Western Highlands Prov., Kaugel R, nr Alkena, 07 Sept 1983, J.T. and D.A. Polhemus.

Labiobaetis altus sp. n.

Figures 35, 36, 61c, 65b

Diagnosis

Larva. Following combination of characters: A) labrum dorsal submarginal arc of setae composed of one plus 5–6 long, simple setae; B) maxillary palp somewhat longer as length of galea-lacinia, apically constricted, without excavation at inner distolateral margin; C) labium paraglossa apically with four rows of long, robust, apically pectinate setae; D) labial palp segment II with a short, thumb-like distomedial protuberance; E) fore femur rather broad, length ca. 3× maximum width, dorsal margin with a row of ca. 30 curved, spine-like setae and many stout, pointed setae near margin; F) fore claw with one row of 12–13 denticles.

Description

Larva (Figs 35, 36, 61c). Body length 9.2 mm.

Figure 35. 

Labiobaetis altus sp. n., larva morphology: a Labrum b Right mandible c Right prostheca d Left mandible e Left prostheca fHypopharynxg Maxilla h Labium.

Figure 36. 

Labiobaetis altus sp. n., larva morphology: aForelegb Fore claw cTergum IV d Gill IV eParaproct.

Colouration. Head, thorax and abdomen dorsally brown, head and thorax with bright median, dorsal suture, thorax and abdomen with bright pattern as in Fig. 61c, forewing pads with bright striation. Head, thorax and abdomen ventrally colourless, femur with distomedial brown spot, legs otherwise colourless.

Antenna with scape and pedicel sub-cylindrical, without distolateral process at scape; flagellum with lanceolate spines and fine, simple setae on apex of each segment.

Labrum (Fig. 35a). Rectangular, length 0.7× maximum width. Distal margin with medial emargination and a small process. Dorsally with medium, fine, simple setae scattered over surface; submarginal arc of setae composed of one plus 5–6 long, simple setae. Ventrally with marginal row of setae composed of lateral and anterolateral long, feathered setae and medial long, bifid setae; ventral surface with 9–11 short, spine-like setae near lateral and anterolateral margin.

Right mandible (Fig. 35b, c). Incisors fused. Outer and inner sets of denticles with 3 + 4 denticles. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically denticulate. Margin between prostheca and mola straight. Tuft of setae at apex of mola present.

Left mandible (Fig. 35d, e). Incisors fused. Outer and inner sets of denticles with 3 + 3 denticles and one minute intermediate denticle. Prostheca robust, apically with small denticles and comb-shape structure. Margin between prostheca and mola straight, with minute denticles towards subtriangular process. Subtriangular process long and slender, above level of area between prostheca and mola. Denticles of mola apically constricted. Tuft of setae at apex of mola present.

Both mandibles with lateral margins almost straight. Basal half with fine, simple setae scattered over dorsal surface.

Hypopharynx (Fig. 35f). Lingua longer than superlingua. Lingua longer than broad; medial tuft of stout setae present; distal half laterally expanded. Superlingua straight; lateral margin rounded; fine, long, simple setae along distal margin.

Maxilla (Fig. 35g). Galea-lacinia with two simple, robust apical setae under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one bipectinate, spine-like seta and 7–8 long, simple setae. Maxillary palp slightly longer than length of galea-lacinia; two segmented. Palp segment II 1.2× length of segment I. Setae on maxillary palp fine and simple, scattered over surface of segments I and II. Apex of last segment constricted, without excavation at inner distolateral margin.

Labium (Fig. 35h, i). Glossa basally broad, narrowing toward apex; shorter than paraglossa; inner margin with 10–11 spine-like setae increasing in length distally; apex with three long, robust setae; outer margin with 6–8 spine-like setae; ventral surface with short, fine, simple, scattered setae. Paraglossa sub-rectangular, curved inward; apex rounded; with four rows of long, apically pectinate setae; dorsally with three medium, simple setae; ventrally with five long, spine-like setae near inner margin. Labial palp with segment I 0.9× length of segments II and III combined. Segment I covered with short, fine, simple setae ventrally and micropores dorsally. Segment II with a short, thumb-like distomedial protuberance; distomedial protuberance 0.5× width of base of segment III; inner margin with short, fine, simple setae, more numerous at apex; outer margin with short, fine, simple setae; dorsally with row of 3–4 long, spine-like, simple setae. Segment III oblong; apex slightly pointed; length 1.2× width; ventrally covered with short and medium spine-like, simple setae and short, fine, simple setae.

Hind wing pads absent.

Foreleg (Fig. 36a, b). Ratio of foreleg segments 1.6:1.0:0.8:0.3. Femur. Length ca. 3× maximum width. Dorsal margin with a row of ca. 30 curved, spine-like setae on margin, and with many stout, pointed setae near margin; length of setae 0.13× maximum width of femur. Apex rounded; with one pair of curved, spine-like setae and some short, stout, pointed setae. Many stout, lanceolate setae and a few fine, simple setae scattered along ventral margin; femoral patch poorly developed. Tibia. Dorsal margin with a row of curved, spine-like setae and long, fine, simple setae. Ventral margin with a row of curved, spine-like setae and some longer, stout, pointed setae and a tuft of long, fine, simple setae on apex. Anterior surface scattered with many stout, lanceolate setae. Tibio-patellar suture present on basal 2/3. Tarsus. Dorsal margin with a row of short, curved, spine-like setae and long, simple setae. Ventral margin with a row of curved, spine-like setae. Tarsal claw with one row of 12–13 denticles; distally pointed; with 3–4 stripes; subapical setae absent.

Tergum (Fig. 36c). Surface with irregular rows of U-shaped scale bases and scattered fine, simple setae and micropores, scales slightly triangular. Posterior margin of tergum IV with rounded or triangular spines, about as long as wide.

Gills (Fig. 36d). Present on segments II–VII. Margin with small denticles intercalating long, fine, simple setae. Tracheae extending from main trunk to inner and outer margins. Gill IV as long as length of segments V and VI combined. Gill VII as long as length of segments VIII and 1/2 IX combined.

Paraproct (Fig. 36e). Distally not expanded, with ca. 20 marginal, stout spines. Surface with U-shaped scale bases and scattered fine, simple setae. Postero-lateral extension (cercotractor) with small marginal spines.

Etymology

Latin word for high, refers to the altitude of the type locality (2700 m a.s.l.).

Distribution

New Guinea.

Biological aspects

The specimens were collected in altitudes of 2700 m a.s.l. and 2900 m a.s.l.

Type-material

Holotype. Nymph (on slide, GBIFCH 00465199), Papua New Guinea, Enga, Kumul Lodge at foot of Mt. Hagen, 2700 m, 05 Dec 2006, 05°47.55'S, 143°58.76'E, Balke & Kinibel (PNG 124). Deposited in ZSM. Paratypes. 4 nymphs (1 on slide, GBIFCH 00465200, 3 in alcohol, GBIFCH 00515273, GBIFCH 00508131, deposited in MZL), same data as holotype; 1 nymph (on slide, GBIFCH 00465201, deposited in MZL), Papua New Guinea, Simbu Prov., 05°49'S, 145°04.50'E, Mt. Wilhelm, Pindaunde Creek, 2900 m a.s.l. (in forest), S3 (oria.4), 18 Aug 1999, leg. L. Čížek.

Labiobaetis gindroi sp. n.

Figures 37, 38, 61d, 65b

Diagnosis

Larva. Following combination of characters: A) labrum dorsal arc of submarginal setae composed of one plus 6–7 long simple setae; B) maxillary palp about as long as galea-lacinia, apically slightly pointed and without excavation at inner lateral margin; C) labial palp segment II with an elongated, thumb-like distomedial protuberance; D) fore femur rather broad, length ca. 3× maximum width, dorsal margin with a row of ca. 26 curved, spine-like setae; E) fore claw with 13–15 denticles.

Description

Larva (Figs 37, 38, 61d). Body length 6.9 mm; antenna: approximately 2.5× as long as head length.

Figure 37. 

Labiobaetis gindroi sp. n., larva morphology: a Labrum b Right mandible c Right prostheca d Left mandible e Left prostheca fHypopharynxg Maxilla h Labium.

Figure 38. 

Labiobaetis gindroi sp. n., larva morphology: aForelegb Fore claw cTergum IV d Gill IV eParaproct.

Colouration. Head, thorax and abdomen dorsally brown, head and thorax with bright median, dorsal suture, forewing pads with bright striation, thorax and abdomen with bright pattern as in Fig. 61d. Legs and caudal filaments light brown, femur dorsal margin brown.

Antenna with scape and pedicel sub-cylindrical, without distolateral process at scape; flagellum with lanceolate spines and fine, simple setae on apex of each segment.

Labrum (Fig. 37a). Rectangular, length 0.7× maximum width. Distal margin with medial emargination and a small process. Dorsally with medium, fine, simple setae scattered over surface; submarginal arc of setae composed of one plus 6–7 long, simple setae. Ventrally with marginal row of setae composed of lateral and anterolateral long, feathered setae and medial long, bifid, pectinate setae; ventral surface with 8–9 short, spine-like setae near lateral and anterolateral margin.

Right mandible (Fig. 37b, c). Incisors fused. Outer and inner sets of denticles with 4 + 4 (sometimes three) denticles. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically denticulate. Margin between prostheca and mola straight. Tuft of setae at apex of mola present.

Left mandible (Fig. 37d, e). Incisors fused. Outer and inner sets of denticles with 3 + 3 (sometimes four) denticles, sometimes with one minute, intermediate denticle. Prostheca robust, apically with small denticles and comb-shape structure. Margin between prostheca and mola straight. Subtriangular process long and slender, above level of area between prostheca and mola. Denticles of mola apically constricted. Tuft of setae at apex of mola present.

Both mandibles with lateral margins almost straight. Basal half with fine, simple setae scattered over dorsal surface.

Hypopharynx (Fig. 37f). Lingua about as long as superlingua. Lingua longer than broad; medial tuft of stout setae present; distal half not expanded. Superlingua rounded; lateral margin rounded; fine, long, simple setae along distal margin.

Maxilla (Fig. 37g). Galea-lacinia with two simple, robust apical setae under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one bipectinate, spine-like seta and 8–9 long, simple setae. Maxillary palp about as long as length of galea-lacinia; two segmented. Palp segment II 1.4× length of segment I. Setae on maxillary palp fine and simple, scattered over surface of segments I and II. Apex of last segment slightly pointed, without excavation at inner distolateral margin.

Labium (Fig. 37h). Glossa basally broad, narrowing toward apex; shorter than paraglossa; inner margin with 8–9 spine-like setae increasing in length distally; apex with three long, robust, pectinate setae; outer margin with 6–7 spine-like setae increasing in length distally; ventral surface with fine, simple, scattered setae. Paraglossa sub-rectangular, curved inward; apex rounded; with three rows of long, robust, apically pectinate setae; dorsally with row of three medium, simple setae; ventrally with four long, spine-like setae near inner margin. Labial palp with segment I 0.8× length of segments II and III combined. Segment I covered with short and medium, fine, simple setae ventrally and with micropores dorsally. Segment II with an elongated, thumb-like distomedial protuberance; distomedial protuberance 0.4× width of base of segment III; inner and outer margin both with short, fine, simple setae; dorsally with row of 2–5 long, spine-like, simple setae. Segment III oblong; apex rounded; length 1.4× width; ventrally covered with short and medium spine-like, simple setae and short, fine, simple setae.

Hind wing pads absent.

Foreleg (Fig. 38a, b). Ratio of foreleg segments 1.2:1.0:0.5:0.2. Femur. Length ca. 3× maximum width. Dorsal margin with a row of ca. 26 curved, spine-like setae; length of setae 0.16× maximum width of femur. Apex rounded; with one pair of curved, spine-like setae and some short, stout, pointed setae. Many stout, lanceolate setae and a few fine, simple setae scattered along ventral margin; femoral patch poorly developed. Tibia. Dorsal margin with a row of stout, lanceolate setae and very fine, simple setae. Ventral margin with a row of curved, spine-like setae and some longer, spine-like, bipectinate setae and a tuft of long, fine, simple setae on apex. Anterior surface scattered with many stout, lanceolate setae and fine, simple setae. Tibio-patellar suture present on basal 1/2. Tarsus. Dorsal margin with a row of short, curved, spine-like setae. Ventral margin with a row of curved, spine-like setae. Tarsal claw with one row of 13–15 denticles; distally pointed; with 5–7 stripes; subapical setae absent.

Tergum (Fig. 38c). Surface with irregular rows of U-shaped scale bases and scattered fine, simple setae and micropores, scales short, apically rounded. Posterior margin of tergum IV with triangular spines, wider than long.

Gills (Fig. 38d). Present on segments II - VII. Margin with small denticles intercalating long, fine, simple setae. Tracheae partly extending from main trunk towards outer and inner margins. Gill IV as long as length of segments V and VI combined. Gill VII as long as length of segments VIII, IX and 1/4 X combined.

Paraproct (Fig. 38e). Distally not expanded, with ca. 21 marginal, stout spines. Surface with U-shaped scale bases and scattered fine, simple setae and micropores. Postero-lateral extension (cercotractor) with small marginal spines.

Etymology

Dedicated to the late friend of one of the authors (JLG), the biologist Cédric Gindro.

Distribution

New Guinea.

Biological aspects

The specimens were collected in altitudes of 1620 m a.s.l. and 2000 m a.s.l.

Type-material

Holotype. Nymph (on slide, GBIFCH 00465202), Indonesia, Papua, Wamena, 20 mins towd Jiwika, limestone creek, 1620 m, 18 Oct 2011, 03°56.95'S, 138°54.38'E, Balke (PAP07). Temporary deposited in MZL before definitely housed in MZB. Paratypes. 63 nymphs (3 on slides, GBIFCH 00465203, GBIFCH 00465204, GBIFCH 00465205, 42 in alcohol, GBIFCH 00515254, GBIFCH 00515256, deposited in MZL; 18 in alcohol, GBIFCH 00515255, GBIFCH00515257, deposited in ZSM), same data as holotype.

Additional material

5 nymphs (1 on slide, GBIFCH 00465206, 4 in alcohol, GBIFCH 00515291, deposited in MZL), Papua New Guinea, Western Highlands, Simbai, 2000 m, 28 Feb 2007, 05°15.17'S, 144°32.81'E, Kinibel (PNG 136).

Labiobaetis paravitilis sp. n.

Figures 39, 40, 62a, 65b

Diagnosis

Larva. Following combination of characters: A) labrum dorsal submarginal arc of setae composed of one plus 5–6 long, simple setae; B) maxillary palp longer as length of galea-lacinia, apically rounded, without excavation at inner distolateral margin; C) labial glossae much shorter than paraglossae; D) labial palp segment II with an elongated, thumb-like distomedial protuberance, segment III conical, apically slightly truncate; E) fore femur slender, length 3.6× maximum width, dorsal margin with a row of ca. 12 curved, spine-like setae; F) fore claw with one row of eleven denticles.

Description

Larva (Figs 39, 40, 62a). Body length 3.7 mm.

Figure 39. 

Labiobaetis paravitilis sp. n., larva morphology: a Labrum b Right mandible c Right prostheca d Left mandible e Left prostheca fHypopharynxg Maxilla h Labium.

Figure 40. 

Labiobaetis paravitilis sp. n., larva morphology: aForelegb Fore claw cTergum IV d Gill IV eParaproct.

Colouration. Head, thorax and abdomen dorsally brown, head and thorax with bright median, dorsal suture. Head, thorax and abdomen ventrally light brown, femur dorsal margin light brown, legs otherwise colourless, caudal filaments colourless.

Antenna with scape and pedicel sub-cylindrical, without distolateral process at scape; flagellum with lanceolate spines and fine, simple setae on apex of each segment.

Labrum (Fig. 39a). Rectangular, length 0.7× maximum width. Distal margin with medial emargination and a small process. Dorsally with medium, fine, simple setae scattered over surface; submarginal arc of setae composed of one plus 5–6 long, simple setae. Ventrally with marginal row of setae composed of lateral and anterolateral long, feathered setae and medial long, bifid setae; ventral surface with seven short, spine-like setae near lateral and anterolateral margin.

Right mandible (Fig. 39b, c). Incisors fused. Outer and inner sets of denticles with 4 + 3 denticles, partly plus one small intermediate denticle. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically denticulate. Margin between prostheca and mola slightly convex, with minute denticles. Tuft of setae at apex of mola present.

Left mandible (Fig. 39d, e). Incisors fused. Outer and inner sets of denticles with 4 + 3 denticles. Prostheca robust, apically with small denticles and comb-shape structure. Margin between prostheca and mola slightly convex, with minute denticles toward subtriangular process. Subtriangular process long and slender, above level of area between prostheca and mola. Denticles of mola apically constricted. Tuft of setae at apex of mola present.

Both mandibles with lateral margins almost straight. Basal half with fine, simple setae scattered over dorsal surface.

Hypopharynx (Fig. 39f). Lingua about as long as superlingua. Lingua longer than broad; medial tuft of stout setae present; distal half laterally expanded. Superlingua rounded; lateral margin rounded; fine, long, simple setae along distal margin.

Maxilla (Fig. 39g). Galea-lacinia with two simple, robust apical setae under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one bipectinate, spine-like seta and five long, simple setae. Maxillary palp 1.4× as long as length of galea-lacinia; two segmented. Palp segment II 1.4× length of segment I. Setae on maxillary palp fine and simple, scattered over surface of segments I and II. Apex of last segment rounded, without excavation at inner distolateral margin.

Labium (Fig. 39h). Glossa basally broad, narrowing toward apex; much shorter than paraglossa; inner margin with five spine-like setae increasing in length distally; apex with two long, robust setae; outer margin with 3–4 long, spine-like setae; ventral surface with few short, fine, simple setae. Paraglossa sub-rectangular, curved inward; apex rounded; with three rows of long, robust, apically pectinate setae; dorsally with 2–3 medium, simple setae; ventrally with two long, spine-like setae near inner margin. Labial palp with segment I 0.8× length of segments II and III combined. Segment I covered with short, fine, simple setae ventrally and micropores dorsally. Segment II with an elongated, thumb-like distomedial protuberance; distomedial protuberance 0.5× width of base of segment III; inner and outer margin both with short, fine, simple setae; dorsally with row of six medium, spine-like, simple setae. Segment III conical; apex truncate; length 0.9× width; ventrally covered with short and medium spine-like, simple setae and short, fine, simple setae.

Hind wing pads absent.

Foreleg (Fig. 40a, b). Ratio of foreleg segments 1.2:1.0:0.5:0.2. Femur. Length ca. 4× maximum width. Dorsal margin with a row of ca. 12 curved, spine-like setae; length of setae 0.16× maximum width of femur. Apex rounded; with one pair of curved, spine-like setae and some very short, stout setae. Many stout, lanceolate setae and a few fine, simple setae scattered along ventral margin; femoral patch absent. Tibia. Dorsal margin with a row of fine, simple setae. Ventral margin with a row of curved, spine-like setae, one seta on apex much longer; one long, bipectinate seta and a tuft of fine, long, simple setae on apex. Anterior surface scattered with stout, lanceolate setae. Tibio-patellar suture present on basal 1/3. Tarsus. Dorsal margin with row of fine, simple setae. Ventral margin with a row of curved, spine-like setae. Tarsal claw with one row of eleven denticles; tapering distally; with three stripes; subapical setae absent.

Tergum (Fig. 40c). Surface with irregular rows of U-shaped scale bases and scattered micropores, scales slightly triangular. Posterior margin of tergum IV with rounded or triangular spines, wider than long.

Gills (Fig. 40d). Present on segments II–VII. Margin with small denticles intercalating long, fine, simple setae. Tracheae extending from main trunk to inner and outer margins. Gill IV as long as length of segments V and VI combined. Gill VII as long as length of segments VIII and IX combined.

Paraproct (Fig. 40e). Distally not expanded, with many marginal, stout spines. Surface with U-shaped scale bases and scattered fine, simple setae and micropores. Postero-lateral extension (cercotractor) with small marginal spines.

Etymology

Refers to the morphological similarity with L. vitilis.

Distribution

New Guinea.

Biological aspects

The specimens were collected at an altitude of 30 m a.s.l.

Type-material

Holotype. Nymph (on slide, GBIFCH 00465207), Papua New Guinea, Madang, Trans Gogol, 30 m, 02.2008, 05°18.09'S, 145°36.45'E, BRC leg. (PNG 179). Deposited in ZSM. Paratypes. 17 nymphs (1 on slide, GBIFCH 00465208, 11 in alcohol, GBIFCH 00515271, GBIFCH 00508148, deposited in MZL; 5 in alcohol, GBIFCH00515272, deposited in ZSM), same data as holotype.

Labiobaetis wilhelmensis sp. n.

Figures 41, 42, 62b, 65b

Diagnosis

Larva. Following combination of characters: A) labrum dorsal submarginal arc of setae composed of one plus 7–10 long, simple setae; B) maxillary palp somewhat longer than length of galea-lacinia, segment II apically slightly pointed and without excavation at inner lateral margin; C) labial palp segment III oblong, apically slightly pointed; D) labium paraglossa apically with five rows of long, robust, apically pectinate setae; E) fore femur rather broad, length ca. 3× maximum width, dorsal margin with a row of ca. 29 curved, spine-like setae and many stout, pointed setae near margin; F) fore claw with one row of 13–15 denticles; G) tracheae of gills restricted to main trunk.

Description

Larva (Figs 41, 42, 62b). Body length 6 mm; antenna approximately twice as long as head length.

Figure 41. 

Labiobaetis wilhelmensis sp. n., larva morphology: a Labrum b Right mandible c Right prostheca d Left mandible e Left prostheca fHypopharynxg Maxilla h Labium.

Figure 42. 

Labiobaetis wilhelmensis sp. n., larva morphology: aForelegb Fore claw cTergum IV d Gill IV eParaproct.

Colouration. Head, thorax and abdomen dorsally brown, head and thorax with bright median, dorsal suture. Head, thorax and abdomen ventrally light brown, legs colourless with light brown pattern as in Fig. 62b, caudal filaments light brown.

Antenna with scape and pedicel sub-cylindrical, without distolateral process at scape; flagellum with lanceolate spines and fine, simple setae on apex of each segment.

Labrum (Fig. 41a). Rectangular, length 0.8× maximum width. Distal margin with medial emargination and small process. Dorsally with medium, fine, simple setae scattered over surface; submarginal arc of setae composed of one plus 7–10 long, simple setae. Ventrally with marginal row of setae composed of lateral and anterolateral long, feathered setae and medial long, bifid, pectinate setae; ventral surface with nine short, spine-like setae near lateral and anterolateral margin.

Right mandible (Fig. 41b, c). Incisors fused. Outer and inner sets of denticles with 4 + 4 (sometimes three) denticles. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically denticulate. Margin between prostheca and mola straight. Tuft of setae at apex of mola present.

Left mandible (Fig. 41d, e). Incisors fused. Outer and inner sets of denticles with 3 + 3 denticles and one minute intermediate denticle. Prostheca robust, apically with small denticles and comb-shape structure. Margin between prostheca and mola straight. Subtriangular process long and slender, at the same level as area between prostheca and mola. Denticles of mola apically constricted. Tuft of setae at apex of mola present.

Both mandibles with lateral margins almost straight. Basal half with fine, simple setae scattered over dorsal surface.

Hypopharynx (Fig. 41f). Lingua shorter than superlingua. Lingua broader than long; medial tuft of stout setae present; distal half laterally expanded. Superlingua rounded; lateral margin rounded; fine, long, simple setae along distal margin.

Maxilla (Fig. 41g). Galea-lacinia with two simple, robust apical setae under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one bipectinate, spine-like seta and 7–8 long, simple setae. Maxillary palp slightly longer than length of galea-lacinia; two segmented. Palp segment II 1.3× length of segment I. Setae on maxillary palp fine and simple, scattered over surface of segments I and II. Apex of last segment slightly pointed, without excavation at inner distolateral margin.

Labium (Fig. 41h). Glossa basally broad, narrowing toward apex; shorter than paraglossa; inner margin with eleven spine-like setae; apex with three long, robust, pectinate setae; outer margin with 7–8 long, spine-like setae; ventral surface with short, fine, simple, scattered setae. Paraglossa sub-rectangular, curved inward; apex rounded; with five rows of long, robust, apically pectinate setae; dorsally with row of four medium, simple setae; ventrally with five long, spine-like setae near inner margin. Labial palp with segment I 0.8× length of segments II and III combined. Segment I covered with short, fine, simple setae ventrally and micropores dorsally. Segment II with a short, thumb-like distomedial protuberance; distomedial protuberance 0.4× width of base of segment III; inner and outer margin both with short, fine, simple setae; dorsally with row of three long, spine-like setae. Segment III oblong; apex rounded; length 1.4× width; ventrally covered with short and medium spine-like, simple setae and short, fine, simple setae.

Hind wing pads absent.

Foreleg (Fig. 42a, b). Ratio of foreleg segments 1.5:1.0:0.6:0.3. Fore femur. Length 2.6× maximum width. Dorsal margin with a row of ca. 29 curved, spine-like setae and with many stout, pointed setae near margin; length of setae 0.14× maximum width of femur. Apex rounded; with one pair of curved, spine-like setae and many short, stout, pointed setae. Many stout, lanceolate setae and a few fine, simple setae along ventral margin; femoral patch poorly developed. Tibia. Dorsal margin with a row of stout, lanceolate setae and very fine, simple setae. Ventral margin with a row of curved, spine-like setae and some longer, stout, pointed setae and a tuft of long, fine, simple setae on apex. Anterior surface scattered with many stout, lanceolate setae. Tibio-patellar suture present on basal 2/3. Tarsus. Dorsal margin with a row of short, curved, spine-like setae. Ventral margin with a row of curved, spine-like setae and some stout, pointed setae near margin. Tarsal claw with one row of 13–15 denticles; distally pointed; with five stripes; subapical setae absent.

Tergum (Fig. 42c). Surface with irregular rows of U-shaped scale bases and scattered fine, simple setae, micropores and egg-shaped scales. Posterior margin of tergum IV with rounded or triangular spines, about as long as wide.

Gills (Fig. 42d). Present on segments II–VII. Margin with small denticles intercalating long, fine, simple setae. Tracheae restricted to main trunk. Gill IV as long as length of segments V and 1/2 VI combined. Gill VII as long as length of segments VIII and 1/3 IX combined.

Paraproct (Fig. 42e). Distally not expanded, with ca. 26 marginal, stout spines. Surface with U-shaped scale bases and scattered fine, simple setae. Postero-lateral extension (cercotractor) with small marginal spines.

Etymology

Refers to the type locality at Mt. Wilhelm.

Distribution

New Guinea.

Biological aspects

The specimens were collected in altitudes of 2900 m a.s.l. and 3210 m a.s.l.

Type-material

Holotype. Nymph (on slide, GBIFCH 00465209), Papua New Guinea, Simbu Prov., 05°48.050'S, 145°04.15'E, (GPS)’, Mt. Wilhelm, Pindaunde Creek, 3210 m a.s.l., (10895 ft GPS), S32 (oria.3), 17 Aug 1999, L. Čížek leg. Deposited in MZL. Paratypes. 14 nymphs (10 in alcohol, GBIFCH 00515247, deposited in MZL; 4 in alcohol, GBIFCH 00515248, deposited in ZSM), same data as holotype; 108 nymphs (3 on slides, GBIFCH 00465210, GBIFCH 00465211, GBIFCH 00465212, 61 in alcohol, GBIFCH 00515249, GBIFCH 00508127, deposited in MZL; 44 in alcohol, GBIFCH 00515250, deposited in ZSM), Papua New Guinea, Simbu Prov., 05°49’ 145°04.5’, Mt. Wilhelm, Pindaunde Creek, 2900 m a.s.l., (in forest), S3 (oria.4), 18 Aug 1999, leg. L. Čížek .

L. vultuosus group of species

The group is characterised by a hook-like protuberance of labial palp segment II and the labrum with a dorsal, submarginal arc of setae composed of simple setae.

Labiobaetis vultuosus (Lugo-Ortiz & McCafferty, 1999)

Figures 43, 64b

Diagnosis

Larva. Following combination of characters: A) labrum dorsal submarginal arc of setae composed of one plus 8–9 long, simple setae; B) maxillary palp longer than galea-lacinia, with well-developed excavation at inner distolateral margin; C) labial palp segment II with hook-like distomedial protuberance, as Fig. 43b, segment III conical; D) fore claw with a row of 8–10 denticles.

Figure 43. 

Labiobaetis vultuosus, larva morphology: a Maxilla b Labial palp.

Examined material

Paratype. 1 nymph (on slide, PERC 0 012 577), Papua New Guinea, Western Highlands Prov., 17 km N of Mt. Hagen, 06 Sept 1983, J.T. and D.A. Polhemus leg.

Labiobaetis paravultuosus sp. n.

Figures 44, 45, 62c, 64b

Diagnosis

Larva. Following combination of characters: A) labrum dorsal submarginal arc of setae composed of one plus nine long, simple setae; B) maxillary palp with segment II longer than length of segment I, segment II with excavation at inner distolateral margin; C) labial palp segment II with a hook-like distomedial protuberance; D) fore femur rather broad, length ca. 3× maximum width, dorsal margin with a row of ca. 28 curved, spine-like setae; E) fore claw with 10 denticles; F) gills margin serrated with alternating bigger and smaller spines.

Description

Larva (Figs 44, 45, 62c). Body length 7.8 mm; antenna approximately twice as long as head length.

Figure 44. 

Labiobaetis paravultuosus sp. n., larva morphology: a Labrum b Right mandible c Right prostheca d Left mandible e Left prostheca fHypopharynxg Maxilla h Labium.

Figure 45. 

Labiobaetis paravultuosus sp. n., larva morphology: aForelegb Fore claw cTergum IV d Gill IV eParaproct.

Colouration. Head, thorax and abdomen dorsally brown, head and thorax with bright median, dorsal suture, forewing pads with bright striation. Head, thorax and abdomen ventrally light brown, femur colourless with a medial brown spot and a brown dorsal margin, tibia and tarsus brown, caudal filaments brown.

Antenna with scape and pedicel sub-cylindrical, without distolateral process at scape; flagellum with lanceolate spines and fine, simple setae on apex of each segment.

Labrum (Fig. 44a). Rectangular, length 0.7× maximum width. Distal margin with medial emargination and a small process. Dorsally with many medium to long, fine, simple setae; submarginal arc of setae composed of one plus nine long, simple setae. Lateral margin with few long, spine-like setae and few long, fine, simple setae. Ventrally with marginal row of setae composed of lateral and anterolateral long, feathered setae and medial long, bifid, pectinate setae; ventral surface with eight short, spine-like setae near lateral and anterolateral margin.

Right mandible (Fig. 44b, c). Incisors fused. Outer and inner sets of denticles with 5 + 4 denticles. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically denticulate. Margin between prostheca and mola slightly convex, with minute denticles. Tuft of setae at apex of mola present.

Left mandible (Fig. 44d, e). Incisors fused. Outer and inner sets of denticles with 4 + 3 denticles and one minute intermediate denticle. Prostheca robust, apically with small denticles and comb-shape structure. Margin between prostheca and mola straight, with minute denticles towards subtriangular process. Subtriangular process long and slender, above level of area between prostheca and mola. Denticles of mola apically constricted. Tuft of setae at apex of mola present.

Both mandibles with lateral margins slightly convex. Basal half with fine, simple setae scattered over dorsal surface.

Hypopharynx (Fig. 44f). Lingua about as long as superlingua. Lingua about as broad as long; medial tuft of stout setae present; distal half laterally expanded. Superlingua rounded; lateral margin rounded; fine, long, simple setae along distal margin.

Maxilla (Fig. 44g). Galea-lacinia with two simple, robust apical setae under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one bipectinate, spine-like seta and 6–7 long, simple setae. Maxillary palp 1.2× as long as length of galea-lacinia; two segmented. Palp segment II 1.2× length of segment I. Setae on maxillary palp fine and simple, scattered over surface of segments I and II. Apex of last segment rounded, with excavation at inner distolateral margin.

Labium (Fig. 44h). Glossa basally broad, narrowing toward apex; shorter than paraglossa; inner margin with 7–9 spine-like setae increasing in length distally; apex with three long, robust, pectinate setae; outer margin with six long spine-like setae increasing in length distally; ventral surface with short, fine, simple, scattered setae. Paraglossa sub-rectangular, curved inward; apex rounded; with three rows of long, robust, apically pectinate setae; dorsally with five medium, simple setae; ventrally with five long, spine-like setae near inner margin. Labial palp with segment I 0.7× length of segments II and III combined. Segment I covered with short, fine, simple setae ventrally and micropores dorsally. Segment II with a hook-like distomedial protuberance; distomedial protuberance 0.5× width of base of segment III; inner and outer margin both with short, fine, simple setae; dorsally with row of 2–3 long, spine-like, simple setae. Segment III slightly pentagonal; apex rounded; length 1.0× width; ventrally covered with short and medium spine-like, simple setae and short, fine, simple setae.

Hind wing pads absent.

Foreleg (Fig. 45a, b). Ratio of foreleg segments 1.1:1.0:0.5:0.1. Femur. Length ca. 3× maximum width. Dorsal margin with a row of ca. 28 curved, spine-like setae; length of setae 0.16× maximum width of femur. Apex rounded; with two pairs of curved, spine-like setae and many short, stout, pointed setae. Many stout, lanceolate setae and a few fine, simple setae scattered along ventral margin; femoral patch poorly developed. Tibia. Dorsal margin with a row of curved, spine-like setae and long, fine, simple setae. Ventral margin with a row of short, curved, spine-like setae and some longer, spine-like, bipectinate setae and a tuft of long, fine, simple setae on apex. Anterior surface scattered with stout, lanceolate setae. Tibio-patellar suture present on basal 2/3. Tarsus. Dorsal margin with a row of short, curved, spine-like setae and long, simple setae. Ventral margin with a row of curved, spine-like setae. Tarsal claw with one row of ten denticles; tapering distally; with five stripes; subapical setae absent.

Tergum (Fig. 45c). Surface with irregular rows of U-shaped scale bases and scattered micropores. Posterior margin of tergum IV with rounded or triangular spines, about as long as wide.

Gills (Fig. 45d). Present on segments II–VII. Margin with alternating smaller and bigger denticles intercalating long, fine, simple setae. Tracheae extending from main trunk to inner and outer margins. Gill IV as long as length of segments V and 1/2 VI combined. Gill VII as long as length of segments VIII and 1/2 IX combined.

Paraproct (Fig. 45e). Distally not expanded, with many marginal, stout spines. Surface with U-shaped scale bases and scattered fine, simple setae and micropores. Postero-lateral extension (cercotractor) with small marginal spines.

Etymology

Refers to the similarity and close relationship to L. vultuosus.

Distribution

New Guinea.

Biological aspects

The specimens were collected at an altitude of 1500 m a.s.l.

Type-material

Holotype. Nymph (on slide, GBIFCH 00465213), Papua New Guinea, Enga, Wapanamanda, 1500 m, 06 Dec 2006, 05°38.11'S, 143°55.34'E, Balke & Kinibel (PNG 128). Deposited in ZSM. Paratypes. 30 nymphs (1 on slide, GBIFCH 00465214, 16 in alcohol, GBIFCH 00515223, deposited in MZL; 13 in alcohol, GBIFCH 00515224, deposited in ZSM), same data as holotype.

Species not assigned to a group

Labiobaetis centralensis sp. n.

Figures 46, 47, 63a, 65a

Diagnosis

Larva. Following combination of characters: A) labrum with dorsal submarginal arc of setae composed of one plus six long, simple setae; B) labial palp segment II with an elongated, thumb-like distomedial protuberance; C) maxillary palp slightly longer than length of galea-lacinia, segment II apically slightly pointed and without excavation at inner lateral margin; D) right mandible outer and inner sets of denticles with 4 + 4 denticles respectively plus one small intermediate denticle; E) left mandible outer and inner sets of denticles with 4 + 4 denticles respectively; F) fore femur slender, length ca. 4× maximum width, dorsal margin with a row of ca. 21 curved, spine-like setae and distally a row of robust, spine-like setae close to margin.

Description

Larva (Figs 46, 47, 63a). Body length 4.8 mm.

Figure 46. 

Labiobaetis centralensis sp. n., larva morphology: a Labrum b Right mandible c Right prostheca d Left mandible e Left prostheca fHypopharynxg Maxilla h Labium.

Figure 47. 

Labiobaetis centralensis sp. n., larva morphology: aForelegb Tibia dorsal seta c Tibia ventral seta d Fore claw eTergum IV f Gill IV gParaproct.

Colouration. Head, thorax and abdomen dorsally brown, with bright pattern as in Fig. 63a. Head and thorax with bright median, dorsal suture, forewing pads with bright striation. Head, thorax, and abdomen ventrally colourless, femur, tibia, and tarsus with brown dorsal margin, legs otherwise colourless, caudal filaments brown.

Antenna with scape and pedicel sub-cylindrical, without distolateral process at scape; flagellum with broad spines on apex of each segment.

Labrum (Fig. 46a). Rectangular, length 0.6× maximum width. Distal margin with medial emargination and a small process. Dorsally with medium, fine, simple setae scattered over surface; submarginal arc of setae composed of one plus six long, simple setae. Ventrally with marginal row of setae composed of anterolateral long, feathered setae and medial long, bifid, pectinate setae; ventral surface with four short, spine-like setae near lateral and anterolateral margin.

Right mandible (Fig. 46b, c). Incisors fused. Outer and inner sets of denticles with 4 + 4 denticles plus one small intermediate denticle. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically denticulate. Margin between prostheca and mola slightly convex, with minute denticles. Tuft of setae at apex of mola present.

Left mandible (Fig. 46d, e). Incisors fused. Outer and inner sets of denticles with 4 + 4 denticles. Prostheca robust, apically with small denticles and comb-shape structure. Margin between prostheca and mola slightly convex, with minute denticles toward subtriangular process. Subtriangular process long and slender, above level of area between prostheca and mola. Denticles of mola not constricted. Tuft of setae at apex of mola present.

Both mandibles with lateral margins almost straight. Basal half with fine, simple setae scattered over dorsal surface.

Hypopharynx (Fig. 46f). Lingua longer than superlingua. Lingua about as broad as long; medial tuft of stout setae present; distal half laterally expanded. Superlingua rounded; lateral margin rounded; fine, long, simple setae along distal margin.

Maxilla (Fig. 46g). Galea-lacinia with two simple, robust apical setae under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one spine-like seta and six long, simple setae. Maxillary palp slightly longer than length of galea-lacinia; two segmented. Palp segment II about as long as segment I. Fine and simple setae scattered over surface of segment II. Apex of segment II slightly pointed, without excavation at inner distolateral margin.

Labium (Fig. 46h). Glossa basally broad, narrowing toward apex; shorter than paraglossa; inner margin with eight spine-like setae increasing in length distally; apex with two long and one short, robust, pectinate setae; outer margin with seven spine-like setae increasing in length distally; ventral surface with fine, simple, scattered setae. Paraglossa sub-rectangular, curved inward; apex rounded; with three rows of long, robust, apically pectinate setae; dorsally with row of three medium, simple setae; ventrally with five medium, spine-like setae near inner margin. Labial palp with segment I 0.7× length of segments II and III combined. Segment I dorsally covered with micropores. Segment II with an elongated, thumb-like distomedial protuberance; distomedial protuberance 0.5× width of base of segment III; inner margin with few fine, simple setae; outer margin bare; dorsally with row of four long, spine-like, simple setae. Segment III conical; apex rounded; ventrally covered with medium spine-like, simple setae and short, fine, simple setae.

Hind wing pads absent.

Foreleg (Fig. 47a–d). Ratio of foreleg segments 1.2:1.0:0.5:0.2. Femur. Length ca. 4× maximum width. Dorsal margin with a row of ca. 21 curved, spine-like setae, distally a row of robust, spine-like setae close to margin, and a row of fine simple setae along margin; length of setae 0.1× maximum width of femur. Apex rounded; with two pairs of spine-like setae, many short, stout, blunt setae and some fine, long, simple setae. Many stout, lanceolate setae and a few fine, simple setae along ventral margin; femoral patch well developed. Tibia. Dorsal margin with stout, lanceolate, apically rounded setae and very fine, simple setae along margin. Ventral margin with a row of curved, spine-like setae, one seta on apex much longer; one long, bipectinate seta and a tuft of fine, long, simple setae on apex. Anterior surface scattered with many stout, lanceolate setae. Tibio-patellar suture present on basal 1/2. Tarsus. Dorsal margin with a row of short, spine-like setae and fine, simple setae along margin, especially on apex. Ventral margin with a row of curved, spine-like setae. Tarsal claw with one row of 10–11 denticles; distally pointed; with five stripes; subapical setae absent.

Tergum (Fig. 47e). Surface with irregular rows of U-shaped scale bases and scattered fine, simple setae and micropores, scales short, apically rounded. Posterior margin of tergum IV with triangular spines, about as long as wide.

Gills (Fig. 47f). Present on segments II–VII. Margin with small denticles intercalating long, fine, simple setae. Tracheae extending from main trunk to inner and outer margins, pigmentation limited to part of main trunk and one or two extensions to inner margin only. Gill IV as long as length of segments V and 1/2 VI combined. Gill VII as long as length of segments VIII and 1/2 IX combined.

Paraproct (Fig. 47g). Distally slightly expanded, with many marginal, stout spines. Surface with U-shaped scale bases and scattered fine, simple setae. Postero-lateral extension (cercotractor) with small marginal spines.

Etymology

Refers to the type locality in the Central Province of Papua New Guinea.

Distribution

New Guinea.

Biological aspects

The specimens were collected at an altitude of 590 m a.s.l.

Type-material

Holotype. Nymph (on slide, GBIFCH 00465215), Papua New Guinea, Central, Kokoda Trek, 590 m, 01.2008, 09°14.34'S, 147°36.92'E, Posman (PNG170). Deposited in ZSM. Paratypes. 16 nymphs (1 on slide, GBIFCH 00465216, 8 in alcohol, GBIFCH 00515217, deposited in MZL; 7 in alcohol, GBIFCH 00515218, deposited in ZSM), same data as holotype.

Labiobaetis dendrisetis sp. n.

Figures 48, 49, 65b

Diagnosis

Larva. Following combination of characters: A) labrum dorsal submarginal arc of setae composed of one plus 5 long, dendritic, apically pointed setae and 3 middle to long, simple setae; B) both mandibles with outermost denticles blade-like; C) maxillary palp somewhat shorter than length of galea-lacinia; D) distomedial protuberance of labial palp segment II short, thumb-like; E) fore femur rather broad, length ca. 3× maximum width, dorsal margin with a row of ca. 20 curved, spine-like setae and basally a row of robust, spine-like setae near margin; F) tarsal claw with one row of seven denticles and without striation.

Description

Larva (Figs 48, 49). Antenna approximately twice as long as head length.

Figure 48. 

Labiobaetis dendrisetis sp. n., larva morphology: a Labrum b Labrum dorsal, submarginal seta c Right mandible, denticles outworn d Right prostheca e Left mandible, denticles outworn f Left prostheca g Left mandible, denticles unused h Left prostheca iHypopharynxj Maxilla k Labium.

Figure 49. 

Labiobaetis dendrisetis sp. n., larva morphology: aForelegb Fore claw cTergum IV d Gill IV eParaproct.

Colouration. Unknown.

Antenna with scape and pedicel sub-cylindrical, without distolateral process at scape; flagellum with lanceolate spines on apex of each segment.

Labrum (Fig. 48a, b). Rectangular, length 0.5× maximum width. Distal margin with medial emargination and a small process. Dorsally with medium, fine, simple setae scattered over surface; submarginal dorsal arc of setae composed of one plus five long, dendritic, apically pointed setae and three middle to long, simple setae. Ventrally with marginal row of setae composed of lateral and anterolateral long, feathered setae and medial long, bifid setae; ventral surface with ten short, spine-like setae near lateral and anterolateral margin.

Right mandible (Fig. 48c, d). Incisors fused. Outer and inner sets of denticles unknown, outermost denticle blade-like. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically denticulate. Margin between prostheca and mola straight, with minute setae. Tuft of setae at apex of mola present.

Left mandible (Fig. 48e–h). Incisors fused. Outer and inner sets of denticles with 3 + 3 denticles, outermost denticle blade-like. Prostheca robust, apically with small denticles and comb-shape structure. Margin between prostheca and mola straight, with minute setae. Subtriangular process long and slender, above level of area between prostheca and mola. Denticles of mola apically constricted. Tuft of setae at apex of mola present.

Both mandibles with lateral margins almost straight. Basal half with fine, simple setae scattered over dorsal surface.

Hypopharynx (Fig. 48i). Lingua longer than superlingua. Lingua longer than broad; medial tuft of stout setae present; distal half laterally expanded. Superlingua rounded; lateral margin straight; fine, long, simple setae along distal margin.

Maxilla (Fig. 48j). Galea-lacinia with two simple, robust apical setae under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one bipectinate, spine-like seta and 9–10 long, simple setae. Maxillary palp somewhat shorter than length of galea-lacinia; two segmented. Palp segment II 1.8× length of segment I. Setae on maxillary palp fine and simple, scattered over surface of segment II and along outer margin of segment I. Apex of last segment rounded, with slight excavation at inner distolateral margin.

Labium (Fig. 48k). Glossa basally broad, narrowing toward apex; shorter than paraglossa; inner margin with five spine-like setae increasing in length distally; apex with three long, robust setae; outer margin with 3–4 long, spine-like setae; ventral surface with few short, fine, simple setae. Paraglossa sub-rectangular, curved inward; apex rounded; with three rows of long, robust, apically pectinate setae; dorsally with two medium, simple setae; ventrally with three long, spine-like setae near inner margin. Labial palp with segment I 0.6× length of segments II and III combined. Segment I dorsally covered with micropores and ventrally with fine, simple setae along margins. Segment II with a short, thumb-like distomedial protuberance; distomedial protuberance 0.2× width of base of segment III; inner and outer margin both with short, fine, simple setae; dorsally with row of six spine-like, simple setae, decreasing in length distally. Segment III semicircular; apex rounded; length 0.8× width; covered with long and medium spine-like, simple setae and short, fine, simple setae.

Hind wing pads absent.

Foreleg (Fig. 49a, b). Ratio of foreleg segments 1.8:1.0:0.6:0.2. Femur. Length ca. 3× maximum width. Dorsal margin with a row of ca. 20 curved, spine-like setae, basally a row of robust, spine-like setae near margin; length of setae 0.18× maximum width of femur. Apex rounded; with one pair of curved, spine-like setae and many short, stout, pointed setae. Ventral margin with a row of short, spine-like setae, some stout, lanceolate, pointed setae and a few fine, simple setae scattered along ventral margin; femoral patch absent. Tibia. Dorsal margin with a few short, curved, spine-like setae and a pair of longer, curved, spine-like setae on apex. Ventral margin with a row of curved, spine-like setae, on apex one stout, spine-like seta and a tuft of long, fine, simple setae. Anterior surface scattered with many stout, lanceolate setae. Tibio-patellar suture present on basal 1/2. Tarsus. Dorsal margin with one or two short, spine-like setae near apex. Ventral margin with a row of curved, spine-like setae. Tarsal claw with one row of seven denticles; tapering distally; striation absent.

Tergum (Fig. 49c). Surface with irregular rows of W-shaped scale bases, scales broad, apically rounded. Posterior margin of tergum IV with triangular or pentagonal spines, about as long as wide.

Gills (Fig. 49d). Present on segments I–VII. Margin with small denticles intercalating long, fine, simple setae. Tracheae partly extending from main trunk towards outer and inner margins. Gill I as long as length of segment II. Gill IV as long as length of segments V and VI combined. Gill VII as long as length of segments VIII and 1/3 IX combined.

Paraproct (Fig. 49e). Distally not expanded, with many marginal, stout spines. Surface with W-shaped scale bases and scattered fine, simple setae and micropores. Postero-lateral extension (cercotractor) with small marginal spines.

Etymology

Refers to the dendritic submarginal setae on dorsal surface of labrum.

Distribution

New Guinea.

Biological aspects

The specimens were collected in forest at an altitude of 2900 m a.s.l.

Type-material

Holotype. Nymph (on slide, GBIFCH 00465217), Papua New Guinea, Simbu Prov., 05°49.00'S, 145°04.50'E, Mt. Wilhelm, Pindaunde Creek, 2900 m a.s.l. (in forest), S3 (oria.4), 18 Aug 1999, leg. L. Čížek . Deposited in MZL. Paratype. 1 nymph (on 2 slides, GBIFCH 00465218, deposited in MZL), same data as holotype.

Labiobaetis elisae sp. n.

Figures 50, 51, 63b, 64a

Diagnosis

Larva. Following combination of characters: A) labrum dorsal submarginal arc of setae composed of one plus 11–13 long, simple setae; B) labrum dorsally with many medium, fine, simple setae, mainly arranged in one band; C) labial palp segment III with emargination at distal margin; D) maxillary palp shorter than galea-lacinia; E) fore femur broad, length ca. 2× maximum width, dorsal margin with an irregular row of more than 40 curved, spine-like setae and some curved, spine like setae near margin.

Description

Larva (Figs 50, 51, 63b). Body length 9.6 mm.

Figure 50. 

Labiobaetis elisae sp. n., larva morphology: a Labrum b Right mandible c Right prostheca d Left mandible e Left prostheca fHypopharynxg Maxilla h Labium.

Figure 51. 

Labiobaetis elisae sp. n., larva morphology: aForelegb Tibia dorsal seta c Fore claw dTergum IV e Gill IV fParaproct.

Colouration. Head, thorax and abdomen dorsally brown, abdominal terga I and X lighter. Head and thorax with bright median, dorsal suture, forewing pads with bright striation. Thorax and abdomen ventrally light brown, femur with brown dorsal margin, legs otherwise light brown, caudal filaments light brown.

Antenna with scape and pedicel sub-cylindrical, without distolateral process at scape; flagellum with broad, apically blunt spines and fine, simple setae on apex of each segment.

Labrum (Fig. 50a). Rectangular, length 0.6× maximum width. Distal margin with medial emargination and a small process. Dorsally with many medium to long, fine, simple setae, mainly arranged in one band; submarginal arc of setae composed of one plus 11–13 long, simple setae. Lateral margin with few long, fine, simple setae. Ventrally with marginal row of setae composed of lateral and anterolateral long, feathered setae and medial long, bifid setae; ventral surface with eight short, spine-like setae near lateral and anterolateral margin.

Right mandible (Fig. 50b, c). Incisors fused. Outer and inner sets of denticles with 4 + 3 denticles plus one small intermediate denticle. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically denticulate. Margin between prostheca and mola slightly convex. Tuft of setae at apex of mola present.

Left mandible (Fig. 50d, e). Incisors fused. Outer and inner sets of denticles with 3 + 4 denticles. Prostheca robust, apically with small denticles and comb-shape structure. Margin between prostheca and mola slightly convex, with minute denticles toward subtriangular process. Subtriangular process long and slender, above level of area between prostheca and mola. Denticles of mola apically constricted. Tuft of setae at apex of mola present.

Both mandibles with lateral margins slightly convex. Basal half with fine, simple setae scattered over dorsal surface.

Hypopharynx (Fig. 50f). Lingua longer than superlingua. Lingua about as broad as long; medial tuft of stout setae present; distal half not expanded. Superlingua rounded; lateral margin rounded; fine, long, simple setae along distal margin and short, simple setae in distal part.

Maxilla (Fig. 50g). Galea-lacinia with two simple, robust apical setae under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one spine-like seta and six long, simple setae. Maxillary palp shorter than length of galea-lacinia; two segmented. Palp segment II somewhat shorter than segment I. Setae on maxillary palp fine and simple, scattered over surface of segments I and II. Palp segment III about as long as segment II. Apex of last segment rounded, without excavation at inner distolateral margin.

Labium (Fig. 50h). Glossa basally broad, narrowing toward apex; shorter than paraglossa; inner margin with six spine-like setae increasing in length distally; apex with three long, robust, pectinate setae and one short, robust seta; outer margin with six long spine-like setae increasing in length distally; ventral surface with short, simple setae. Paraglossa sub-rectangular, curved inward; apex rounded; with three rows of long, robust, apically pectinate setae; dorsally with nine medium, simple setae; ventrally with three long, spine-like setae near inner margin. Labial palp with segment I 0.8× length of segments II and III combined. Segment I dorsally covered with micropores and ventrally with fine, simple setae along margins. Segment II with a short, thumb-like distomedial protuberance; distomedial protuberance 0.2× width of base of segment III; inner and outer margin both with short, fine, simple setae; dorsally with row of five long, spine-like, simple setae. Segment III conical; apex with emargination; ventrally covered with short, fine, simple setae.

Hind wing pads absent.

Foreleg (Fig. 51a–c). Ratio of foreleg segments 1.2:1.0:0.5:0.2. Femur. Length ca. 2× maximum width. Dorsal margin with an irregular row of more than 40 curved, spine-like setae and some curved, spine-like setae and fine, simple setae near margin; length of setae 0.1× maximum width of femur. Apex rounded; with one pair of curved, spine-like setae and many short, stout, apically rounded setae. Many stout, lanceolate, setae and a few fine, simple setae along ventral margin; femoral patch poorly developed. Tibia. Dorsal margin with a row of fine, simple setae and a row of stout, lanceolate setae along margin. Ventral margin with a row of short, curved, spine-like setae and a tuft of long, fine, simple setae on apex. Anterior surface scattered with stout, lanceolate, apically rounded setae and fine, simple setae. Tibio-patellar suture present on basal 2/3. Tarsus. Dorsal margin with a row of short, spine-like setae and a row of long, fine, simple setae on and near margin, especially on apex. Ventral margin with a row of curved, spine-like setae. Tarsal claw with one row of 11–12 denticles; tapering distally; with 4–6 stripes; subapical setae absent.

Tergum (Fig. 51d). Surface with irregular rows of U-shaped scale bases and scattered fine, simple setae, scales short and apically rounded. Posterior margin of tergum IV with rounded spines, wider than long.

Gills (Fig. 51e). Present on segments II - VII. Margin with small denticles intercalating long, fine, simple setae. Tracheae extending from main trunk to inner and outer margins. Gill IV as long as length of segments V and 1/2 VI combined. Gill VII little longer than length of segment VIII.

Paraproct (Fig. 51f). Distally expanded, with many marginal, stout spines. Surface with U-shaped scale bases and scattered fine, simple setae. Postero-lateral extension (cercotractor) with small marginal spines.

Etymology

Dedicated to Elisa Gattolliat, the daughter of one of the authors.

Distribution

New Guinea.

Biological aspects

The specimens were collected in altitudes of 1200 m and 1400 m a.s.l.

Type-material

Holotype. Nymph (on slide, GBIFCH 00465219), Papua New Guinea, Western Highlands, Kundum, 1400 m, 03 Mar 2007, 05°16.10'S, 144°27.87'E, Kinibel (PNG142). Deposited in ZSM. Paratypes. 31 nymphs (1 on slide, GBIFCH 00465220, 20 in alcohol, GBIFCH 00515221; 10 in alcohol, GBIFCH 00515222, deposited in ZSM), same data as holotype; 1 nymph (on slide, GBIFCH 00465221, remaining parts in alcohol, GBIFCH 00515287, deposited in MZL), Papua New Guinea, Madang, Simbai area, 1200 m, 10 Mar 2007, 05°13.39'S, 144°37.29'E, Kinibel (PNG 152); 1 nymph (on slide, GBIFCH 00465231, deposited in MZL), Papua New Guinea, Eastern Highlands, Bena, 1393 m, 20 Oct 2002, 06°11.02'S, 145°26.41'E, grassland river, K. Sagata leg.

Labiobaetis inopinatus sp. n.

Figures 52, 53, 64b

Diagnosis

Larva. Following combination of characters: A) labrum dorsal submarginal arc of setae composed of 21 long, lanceolate, apically pectinate setae; B) maxillary palp much longer than length of galea-lacinia, apically rounded, with excavation at inner distolateral margin; C) labial palp segment II with a large, lobed distomedial protuberance, segment III slightly pentagonal, apically slightly pointed; D) fore femur very slender, length ca. 5× maximum width, dorsal margin with a row of ca. 12 curved, spine-like setae; E) fore claw with one row of eleven denticles.

Description

Larva (Figs 52, 53).

Figure 52. 

Labiobaetis inopinatus sp. n., larva morphology: a Labrum b Labrum dorsal, submarginal seta c Right mandible d Right prostheca e Left mandible f Left prostheca gHypopharynxh Maxilla i Labium.

Figure 53. 

Labiobaetis inopinatus sp. n., larva morphology: aForelegb Fore claw.

Colouration. Unknown.

Labrum (Fig. 52a, b). Rectangular, length 0.7× maximum width. Distal margin with medial emargination and a small process. Dorsally with medium, fine, simple setae scattered over surface; submarginal arc of setae composed of 21 long, lanceolate, apically pectinate setae. Ventrally with marginal row of setae composed of lateral and anterolateral long, feathered setae and medial long, bifid setae; ventral surface with seven short, spine-like setae near lateral and anterolateral margin.

Right mandible (Fig. 52c, d). Incisors fused. Outer and inner sets of denticles with 4 + 3 denticles plus one small intermediate denticle. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically denticulate. Margin between prostheca and mola straight, with minute denticles. Tuft of setae at apex of mola present.

Left mandible (Fig. 52e, f). Incisors fused. Outer and inner sets of denticles with 4 + 4 denticles. Prostheca robust, apically with small denticles and comb-shape structure. Margin between prostheca and mola straight, with minute denticles towards subtriangular process. Subtriangular process long and slender, above level of area between prostheca and mola. Denticles of mola apically constricted. Tuft of setae at apex of mola present.

Both mandibles with lateral margins almost straight. Basal half with fine, simple setae scattered over dorsal surface.

Hypopharynx (Fig. 52g). Lingua shorter than superlingua. Lingua longer than broad; medial tuft of stout setae present; distal half laterally expanded. Superlingua slightly concave; lateral margin rounded; fine, long, simple setae along distal margin.

Maxilla (Fig. 52h). Galea-lacinia with two simple, robust apical setae under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one spine-like seta and six long, simple setae. Maxillary palp 1.7× as long as length of galea-lacinia; two segmented. Palp segment II 1.2× length of segment I. Setae on maxillary palp fine and simple, scattered over surface of segments I and II. Apex of last segment rounded, with excavation at inner distolateral margin.

Labium (Fig. 52i, j). Glossa basally broad, narrowing toward apex; shorter than paraglossa; inner margin with eight spine-like setae increasing in length distally; apex with three long, robust, pectinate setae; outer margin with five long, spine-like setae; ventral surface with short, fine, simple, scattered setae. Paraglossa sub-rectangular, curved inward; apex rounded; with three rows of long, robust, apically pectinate setae; dorsally with five medium, simple setae; ventrally with three long, spine-like setae near inner margin. Labial palp with segment I 0.7× length of segments II and III combined. Segment I covered with short, fine, simple setae ventrally and micropores dorsally. Segment II with a large, lobed distomedial protuberance; distomedial protuberance 0.7× width of base of segment III; inner and outer margin both with short, fine, simple setae; dorsally with two long, spine-like, simple setae. Segment III slightly pentagonal; apex slightly pointed; length 1.2× width; ventrally covered with short and medium spine-like, simple setae and short, fine, simple setae.

Hind wing pads unknown.

Foreleg (Fig. 53a, b). Ratio of foreleg segments 1.1:1.0:0.5:0.1. Femur. Length ca. 5× maximum width. Dorsal margin with a row of ca. 12 curved, spine-like setae; length of setae 0.2× maximum width of femur. Apex rounded; with one pair of curved, spine-like setae and some short, stout, pointed setae. Many stout, lanceolate setae along ventral margin; femoral patch absent. Tibia. Dorsal margin with a row of stout, lanceolate setae and very fine, simple setae. Ventral margin with a row of curved, spine-like setae and some longer, spine-like, bipectinate setae and a tuft of long, fine, simple setae on apex. Anterior surface scattered with stout, lanceolate setae. Tibio-patellar suture present on basal 1/3. Tarsus. Dorsal margin bare. Ventral margin with a row of curved, spine-like setae. Tarsal claw with one row of eleven denticles; tapering distally; with three stripes; subapical setae absent.

Tergum. Unknown.

Gills. Unknown.

Paraproct. Unknown.

Etymology

Latin word for unexpected, refers to the unexpected finding of this species amongst other material.

Distribution

New Guinea.

Type-material

Holotype. Nymph (on slide, GBIFCH 00465230), Papua New Guinea, Gulf Prov., Supa-Hala, 1032 m, 10 Nov 2002, forest stream, K. Sagata leg. Deposited in ZSM.

Labiobaetis involutus (Lugo-Ortiz & McCafferty, 1999)

Figure 64b

Diagnosis

Larva. Following combination of characters: A) labrum dorsal submarginal arc of setae composed of one plus 4–5 long, simple setae; B) labial palp segment II with elongated thumb-like distomadial protuberance, segment III about semicircular; C) maxillary palp shorter than length of galea-lacinia, without excavation at inner distolateral margin of segment II; D) fore femur rather broad, length ca. 3× maximum width; E) fore claw with a row of 10–12 denticles; F) spines at posterior margin of tergum IV triangular, pointed, longer than wide; G) paraproct distally not expanded.

Examined material

Paratypes. 2 nymphs (on slides, PERC 0.012.560, PERC 0.012.561), Papua New Guinea, Bulolo River, East of Wau, 2950 ft, 15 Oct 1964, W.L. and J.G. Peters leg.

Labiobaetis pindaundensis sp. n.

Figures 54, 55, 63c, 65b

Diagnosis

Larva. Following combinations of characters: A) labrum dorsal submarginal arc of setae composed of one plus 10–12 long, simple setae; B) maxillary palp 1.6× as long as length of galea-lacinia; C) labial palp segment III conical, slightly pointed; D) labial palp segment II with a large, lobed distomedial protuberance; E) fore femur slender, length ca. 4× maximum width, dorsal margin with a row of ca. 27 curved, spine-like setae and with stout, pointed setae near margin.

Description

Larva (Figs 54, 55, 63c). Body length 7.5 mm; antenna approximately 2.5× as long as head length.

Figure 54. 

Labiobaetis pindaundensis sp. n., larva morphology: a Labrum b Right mandible c Right prostheca d Left mandible e Left prostheca fHypopharynxg Maxilla h Labium.

Figure 55. 

Labiobaetis pindaundensis sp. n., larva morphology: aForelegb Fore claw cTergum IV d Gill IV eParaproct.

Colouration. Head, thorax and abdomen dorsally brown, head and thorax with bright median, dorsal suture, forewing pads with bright striation. Head, thorax and abdomen ventrally light brown, legs colourless, caudal filaments light brown.

Antenna with scape and pedicel sub-cylindrical, without distolateral process at scape; flagellum with lanceolate spines on apex of each segment.

Labrum (Fig. 54a). Rectangular, length 0.7× maximum width. Distal margin with medial emargination and a small process. Dorsally with medium, fine, simple setae scattered over surface; submarginal arc of setae composed of one plus 10–12 long, simple setae. Ventrally with marginal row of setae composed of lateral and anterolateral long, feathered setae and medial long, bifid, pectinate setae; ventral surface with nine short, spine-like setae near lateral and anterolateral margin.

Right mandible (Fig. 54b, c). Incisors fused. Outer and inner sets of denticles with 4 + 3 denticles. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically denticulate. Margin between prostheca and mola slightly convex. Tuft of setae at apex of mola present.

Left mandible (Fig. 54d, e). Incisors fused. Outer and inner sets of denticles with 4 + 3 denticles. Prostheca robust, apically with small denticles and comb-shape structure. Margin between prostheca and mola slightly convex. Subtriangular process long and slender, above level of area between prostheca and mola. Denticles of mola apically constricted. Tuft of setae at apex of mola present.

Both mandibles with lateral margins almost straight. Basal half with fine, simple setae scattered over dorsal surface.

Hypopharynx (Fig. 54f). Lingua shorter than superlingua. Lingua longer than broad; medial tuft of stout setae present; distal half laterally expanded. Superlingua rounded; lateral margin rounded; fine, long, simple setae along distal margin.

Maxilla (Fig. 54g). Galea-lacinia with two simple, robust apical setae under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one bipectinate, spine-like seta and seven long, simple setae. Maxillary palp 1.6× as long as length of galea-lacinia; two segmented. Palp segment II 1.9× length of segment I. Setae on maxillary palp fine and simple, scattered over surface of segments I and II. Apex of last segment slightly pointed, without excavation at inner distolateral margin.

Labium (Fig. 54h). Glossa basally broad, narrowing toward apex; shorter than paraglossa; inner margin with ten spine-like setae increasing in length distally; apex with three long, robust setae; outer margin with ten long, spine-like setae; ventral surface with fine, simple setae. Paraglossa sub-rectangular, curved inward; apex rounded; with three rows of long, robust, apically pectinate setae; dorsally with ten medium, simple setae; ventrally with six long, spine-like setae near inner margin. Labial palp with segment I 0.7× length of segments II and III combined. Segment I covered with short, fine, simple setae ventrally and micropores dorsally. Segment II with a large, lobed distomedial protuberance; distomedial protuberance 0.8× width of base of segment III; inner and outer margin both with short, fine, simple setae; dorsally with row of five long, spine-like, simple setae. Segment III conical; apex slightly pointed; length 1.2× width; ventrally covered with medium spine-like, simple setae and short, fine, simple setae.

Hind wing pads absent.

Foreleg (Fig. 55a, b). Ratio of foreleg segments 1.4:1.0:0.8:0.2. Femur. Length ca. 4× maximum width. Dorsal margin with a row of ca. 27 curved, short, spine-like setae and with stout, pointed setae near margin; length of setae 0.14× maximum width of femur. Apex rounded; with two pairs of curved, spine-like setae and many short, stout, pointed setae. Many stout, lanceolate setae and a few fine, simple setae along ventral margin; femoral patch poorly developed. Tibia. Dorsal margin with a row of short, curved, spine-like setae and long, fine, simple setae. Ventral margin with a row of curved, spine-like setae, apically longer, dense and bipectinate and with a tuft of long, fine, simple setae. Anterior surface scattered with many stout, lanceolate setae, partly bipectinate (difficult to see). Tibio-patellar suture present on basal 1/2. Tarsus. Dorsal margin with a row of short, curved, spine-like setae. Ventral margin with a row of curved, spine-like setae. Tarsal claw with one row of 13–14 denticles; distally pointed; with 5–6 stripes; subapical setae absent.

Tergum (Fig. 55c). Surface with irregular rows of U-shaped scale bases and scattered fine, simple setae, scales short and apically rounded. Posterior margin of tergum IV with rounded spines, wider than long.

Gills (Fig. 55d). Present on segments II–VII. Margin with small denticles intercalating long, fine, simple setae. Tracheae extending from main trunk to inner and outer margins. Gill IV as long as length of segments V, VI and 1/2 VII combined. Gill VII as long as length of segments VIII and IX combined.

Paraproct (Fig. 55e). Distally slightly expanded, with many marginal, stout spines. Surface with U-shaped scale bases and scattered fine, simple setae. Postero-lateral extension (cercotractor) with small marginal spines.

Etymology

Refers to Pindaunde Creek in Papua New Guinea, where the species has been collected.

Distribution

New Guinea.

Biological aspects

The specimens were collected at altitudes of 1700 m, 2600 m and 2900 m a.s.l., partly in forest.

Type-material

Holotype. Nymph (on slide, GBIFCH 00465222), Papua New Guinea, Simbu Prov., 05°49.00'S, 145°04.50'E, (GPS), Mt. Wilhelm, Pindaunde Creek, 2900 m a.s.l. (in forest), S3 (oria.4),18 Aug 1999, leg. L. Čížek. Deposited in MZL. Paratypes. 13 nymphs (1 on slide, GBIFCH 00465223, 8 in alcohol, GBIFCH 00515236, GBIFCH 00508125, deposited in MZL; 4 in alcohol, GBIFCH 00515237, deposited in ZSM), same data as holotype; 2 nymphs (1 on slide, GBIFCH 00465224, 1 in alcohol, GBIFCH 00515238, deposited in MZL), Papua New Guinea, Simbu Prov., 05°49.03'S, 145°05.27'E, Mt. Wilhelm, Pindaunde Creek, 2600 m a.s.l. (near fish farm), (9181 ft GPS), S4 (oria.5), 18 Aug 1999, L. Čížek leg.

Additional material

10 nymphs (1 on slide, GBIFCH 00465225, 9 in alcohol, GBIFCH 00515278, deposited in MZL), Papua New Guinea, Central, Woitape, 1700 m, 01.2008, 08°31.29'S, 147°13.68'E, Posman (PNG 166).

Labiobaetis vallus sp. n.

Figures 56, 57, 63d, 64b

Diagnosis

Larva. Following combination of characters: A) labrum dorsal submarginal arc of setae composed of 23 long, lanceolate, apically pointed setae; B) maxillary palp with segment II 2.4× longer than length of segment I, slender, apically pointed, without excavation at inner lateral margin; C) labial palp segment III sub-rectangular, apically slightly pointed; D) labial palp segment II with an elongated, thumb-like distomedial protuberance; E) fore femur slender, length ca. 4× maximum width, dorsal margin with a row of ca. 10 curved, spine-like setae and some stout, pointed setae near margin.

Description

Larva (Figs 56, 57, 63d). Body length 5.4 mm.

Figure 56. 

Labiobaetis vallus sp. n., larva morphology: a Labrum b Labrum dorsal, submarginal seta c Right mandible d Right prostheca e Left mandible f Left prostheca g Left mandible, area between prostheca and mola hHypopharynxi Maxilla j Labium.

Figure 57. 

Labiobaetis vallus sp. n., larva morphology: aForelegb Femur ventral seta c Tibia bipectinate seta d Fore claw eTergum IV f Gill III gParaproct.

Colouration. Thorax and abdomen dorsally brown, with bright pattern as in Fig. 63d. Thorax with bright median, dorsal line. Thorax and abdomen ventrally colourless, abdomen light brown toward the end. Legs colourless, femur with proxomedial and distomedial brown spots, tibia with proximal and distal brown spots. Caudal filaments light brown.

Antenna with scape and pedicel sub-cylindrical, without distolateral process at scape.

Labrum (Fig. 56a, b). Rectangular, length 0.6× maximum width. Distal margin with medial emargination and a small process. Dorsally with medium, fine, simple setae scattered over surface; submarginal arc of setae composed of 23 long, lanceolate setae. Ventrally with marginal row of setae composed of lateral and anterolateral long, feathered setae and medial long, bifid, pectinate setae; ventral surface with five short, spine-like setae near lateral and anterolateral margin.

Right mandible (Fig. 56c, d). Incisors fused. Outer and inner sets of denticles with 4 + 3 denticles. Inner margin of innermost denticle with a row of thin setae. Prostheca robust, apically denticulate. Margin between prostheca and mola slightly convex. Tuft of setae at apex of mola present.

Left mandible (Fig. 56e–g). Incisors fused. Outer and inner sets of denticles with 3 + 4 denticles and one minute intermediate denticle. Prostheca robust, apically with small denticles and comb-shape structure. Margin between prostheca and mola straight, with minute denticles towards subtriangular process. Subtriangular process long and slender, above level of area between prostheca and mola. Denticles of mola apically constricted. Tuft of setae at apex of mola present.

Both mandibles with lateral margins almost straight. Basal half with fine, simple setae scattered over dorsal surface.

Hypopharynx (Fig. 56h). Lingua longer than superlingua. Lingua about as broad as long; medial tuft of stout setae present; distal half not expanded. Superlingua rounded; lateral margin angulate; fine, long, simple setae along distal margin.

Maxilla (Fig. 56i). Galea-lacinia with two simple, robust apical setae under crown. Inner dorsal row of setae with three denti-setae, distal denti-seta tooth-like, middle and proximal denti-setae slender, bifid and pectinate. Medially with one bipectinate, spine-like seta and five long, simple setae. Maxillary palp 1.2× as long as length of galea-lacinia; two segmented. Palp segment II 2.4× length of segment I. Setae on maxillary palp fine and simple, scattered over surface of segments I and II. Apex of last segment slightly pointed, without excavation at inner distolateral margin.

Labium (Fig. 56j). Glossa basally broad, narrowing toward apex; shorter than paraglossa; inner margin with seven spine-like setae increasing in length distally; apex with three long, robust, pectinate setae; outer margin with six long spine-like setae increasing in length distally; ventral surface with fine, simple setae. Paraglossa sub-rectangular, curved inward; apex rounded; with three rows of long, robust, apically pectinate setae; dorsally with five medium, simple setae; ventrally with four long, spine-like setae near inner margin. Labial palp with segment I 0.7× length of segments II and III combined. Segment I covered with short and medium, fine, simple setae ventrally and with micropores dorsally. Segment II with an elongated, thumb-like distomedial protuberance; distomedial protuberance 0.5× width of base of segment III; inner and outer margin both with short, fine, simple setae; dorsally with row of six medium, spine-like, simple setae. Segment III sub-rectangular; apex slightly pointed; length 1.0× width; ventrally covered with long and medium spine-like, simple setae and short, fine, simple setae.

Hind wing pads absent.

Foreleg (Fig. 57a–d). Ratio of foreleg segments 1.4:1.0:0.6:0.2. Femur. Length ca. 4× maximum width. Dorsal margin with a row of ca. 10 curved, spine-like setae and some stout, pointed setae near margin; length of setae 0.2× maximum width of femur. Apex rounded; with one pair of curved, spine-like setae and some minute setae. Stout, lanceolate, bipectinate setae along ventral margin; femoral patch absent. Tibia. Dorsal margin with a row of curved, spine-like setae and long, fine, simple setae. Ventral margin with a row of curved, spine-like setae, apically longer, dense and bipectinate and with a tuft of long, fine, simple setae. Anterior surface scattered with stout, lanceolate setae. Tibio-patellar suture present on basal 1/2. Tarsus. Dorsal margin with a row of short, spine-like setae and long, simple setae. Ventral margin with a row of curved, spine-like, bipectinate setae. Tarsal claw with one row of 11–13 denticles; distally pointed; with two stripes; subapical setae absent.

Tergum (Fig. 57e). Surface with irregular rows of shallow U-shaped scale bases and scattered micropores. Posterior margin of tergum IV with triangular spines, longer than wide.

Gills (Fig. 57f). Present on segments II–VII. Margin with small denticles intercalating fine simple setae. Tracheae extending from main trunk to inner and outer margins. Gill IV unknown, gill III as long as segments IV and 1/2 V combined. Gill VII unknown.

Paraproct (Fig. 57g). Distally not expanded, with ca. 21 marginal, stout spines. Surface with U-shaped scale bases and scattered fine, simple setae and micropores. Postero-lateral extension (cercotractor) with small marginal spines.

Etymology

Refers to the remarkable, fence-like, dorsal, submarginal arc of setae of the labrum.

Distribution

New Guinea.

Biological aspects

The specimen was collected at an altitude of 400 m a.s.l.

Type-material

Holotype. Nymph (on slide, GBIFCH 00465226), Papua New Guinea, Madang, Keki, Adalbert Mts, 400 m, 29 Nov 2006, 04°43.06'S, 145°24.44'E, Binatang Boys (PNG 119). Deposited in ZSM.

Labiobaetis xeniolus (Lugo-Ortiz & McCafferty, 1999)

Figure 65b

Diagnosis

Larva. Following combination of characters: A) labrum dorsal submarginal arc of setae composed of one plus 7–9 long, simple setae; B) maxillary palp shorter than length of galea-lacinia, segment II without excavation at inner distolateral margin; C) labial palp segment II with elongated thumb-like distomedial protuberance, segment III about semicircular; D) femur rather broad, length ca. 2–3× maximum width, dorsal margin with >40 curved, spine-like setae; E) fore claw with a row of 8–10 denticles; F) Gills with strongly developed, dense, pigmented tracheation; G) spines at posterior margin of tergum IV irregular, mostly triangular, apically rounded, wider than long; H) paraproct with marginal spines poorly defined.

Examined material

Paratypes. 2 nymphs (on slides, PERC 0.012.578, PERC 0.012.579), Papua New Guinea, Morobe Prov., Poverty Cr., Mt. Missim, 1600 m, 18.09. Sept 1983, J.T. and D.A. Polhemus leg.

Key to the nymphs of Labiobaetis species from New Guinea

1 Labrum submarginal dorsal arc of simple setae (Fig. 1a) 2
Labrum submarginal dorsal arc of lanceolate setae (Fig. 1e) L. vallus sp. n.
Labrum submarginal dorsal arc of lanceolate, apically pectinate setae (Fig. 1f).... L. inopinatus sp. n.
Labrum submarginal dorsal arc of spatulate, apically pectinate setae (Fig. 1d) 17
Labrum submarginal dorsal arc of feathered setae (Fig. 1b) 19
Labrum submarginal dorsal arc of dendritic setae (Fig. 1c) L. dendrisetis sp. n.
2(1) Labial palp segment II enlargement elongated, thumb-like (Fig. 1j) 3
Labial palp segment II enlargement short, thumb-like (Fig. 1k) 7
Labial palp segment II enlargement compact, rounded (Fig. 1h) 12
Labial palp segment II enlargement large, lobed (Fig. 1g) L. pindaundensis sp. n.
Labial palp segment II enlargement hook-like (Fig. 1i) 16
3(2) Labial palp segment III subrectangular (Fig. 8h) L. claudiae sp. n.
Labial palp segment III about semicircular (Fig. 1j) 4
Labial palp segment III conical (Fig. 1h) 6
Labial palp segment III oblong (Fig. 1k) L. gindroi sp.n.
4(3) Mandibles with outermost denticle normally developed (Fig. 1m); maxillary palp segment II longer than segment I; spines at posterior margin of abdominal terga longer than wide; spines at posterior margin of abdominal terga mostly triangular, pointed 5
Mandibles with outermost denticle blade-like (Fig. 1l); maxillary palp segment II about as long or shorter than segment I; spines at posterior margin of abdominal terga wider than long; spines at posterior margin of abdominal terga mostly rounded; paraproct with marginal spines poorly defined (Lugo-Ortiz et al. 1999: figs 104–115) L. xeniolus
5(4) Maxillary palp shorter than length of galea-lacinia; gills margin serrate with alternating smaller and bigger denticles and with fine, simple setae; number of femur dorsal setae on margin > 40; paraproct distally not expanded (Lugo-Ortiz et al. 1999: figs 31–42) L. involutus
Maxillary palp longer than length of galea-lacinia; gills margin serrate with small denticles and with fine simple setae (Fig. 11d); number of femur dorsal setae on margin 12–20; paraproct distally expanded (Fig. 11e) L. stagnum sp. n.
6(3) Labial palp segment III distal margin rounded (Fig. 46h); maxillary palp segment II about as long or shorter than segment I; spines at posterior margin of abdominal terga about as long as wide; fore femur ca. 2–3× as long as wide L. centralensis sp. n.
Labial palp segment III distal margin truncate (Fig. 39h); maxillary palp segment II longer than segment I; spines at posterior margin of abdominal terga wider than long; fore femur ca. 4–5× as long as wide L. paravitilis sp. n.
7(2) Labium paraglossae distally with three rows of setae 8
Labium paraglossae distally with four rows of setae L. altus sp. n.
Labium paraglossae distally with five rows of setae L. wilhelmensis sp. n.
8(7) Mandibles with outermost denticle normally developed (Fig. 1m) 9
Mandibles with outermost denticle blade-like (Fig. 1l) 10
9(8) Labial palp segment III conical, distal margin with emargination (Fig. 50h); maxillary palp shorter than length of galea-lacinia; spines at posterior margin of abdominal terga wider than long L. elisae sp. n.
Labial palp segment III slightly pentagonal, distal margin rounded (Fig. 34d); maxillary palp longer than length of galea-lacinia; spines at posterior margin of abdominal terga about as long as wide L. vitilis
10(8) Labial palp segment III distal margin slightly pointed (Fig. 1k) L. gladius sp. n.
Labial palp segment III distal margin rounded (Fig. 16c) 11
11(10) Maxillary palp segment II longer than segment I; spines at posterior margin of abdominal terga wider than long; gills margin serrate with small denticles and with fine simple setae (Fig. 20d); number of femur dorsal setae on margin 31–40 L. janae sp. n.
Maxillary palp segment II about as long or shorter than segment I; spines at posterior margin of abdominal terga longer than wide; gills margin serrate with alternating smaller and bigger denticles and with fine, simple setae (Lugo-Ortiz et al. 1999: fig. 54); number of femur dorsal setae on margin > 40 L. petersorum
12(2) Maxillary palp about as long as length of galea-lacinia L. magnovaldus sp. n.
Maxillary palp longer (1.2–1.4×) than length of galea-lacinia 13
Maxillary palp much longer (> 1.4×) than length of galea-lacinia L. planus sp. n.
13(12) Gills margin serrate with small denticles and with robust, lanceolate setae (Fig. 23d, e) L. branchiaesetis sp. n.
Gills margin serrate with alternating smaller and bigger denticles and with fine, simple setae (Fig. 29d); paraproct surface with several robust, lanceolate setae (Fig. 29e, f) L. podolakae sp. n.
Gills margin serrate with small denticles and with fine simple setae (Fig. 31d) 14
14(13) Spines at posterior margin of abdominal terga about as long as wide; labrum submarginal dorsal arc of setae with 0–9 setae; maxillary palp segment II with well-developed distolateral excavation; paraproct distally not or slightly expanded (Fig. 1r, s) 15
Spines at posterior margin of abdominal terga wider than long; labrum submarginal dorsal arc of setae with 10–14 setae; maxillary palp segment II without distolateral excavation; paraproct distally expanded (Fig. 1q) L. rutschmannae sp. n.
15(14) Spines at posterior margin of abdominal terga mostly rounded; paraproct with > 40 marginal spines; tibia as Fig. 33a L. schwanderae sp. n.
Spines at posterior margin of abdominal terga mostly triangular, pointed; paraproct with 31–40 marginal spines; tibia as Fig. 21c L. tuberpalpus
16(2) Maxillary palp segment II longer than segment I; gills margin serrate with alternating smaller and bigger denticles and with fine, simple setae (Fig. 45d); fore femur ca. 2–3× as long as wide; labial palp as Fig. 44h L. paravultuosus sp. n.
Maxillary palp segment II about as long or shorter than segment I; gills margin serrate with small denticles and with fine simple setae; fore femur ca. 4–5× as long as wide; labial palp as Fig. 43b.. L. vultuosus
17(1) Maxillary palp longer (1.1–1.4×) than length of galea-lacinia; fore femur ca. 2–3× as long as wide 18
Maxillary palp much longer (> 1.4×) than length of galea-lacinia; fore femur ca. 4–5× as long as wide L. lobatus sp. n.
18(17) Maxillary palp segment II longer than segment I; spines at posterior margin of abdominal terga mostly triangular, pointed; paraproct distally expanded (Fig. 3f) L. balkei sp. n.
Maxillary palp segment II about as long or shorter than segment I; spines at posterior margin of abdominal terga mostly rounded; paraproct distally slightly expanded (Fig. 7e) L. michaeli sp. n.
19(1) Spines at posterior margin of abdominal terga mostly rounded; femur ventral without pectinate setae L. papuaensis sp. n.
Spines at posterior margin of abdominal terga mostly triangular, pointed; femur ventral with pectinate setae (difficult to see) L. orientis sp. n.
Figure 58. 

Habitus, larvae: a Labiobaetis balkei sp. n., dorsal view b Labiobaetis lobatus sp. n., dorsal view c Labiobaetis michaeli sp. n., dorsal view d Labiobaetis claudiae sp. n., dorsal view.

Figure 59. 

Habitus, larvae: a Labiobaetis stagnum sp. n., dorsal view b Labiobaetis papuaensis sp. n., dorsal view c Labiobaetis gladius sp. n., dorsal view d Labiobaetis janae sp. n., dorsal view.

Figure 60. 

Habitus, larvae: a Labiobaetis branchiaesetis sp. n., dorsal view b Labiobaetis magnovaldus sp. n., dorsal view c Labiobaetis planus sp. n., dorsal view d Labiobaetis podolakae sp. n., dorsal view.

Figure 61. 

Habitus, larvae: a Labiobaetis rutschmannae sp. n., dorsal view, without head b Labiobaetis schwanderae sp. n., dorsal view c Labiobaetis altus sp. n., dorsal view d Labiobaetis gindroi sp. n., dorsal view.

Figure 62. 

Habitus, larvae: a Labiobaetis paravitilis sp. n., dorsal view b Labiobaetis wilhelmensis sp. n., dorsal view c Labiobaetis paravultuosus sp. n., dorsal view.

Figure 63. 

Habitus, larvae: a Labiobaetis centralensis sp. n., dorsal view b Labiobaetis elisae sp. n., dorsal view c Labiobaetis pindaundensis sp. n., dorsal view d Labiobaetis vallus sp. n., dorsal view, without head.

Distributions

The distributions of all species known from New Guinea are shown in Figures 64, 65. The six species described in Lugo-Ortiz et al. (1999) were all collected in two restricted areas. The recent material treated in this study was collected in many locations across the island. However, there are still other regions in New Guinea where no sampling of mayflies has yet been done and many species are known from only one single population so far. In terms of altitude, the Labiobaetis species of New Guinea were found from close to sea level near the coast to high parts of the mountains till up to 3210 m a.s.l. The GPS coordinates of the locations in New Guinea are given in Table 2.

Figure 64. 

Distribution of Labiobaetis in New Guinea: a red circle, L. balkei sp. n.; blue star, L. lobatus sp. n.; yellow circle, L. michaeli sp. n.; red square, L. claudiae sp. n.; yellow square, L. stagnum sp. n.; red triangle, L. orientis sp. n.; yellow triangle, L. papuaensis sp. n.; green star, L. elisae sp. n. b red circle, L. petersorum; yellow circle, L. gladius sp. n.; green circle, L. janae sp. n.; green star, L. vultuosus; red star, L. paravultuosus sp. n.; yellow triangle, L. involutus; red triangle, L. vallus sp. n.; green triangle, L. inopinatus sp. n.

Figure 65. 

Distribution of Labiobaetis in New Guinea: a red circle, L. tuberpalpus; yellow circle, L. branchiaesetis sp. n.; green circle, L. magnovaldus sp. n.; red triangle, L. planus sp. n.; blue circle, L. podolakae sp. n.; yellow triangle, L. rutschmannae sp. n.; green triangle, L. schwanderae sp. n.; red square, L. centralensis sp. n. b yellow circle, L. paravitilis sp. n.; red circle, L. altus sp. n.; green circle, L. gindroi sp. n.; yellow triangle, L. vitilis; green triangle, L. pindaundensis sp. n.; red square, L. xeniolus; blue star, L. wilhelmemsis sp. n. / L. dendrisetis sp. n. / L. pindaundensis sp. n.

Genetics

COI sequences were obtained from 20 of the new species (Table 1). The genetic distances between these species are between 13% and 32% and therefore always much higher than 3.5%, generally considered as a likely maximal value for intraspecific divergence (Hebert et al. 2003, Ball et al. 2005, Zhou et al. 2010) (Table 3). Only very limited genetic distances between 0% and 2% were found between specimens of the same species, as in L. balkei sp. n., L. janae sp. n., L. planus sp. n., L. paravultuosus sp. n. and L. centralensis sp. n. The exception is L. michaeli sp. n., where two specimens have no distance to each other (K2P), but the third specimen from the same location has a distance of 5% (K2P and p-distance) to both of them. However, sequences were obtained from only one to a few specimens per species (Table 1). In general, the genetic distances calculated with K2P are very similar to the p-distance values, but often slightly bigger, as expected (Srivathsan and Meier 2012). Both methods supported the same delimitation of species.

Table 2.

GPS coordinates of locations of examined specimens.

Species Locality GPS coordinates
L. balkei sp. n. Papua New Guinea, Central Prov. 09°01.95'S, 147°44.46'E
L. lobatus sp. n. Papua New Guinea, Central Prov. 09°00.34'S, 147°44.25'E
L. michaeli sp. n. Papua New Guinea, Eastern Highlands 05°56.80'S, 145°22.24'E
L. claudiae sp. n. Papua New Guinea, Madang Prov. 05°24.41'S, 145°38.21'E
L. stagnum sp. n. Indonesia, Papua Prov. 02°30.51'S, 140°22.83'E
L. orientis sp. n. Papua New Guinea, Eastern Highlands 07°01.70'S, 145°49.81'E
L. papuaensis sp. n. Indonesia, Papua Prov. 03°29.80'S, 135°43.89'E
L. petersorum Papua New Guinea, Morobe Prov. 07°20.30'S, 146°43.72'E
L. gladius sp. n. Papua New Guinea, Simbu Prov. 05°49.96'S, 145°06.13'E
05°48.05'S, 145°04.15'E
05°49.03'S, 145°05.27'E
Papua New Guinea, Western Highlands 05°15.87'S, 144°32.72'E
Papua New Guinea, Eastern Highlands 05°56.80'S, 145°22.23'E
L. janae sp. n. Indonesia, Papua Prov. 04°07.77'S, 138°40.77'E
L. tuberpalpus Papua New Guinea, Morobe Prov. 07°20.30'S, 146°43.72'E
06°59.00'S, 146°37.00'E
L. branchiaesetis sp. n. Papua New Guinea, Eastern Highlands 07°01.70'S, 145°49.81'E
Papua New Guinea, Gulf Prov. 07°03.60'S, 145°44.38'E
L. magnovaldus sp. n. Papua New Guinea, Simbu Prov. 05°49.00'S, 145°04.50'E
Papua New Guinea, Eastern Highlands 05°56.80'S, 145°22.24'E
L. planus sp. n. Indonesia, Papua Prov. 00°49.35'S, 131°24.20'E
L. podolakae sp. n. Papua New Guinea, Eastern Highlands 06°21.41'S, 145°54.34'E
L. rutschmannae sp. n. PapuaNewGuinea,WesternHighlands 05°14.28'S, 144°28.74'E
05°15.17'S, 144°32.81'E
L. schwanderae sp. n. Papua New Guinea, Gulf Prov. 07°05.66'S, 145°44.47'E
L. vitilis Papua New Guinea, Western Highlands 05°54.91'S, 143°59.06'E
L. altus sp. n. Papua New Guinea, Enga Prov. 05°47.55'S, 143°58.76'E
Papua New Guinea, Simbu Prov. 05°49.00'S, 145°04.50'E
L. gindroi sp. n. Indonesia, Papua Prov. 03°56.95'S, 138°54.38'E
Papua New Guinea, Western Highlands 05°15.17'S, 144°32.81'E
L. paravitilis sp. n. Papua New Guinea, Madang Prov. 05°18.09'S, 145°36.45'E
L. wilhelmensis sp. n Papua New Guinea, Simbu Prov. 05°49.00'S, 145°04.50'E
05°48.05'S, 145°04.15'E
L. vultuosus Papua New Guinea, Western Highlands 05°51.00'S, 144°14.72'E
L. paravultuosus sp. n. Papua New Guinea, Enga Prov. 05°38.11'S, 143°55.34'E
L. centralensis sp. n. Papua New Guinea, Central Prov. 09°14.34'S, 147°36.92'E
L. dendrisetis sp. n. Papua New Guinea, Simbu Prov. 05°49.00'S, 145°04.50'E
L. elisae sp. n. Papua New Guinea, Western Highlands 05°16.10'S, 144°27.87'E
Papua New Guinea, Madang Prov. 05°13.39'S, 144°37.29'E
Papua New Guinea, Eastern Highlands 06°11.02'S, 145°26.41'E
L. inopinatus sp. n. Papua New Guinea, Gulf Prov. 07°37'S 146°04'E
L. pindaundensis sp. n. Papua New Guinea, Simbu Prov. 05°49.00'S, 145°04.50'E
05°49.03'S, 145°05.27'E
Papua New Guinea, Central Prov. 08°31.29'S, 147°13.68'E
L. vallus sp. n. Papua New Guinea, Madang Prov. 04°43.06'S, 145°24.44'E
L. involutus Papua New Guinea, Morobe Prov. 07°20.30'S, 146°43.72'E
L. xeniolus Papua New Guinea, Morobe Prov. 07°13.00'S, 146°49.00'E
Table 3.

Genetic distances (COI) between sequenced specimens, using the Kimura 2-parameter.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26
1 L. balkei sp. n.
2 L. balkei sp. n. 0,00
3 L. michaeli sp. n. 0,26 0,26
4 L. michaeli sp. n. 0,26 0,26 0,00
5 L. michaeli sp. n. 0,28 0,28 0,05 0,05
6 L. lobatus sp. n. 0,20 0,20 0,28 0,28 0,28
7 L. claudiae sp. n. 0,21 0,21 0,25 0,25 0,27 0,24
8 L. stagnum sp. n. 0,22 0,22 0,27 0,27 0,26 0,22 0,21
9 L. orientis sp. n. 0,26 0,26 0,27 0,27 0,26 0,24 0,18 0,22
10 L. papuaensis sp. n. 0,27 0,27 0,25 0,25 0,25 0,24 0,20 0,19 0,21
11 L. gladius sp. n. 0,22 0,22 0,25 0,25 0,27 0,24 0,19 0,23 0,24 0,20
12 L. janae sp. n. 0,24 0,24 0,29 0,29 0,29 0,24 0,23 0,23 0,23 0,24 0,23
13 L. janae sp. n. 0,24 0,24 0,29 0,29 0,29 0,24 0,23 0,23 0,23 0,24 0,23 0,00
14 L. branchiaesetis sp. n. 0,20 0,20 0,26 0,26 0,25 0,24 0,18 0,21 0,22 0,23 0,19 0,19 0,19
15 L. planus sp. n. 0,22 0,22 0,25 0,25 0,25 0,24 0,18 0,16 0,19 0,17 0,18 0,18 0,18 0,18
16 L. planus sp. n. 0,22 0,22 0,25 0,25 0,25 0,24 0,18 0,16 0,19 0,17 0,18 0,18 0,18 0,18 0,00
17 L. podolakae sp. n. 0,25 0,25 0,25 0,25 0,25 0,24 0,20 0,19 0,22 0,20 0,18 0,20 0,20 0,14 0,17 0,17
18 L. schwanderae sp. n. 0,21 0,21 0,25 0,25 0,25 0,24 0,18 0,18 0,19 0,19 0,16 0,22 0,22 0,19 0,13 0,13 0,19
19 L. altus sp. n. 0,22 0,22 0,29 0,29 0,30 0,24 0,20 0,18 0,15 0,20 0,22 0,24 0,24 0,22 0,18 0,18 0,20 0,20
20 L. gindroi sp. n. 0,26 0,26 0,24 0,24 0,25 0,24 0,21 0,19 0,20 0,19 0,22 0,19 0,19 0,20 0,20 0,20 0,20 0,18 0,16
21 L. paravitilis sp. n. 0,24 0,24 0,27 0,27 0,26 0,24 0,24 0,20 0,24 0,21 0,21 0,22 0,22 0,17 0,21 0,21 0,21 0,20 0,19 0,20
22 L. paravultuosus sp. n. 0,22 0,22 0,24 0,24 0,24 0,24 0,20 0,18 0,21 0,18 0,21 0,21 0,21 0,19 0,15 0,15 0,19 0,19 0,19 0,23 0,20
23 L. paravultuosus sp. n. 0,23 0,23 0,26 0,26 0,26 0,24 0,23 0,20 0,23 0,20 0,23 0,22 0,22 0,21 0,17 0,17 0,21 0,21 0,21 0,25 0,21 0,02
24 L. centralensis sp. n. 0,22 0,22 0,31 0,31 0,29 0,24 0,21 0,22 0,25 0,23 0,23 0,20 0,20 0,24 0,22 0,22 0,21 0,22 0,23 0,22 0,26 0,26 0,27
25 L. centralensis sp. n. 0,23 0,23 0,32 0,32 0,30 0,24 0,21 0,23 0,24 0,23 0,23 0,20 0,20 0,24 0,22 0,22 0,21 0,21 0,23 0,22 0,25 0,26 0,27 0,01
26 L. elisae sp. n. 0,22 0,22 0,28 0,28 0,27 0,24 0,19 0,20 0,21 0,19 0,21 0,23 0,23 0,22 0,17 0,17 0,19 0,18 0,19 0,19 0,19 0,20 0,21 0,21 0,21
27 L. vallus sp. n. 0,26 0,26 0,25 0,25 0,26 0,24 0,18 0,18 0,24 0,19 0,21 0,19 0,19 0,17 0,17 0,17 0,18 0,18 0,21 0,16 0,19 0,21 0,23 0,20 0,20 0,20

Discussion

For the attribution of the new species to Labiobaetis we are referring to Kluge and Novikova (2014), Müller-Liebenau (1984a) and McCafferty and Waltz (1995). The plesiomorph Labiobaetis is characterised by a number of derived characters, some of which are not found in other taxa (Kluge and Novikova 2014): antennal scape sometimes with a distolateral process (not developed by any species in New Guinea); maxillary palp two segmented with excavation at inner distolateral margin of segment II, excavation may be poorly developed or absent (Fig. 1n–p); labium with paraglossae widened and glossae diminished; labial palp segment II with distomedial protuberance (Fig. 1g–k). All these characters vary and may be secondarily lost (Kluge and Novikova 2014). The concept of Labiobaetis is also based on additional characters (Müller-Liebenau 1984a, McCafferty and Waltz 1995, Lugo-Ortiz and McCafferty 1997, Lugo-Ortiz et al. 1999). The discovery of 26 new species allows us to slightly modify these characters: labrum dorsal, submarginal setae are arranged in one arc, the setae may belong to a simple, pointed type, a feathered type, a dendritic type, a spatulate type or a lanceolate, apically pectinate or not pectinate type (Fig. 1 a–f); mandibles with fused incisors, right prostheca apically denticulate, left prostheca apically denticulate and with comb-shape structure; hypopharynx with medial tuft of stout setae at apex of median lobe; paraglossae subrectangular, slightly curved inward; hindwing pads present, minute or absent (always absent in species from New Guinea); femoral patch well developed, rudimentary or absent; tibia at apical margin with a tuft of fine, simple setae; tarsal claw distally pointed with one row of denticles, striation present, subapical setae absent; abdominal terga with irregular rows of numerous U-shaped or rarely W-shaped scale bases, posterior margin with regular, triangular, pentagonal or rounded spines; gills on abdominal segment I present or absent (mostly absent in species from New Guinea); paraproct with ca. 18 to over 40 marginal spines, laterally always smaller, and distally expanded, slightly expanded or not expanded at all (Fig. 1q–s). The medial tuft of setae of the hypopharynx is an important character, as it is stable across the genus and quite rare in other genera. Another very important character is the femoral patch, which is considered to be a synapomorphy of the Baetini (Waltz et al. 1994), in Labiobaetis it is often rudimentary or absent, which seems to be a secondary loss. There are a few taxa outside Labiobaetis with a convergent excavation at the maxillary palp: one is Indobaetis costai Müller-Liebenau & Morihara, 1982 (Müller-Liebenau and Morihara 1982: figs 1d, 2d, McCafferty and Waltz 1995, Kluge and Novikova 2014), other species of Indobaetis do not show this character; other two species belong to the Neotropical genus Zelusia Lugo-Ortiz & McCafferty, 1998 (Salles et al. 2016). Two species from New Guinea (L. orientis sp. n., L. vallus sp. n.) have bipectinate setae ventrally on tibia and femur similar to Indocloeon Müller-Liebenau, 1982, but not on the dorsal margin of the femur as Indocloeon (Kluge 2012, Kaltenbach and Gattolliat 2017).

The seven species groups proposed in this paper are mainly based on the combination of two characters: the kind of setae composing the dorsal, submarginal arc of setae on the labrum and the shape of the distomedial protuberance of labial palp segment II, sometimes together with other additional characters. An exception is the petersorum group, where the main character is the blade-like outermost denticle of the mandibles. Species sharing combinations of character states as the type of setae forming the dorsal, submarginal arc of setae or the shape of the labial palp segment II are often very similar in most other characters, which justify the formation of species groups. These morphological groups within Labiobaetis are primarily a working tool, but could also serve as a basis for future studies on the generic delimitation and phylogeny of this probably polyphyletic genus. The inclusion of nuclear gene sequences may prove that some of them may be natural groups. In other realms, especially the Oriental realm, some species share the main characters of some of the proposed species groups: L. molawinensis (Müller-Liebenau) from the Philippines and Taiwan and L. atrebatinus (Eaton) from Eurasia have spatulate, apically pectinate setae composing the dorsal, submarginal arc of setae of the labrum and a large, lobed distomedial protuberance of the labial palp segment II like the species of the balkei group. They also share other characters such as the distolateral excavation of maxillary palp segment II, the shape of labial palp segment III, which is slightly pentagonal and apically slightly pointed, and the arrangement of outer and inner sets of denticles of the mandibles, which are as usually fused, but have a small gap between them. Therefore both species should be considered as members of that group. They are both differentiated from the species in New Guinea by a distolateral process at the antennal scape and L. atrebatinus additionally by the presence of hindwing pads and seven pairs of gills (Müller-Liebenau 1982, Kang et al. 1994). Another Oriental species, L. borneoensis (Müller-Liebenau), has a lobed distomedial protuberance at labial palp segment II combined with feathered dorsal labrum arc setae as seen in the two species of the orientis group and therefore belongs to this group as well (Müller-Liebenau 1984b). It is easily differentiated by having seven pairs of gills, an antennal scape process and hindwing pads, which the two species from New Guinea don’t have. The Australian L. inconspicuus (Lugo-Ortiz & McCafferty) shares the compact, rounded protuberance of labial palp segment II, the simple dorsal labrum arc setae and the closely neighboured position of the two first labrum arc setae with the species of the tuberpalpus group in New Guinea and may therefore belong to this group as well (Lugo-Ortiz et al. 1999, Webb and Suter 2011). However, it is missing the pair of central, submedian setae dorsally on the labrum. The L. vultuosus group of species consists of two species in New Guinea and is characterised by a hook-like protuberance of the labial palp segment II in combination with simple labrum arc setae. L. sumigarensis (Müller-Liebenau) from the Philippines shares a very similar labial palp, but has spatulate, apically pectinate dorsal submarginal labrum arc setae (Müller-Liebenau 1982). It is therefore not considered to be part of that group. As a whole we see some remarkable differences between the morphology of species from New Guinea compared to other regions: in New Guinea there are no species with an antennal scape process, all but one species have only six pairs of gills, there are no species with hindwing pads and most species have simple dorsal labrum arc setae. All other regions have several species with or without antennal scape process, with six or seven pairs of gills, with or without hindwing pads and the balance between the main types of dorsal labrum arc setae (simple, feathered, spatulate) is more equalised. The latter is especially true in the Oriental realm, whereas the feathered type seems to be dominant in the Afrotropical region (Lugo-Ortiz and McCafferty 1997, Gattolliat 2001, Gattolliat et al. 2018). The tendency of secondary loss of certain structures seems to be particularly strong in New Guinea, alternatively it could also be due to the colonization history of the island and thus a phylogenetic signal. Additionally, there is more variability in some morphological characters in New Guinea compared to all other regions: Examples are the dendritic or lanceolate dorsal labrum arc setae of L. dendrisetis sp. n. and L. vallus sp. n. respectively, the robust, lanceolate setae at the margin of the gills of L. branchiaesetis sp. n., the robust, lanceolate setae on the surface of the paraproct of L. podolakae sp. n. and the blade-like outermost denticle of the mandibles of the petersorum group.

In general, the genetic distances between the different species of Labiobaetis are rather high in New Guinea, on average 22% (K2P, Table 3). Ball et al. (2005) reported a mean interspecific, congeneric distance of 18% for mayflies from the United States and Canada. The intraspecific distances are very low as expected, ranging from 0 % to 2% (K2P), based on the limited number of sequenced specimens per species, which were mostly from one single population. However, there is one exception, L. michaeli sp. n., where one specimen has an intraspecific distance of 5% (K2P and p-distance). Sequencing errors may have contributed to that, but also compared to the usual distances between different Labiobaetis species in that region we consider this distance to be still intraspecific. Ball et al. (2005) also reported a case with 6% intraspecific distance in a mayfly in North America and intraspecific K2P distances of more than 3.5% are also not uncommon within Plecoptera (Gill et al. 2015, Gattolliat et al. 2016).

In addition to the 26 new species described in this paper we obtained five other different COI sequences with clearly interspecific genetic distance to other species with similar morphology: two sequences L. cf. balkei sp. n. (K2P 16%–30%), two sequences L. cf. vultuosus (K2P 16%–21%) and one sequence L. cf. tuberpalpus (K2P 13%). Based on the existing material we are not in a position to distinguish these specimens morphologically from all species within their morphological group. Therefore, they have to remain species hypotheses for now without further treatment in this paper. Additional material will be necessary to confirm their status in the future.

The Labiobaetis species distribution seems to be restricted to New Guinea, as far as we know, which is fully in line with other Baetidae genera having a species endemicity of close to 100% in the Australasian realm (Gattoliat and Nieto 2009). In Madagascar there is a similar situation with eight species, which are all restricted to this island (Lugo-Ortiz and McCafferty 1997, Gattolliat 2001). On the other hand, there is the Afrotropical L. glaucus (Agnew) with a widespread distribution reaching from South Africa to Saudi Arabia, including even the Comoros (Lugo-Ortiz and McCafferty 1997, Gattolliat et al. 2018). Borneo is equally known for its enormous diversity. During an 85 km2 survey of the mayfly fauna of a lowland tropical forest more than 40 mayfly genera were collected and at least 10 new genera and many new species were discovered (Barber-James et al. 2008, Sartori et al. 2003). So far only one Labiobaetis species is known from this island, but several others were already identified and will be described later (Kaltenbach and Gattolliat, in preparation), and Borneo is less well sampled than Madagascar.

Our recent knowledge shows high levels of micro-endemism restricted to smaller areas in New Guinea. This indicates that allopatry could be a major driver of diversity in the genus. Large studies about the highly diversified genus Exocelina Balke, 1998 (Coleoptera, Dytiscidae) demonstrated allopatry to be the main mechanism of diversification in New Guinea and found strong evidence that recent environmental change in the extremely structured central highlands of New Guinea with its ongoing formation of rich aquatic resources and remote valleys and mountain blocks was the primary driver of diversification in that area (Toussaint et al. 2013, 2014). There is also evidence that species in running waters are weaker dispersers then species living in standing water, which has been suggested to promote allopatric speciation and micro-endemism in the first group and dispersal in the second group (Ribera et al. 2001, Monaghan et al. 2005). Labiobaetis species mainly live in running waters, but there are a few exceptions. On the other hand, their dispersal ability seems to be high enough to have reached remote islands like Vanuatu (Gattolliat and Staniczek 2011) and Fiji (Flowers 1990) in the past and bidirectional transoceanic dispersal between Madagascar and Africa has been shown as well (Monaghan et al. 2005). Additionally, parthenogenesis has been demonstrated in the genus, which may favor successful dispersal events as well (Sivaramakrishnan et al. 1991, Gattolliat and Staniczek 2011).

Despite covering an important part of New Guinea, the sampling effort and the number of localities and different habitats is still limited and there are huge areas without any collection activities so far. Additionally we have already five species hypotheses based on genetics only in the present material, which may be confirmed as separate species in the future. Therefore we may assume, that the number of Labiobaetis species in New Guinea will continue to increase substantially with further collections in the future.

Acknowledgements

We sincerely thank Michael Balke (Zoologische Staatssammlung München, ZSM, Germany) and Tomáš Soldán (Institute of Entomology, Biology Centre CAS, České Budějovice), who passed away during the review phase of this manuscript, for the allocation of rich material from New Guinea to the Museum of Zoology Lausanne (MZL) and Lukáš Čížek (Institute of Entomology, Biology Centre CAS, České Budějovice) and Katayo Sagata (University of Papua New Guinea), who collected parts of this material. We extend our appreciation to Luke Jacobus (Purdue University, Columbus) for the loan of Labiobaetis type material from New Guinea and to Frederico F. Salles for precious information and the structure of a DELTA database, which we used for the development of our own database of Labiobaetis. We also thank Tanja Schwander (University of Lausanne, UNIL) for the possibility of one of the authors (TK) to work in her lab during a master project, and Zoé Dumas (UNIL) and Maud Liégeois (UNIL) for technical support in the lab. We are grateful to Michel Sartori (MZL) for his constant interest and support for our project and to Marion Podolak (MZL) for her dedicated technical assistance. Finally we are thankful to Helen James (Albany Museum, Grahamstown, South Africa) for corrections and improvements of the English language and to the anonymous reviewers of our manuscript for their very valuable comments.

References

  • Agnew JD (1961) New Baetidae (Ephem.) from South Africa. Novos Taxa Entomologicos 26: 1–9.
  • Ball SL, Hebert PDN, Burian SK, Webb JM (2005) Biological identifications of mayflies (Ephemeroptera) using DNA barcodes. Journal of the North American Benthological Society 24: 508–524. https://doi.org/10.1899/04-142.1
  • Chakrabarty P, Warren M, Page LM, Baldwin CC (2013) GenSeq: An updated nomenclature and ranking for genetic sequences from type and non-type sources. ZooKeys 346: 29–41. http://doi.org/10.3897/zookeys.346.5753
  • Dallwitz MJ, Paine TA, Zurcher EJ (1999 onwards) User’s guide to the DELTA Editor. http://www.delta-intkey.com [Version: 16 November 2016]
  • Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from divers metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299. http://www.mbari.org/staff/vrijen/PDFS/Folmer_94MMBB.pdf
  • Fujitani T (2008) The family Baetidae from Japan. In: Hauer FR, Stanford JA, Newell RL (Eds) International Advances in the Ecology, Zoogeography and Systematics of Mayflies and Stoneflies.University of California Press, Berkeley, 205–218. https://doi.org/10.1525/california/9780520098688.003.0015
  • Fujitani T, Hirowatari T, Tanida K (2003) Genera and species of Baetidae in Japan: Nigrobaetis, Alainites, Labiobaetis, and Tenuibaetis n. stat. (Ephemeroptera). Limnology 4: 121–129. https://doi.org/10.1007/s10201-003-0105-2
  • Gattolliat J-L (2001) Six new species of Labiobaetis Novikova & Kluge (Ephemeroptera: Baetidae) from Madagascar with comments on the validity of the genus. Annales de Limnologie 37: 97–123. https://doi.org/10.1051/limn/2001013
  • Gattolliat J-L, Kondratieff BC, Kaltenbach T, Al Dhafer HM (2018) Labiobaetis from the Kingdom of Saudi Arabia (Insecta: Ephemeroptera: Baetidae). ZooKeys 774: 77–104. https://doi.org/10.3897/zookeys.774.25273
  • Gattolliat J-L, Monaghan MT, Sartori M, Elouard JM, Barber-James H, Derleth P, Glaizot O, de Moor F, Vogler AP (2008) A molecular analysis of the Afrotropical Baetidae. In: Hauer FR, Stanford JA, Newell RL (Eds) International Advances in the Ecology, Zoogeography and Systematics of Mayflies and Stoneflies.University of California Press, Berkeley, 219–232. https://doi.org/10.1525/california/9780520098688.003.0016
  • Gattolliat J-L, Staniczek A (2011) New larvae of Baetidae (Insecta: Ephemeroptera) from Espiritu Santo, Vanuatu. Stuttgarter Beiträge zur Naturkunde A, Neue Serie 4: 75–82.
  • Gattolliat J-L, Vinçon G, Wyler S, Pawlowski J, Sartori M (2016) Toward a comprehensive COI DNA barcode library for Swiss Stoneflies (Insecta: Plecoptera) with special emphasis on the genus Leuctra. Zoosymposia 11: 135–155. http://dx.doi.org/10.11646/zoosymposia.11.1.15
  • Gill BA, Sandberg JB, Kondratieff BC (2015) Evaluation of the morphological species concepts of 16 western Nearctic Isoperla species (Plecoptera: Perlodidae) and their respective species groups using DNA barcoding. Illiesia 11: 130–146. http://illiesia.speciesfile.org/papers/Illiesia11-11.pdf
  • Hebert PDN, Cywinska A, Ball SL, DeWaard JR (2003) Biological identifications through DNA barcodes. Proceedings of The Royal Society B-Biological Sciences 270: 313–321. https://doi.org/10.1098/rspb.2002.2218
  • Hubbard MD (1995) Towards a standard methodology for the description of mayflies (Ephemeroptera). In: Corkum LD, Ciborowski JJH (Eds) Current directions in research on Ephemeroptera.Canadian Scholar’s Press, Toronto, 361–369.
  • Kang S-C, Chang H-C, Yang C-T (1994) A revision of the genus Baetis in Taiwan. Journal of Taiwan Museum 47: 9–44.
  • Kimura M (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16: 111–120. https://doi.org/10.1007/BF01731581
  • Kluge NJ (2012) Non-African representatives of the plesiomorphion Protopatellata (Ephemeroptera: Baetidae). Russian Entomological Journal 20: 361–376.
  • Kluge NJ, Novikova EA (2011) Systematics of the mayfly taxon Acentrella (Ephemeroptera, Baetidae), with description of new Asian and African species. Russian Entomological Journal 20: 1–56.
  • Kluge NJ, Novikova EA (2014) Systematics of Indobaetis Müller-Liebenau & Morihara, 1982, and related implications for some other Baetidae genera (Ephemeroptera). Zootaxa 3835: 209–236. http://dx.doi.org/10.11646/zootaxa.3835.2.3
  • Kluge NJ, Novikova EA (2016) New tribe Labiobaetini tribus n., redefinition of Pseudopannota Waltz & McCafferty 1987 and descriptions of new and little known species from Zambia and Uganda. Zootaxa 4169: 1–43. https://doi.org/10.11646/zootaxa.4169.1.1
  • Kubendran T, Balasubramanian C, Selvakumar C, Gattolliat J-L, Sivaramakrishnan KG (2015) Contribution to the knowledge of Tenuibaetis Kang & Yang, 1994, Nigrobaetis Novikova & Kluge, 1987 and Labiobaetis Novikova & Kluge (Ephemeroptera: Baetidae) from the Western Ghats (India). Zootaxa 3957: 188–200. https://doi.org/10.11646/zootaxa.3957.2.3
  • Kubendran T, Rathinakumar T, Balasubramanian C, Selvakumar C, Sivaramakrishnan KG (2014) A new species of Labiobaetis Novikova & Kluge, 1987 (Ephemeroptera: Baetidae) from the southern Western Ghats in India, with comments on the taxonomic status of Labiobaetis. Journal of Insect Science 14: 1–10. http://www.insectscience.org/14.86
  • Kumar S, Stecher G, Tamura K (2016) MEGA 7: molecular evolutionary genetics analysis version 7.0 for bigger data sets. Molecular Biology and Evolution 33: 1870–1874. https://doi.org/10.1093/molbev/msw054
  • Lugo-Ortiz CR, McCafferty WP (1997) Labiobaetis Novikova & Kluge (Ephemeroptera: Baetidae) from the Afrotropical Region. African Entomology 5: 241–260.
  • Lugo-Ortiz CR, McCafferty WP, Waltz RD (1999) Definition and reorganization of the genus Pseudocloeon (Ephemeroptera: Baetidae) with new species descriptions and combinations. Transactions of the American Entomological Society 125: 1–37.
  • McCafferty WP, Lenat DR, Jacobus LM, Meyer MD (2010) The mayflies (Ephemeroptera) of the southeastern United States. Transactions of the American Entomological Society 136: 221–233. https://doi.org/10.3157/061.136.0303
  • McCafferty WP, Waltz RD (1995) Labiobaetis (Ephemeroptera: Baetidae): new status, new North American species, and related new genus. Entomological News 106: 19–28.
  • Monaghan MT, Gattolliat JL, Sartori M, Elouard JM, James H, Derleth P, Glaizot O, de Moor F, Vogler AP (2005) Trans-oceanic and endemic origins of the small minnow mayflies (Ephemeroptera, Baetidae) of Madagascar. Proceedings of The Royal Society B-Biological Sciences 272: 1829–1836. https://doi.org/10.1098/rspb.2005.3139
  • Morihara DK, McCafferty WP (1979a) The Baetis larvae of North America (Ephemeroptera: Baetidae). Transactions of the American Entomological Society 105: 139–221.
  • Morihara DK, McCafferty WP (1979b) Systematics of the propinquus group of Baetis species (Ephemeroptera: Baetidae). Annals of the Entomological Society of America 72: 130–135. https://doi.org/10.1093/aesa/72.1.130
  • Müller-Liebenau I (1969) Revision der europäischen Arten der Gattung Baetis Leach, 1815. (Insecta, Ephemeroptera). Gewässer und Abwässer 49: 1–214.
  • Müller-Liebenau I (1982) New species of the family Baetidae from the Philippines (Insecta, Ephemeroptera). Archiv für Hydrobiologie 94: 70–82.
  • Müller-Liebenau I (1984a) New genera and species of the family Baetidae from West-Malaysia (River Gombak) (Insecta: Ephemeroptera). Spixiana 7: 253–284.
  • Müller-Liebenau I (1984b) Baetidae from Sabah (East Malaysia) (Ephemeroptera). In: Landa V, Soldán T, Tonner M (Eds) Proceedings of the Fourth International Conference on Ephemeroptera, Czechoslovak Academy of Sciences, Budejovice, 85–89.
  • Müller-Liebenau I, Hubbard MD (1985) Baetidae from Sri Lanka with some general remarks on the Baetidae of the Oriental Region (Insecta: Ephemeroptera). Florida Entomologist 68: 537–561. https://doi.org/10.2307/3494855
  • Müller-Liebenau I, Morihara DK (1982) Indobaetis: a new genus of Baetidae from Sri Lanka (Insecta: Ephemeroptera) with two new species. Gewässer und Abwässer 68/69: 26–34.
  • Müller-Liebenau I, Soldán T (1981) Baetis balcanicus sp. n., a new species of the genus Baetis from Bulgaria and Greece (Insecta, Ephemeroptera, Baetidae: atrebatinus group). Spixiana 4: 291–295.
  • Novikova EA, Kluge NJ (1987) Systematics of the genus Baetis (Ephemeroptera, Baetidae), with descriptions of new species from Middle Asia. Vestnik Zoologii 1987(4): 8–19 [In Russian]
  • Ogden TH, Gattolliat J-L, Sartori M, Staniczek AH, Soldan T, Whiting MF (2009) Towards a new paradigm in mayfly phylogeny (Ephemeroptera): combined analysis of morphological and molecular data. Systematic Entomology 34: 616–634. https://doi.org/10.1111/j.1365-3113.2009.00488.x
  • Ribera I, Barraclough TG, Vogler AP (2001) The effect of habitat type on speciation rates and range movements in aquatic beetles: inferences from species-level phylogenies. Molecular Ecology 10: 721–735. https://doi.org/10.1046/j.1365-294x.2001.01218.x
  • Salles FF, Angeli KB, Jacobus LM (2016) Review of Waltzophius McCafferty & Lugo-Ortiz, 1995 and Zelusia Lugo-Ortiz & McCafferty, 1998 (Ephemeroptera: Baetidae). Zoosymposia 11: 174–204. https://doi.org/10.11646/zoosymposia.11.1.19
  • Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences U.S.A.74: 5463–5467. https://doi.org/10.1073/pnas.74.12.5463
  • Sartori M, Derleth P, Gattolliat J-L (2003) New data about the mayflies (Ephemeroptera) from Borneo. In: Gaino E (Ed.) Research update on Ephemeroptera and Plecoptera.University of Perugia, Perugia, 403–406.
  • Sivaramakrishnan KG, Sridhar S, Rajarajan PA (1991) Effect of temperature on hatching of parthenogenetic eggs of Baetis geminatus Müller-Liebenau & Hubbard, 1985 from South India (Ephemeroptera: Baetidae). Opuscula zoologica fluminense 69: 1–8.
  • Toussaint EFA, Sagata K, Surbakti S, Hendrich L, Balke M (2013) Australasian sky islands act as a diversity pump facilitating peripheral speciation and complex reversal from narrow endemic to widespread ecological supertramp. Ecology and Evolution 3: 1031–1049. https://doi.org/10.1002/ece3.517
  • Toussaint EFA, Hall R, Monaghan MT, Sagata K, Ibalim S, Shaverdo HV, Vogler AP, Pons J, Balke M (2014) The towering orogeny of New Guinea as a trigger for arthropod megadiversity. Nature Communications 5: 4001–4010. https://doi.org/10.1038/ncomms5001
  • Vuataz L, Sartori M, Wagner A, Monaghan MT (2011) Toward a DNA taxonomy of Alpine Rhithrogena (Ephemeroptera: Heptagenidae) using a mixed Yule-Coalescent Analysis of mitochondrial and nuclear DNA. PLoS ONE 6: 1–11. https://doi.org/10.1371/journal.pone.0019728
  • Waltz RD, McCafferty WP (1985) Redescription and new lectotype designation for the type species of Pseudocloeon, P. kraepelini Klapálek (Ephemeroptera: Baetidae). Proceedings of the Entomological Society of Washington 87: 800–804.
  • Waltz RD, McCafferty WP (1987) Systematics of Pseudocloeon, Acentrella, Baetiella, and Liebebiella, new genus (Ephemeroptera: Baetidae). Journal of the New York Entomological Society 95: 553–568.
  • Waltz RD, McCafferty WP, Thomas A (1994) Systematics of Alainites n. gen., Diphetor, Indobaetis, Nigrobaetis n. stat., and Takobia n. stat. (Ephemeroptera, Baetidae). Bulletin de la Société d’Histoire Naturelle de Toulouse 130: 33–36.
  • Zhou X, Jacobus LM, DeWalt RE, Adamowicz SJ, Hebert PDN (2010) Ephemeroptera, Plecoptera, and Trichoptera fauna of Churchill (Manitoba, Canada): insights into biodiversity patterns from DNA barcoding. Journal of the North American Benthological Society 29: 814–837. https://doi.org/10.1899/09-121.1