Research Article |
Corresponding author: Anna L. Klass ( ania.klass29@gmail.com ) Academic editor: Fredric Govedich
© 2018 Anna L. Klass, Svetlana E. Sokolova, Alexander V. Kondakov, Yuliya V. Bespalaya, Mikhail Yu. Gofarov, Alena A. Tomilova, Ilya V. Vikhrev, Ivan N. Bolotov.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Klass AL, Sokolova SE, Kondakov AV, Bespalaya YV, Gofarov MY, Tomilova AA, Vikhrev IV, Bolotov IN (2018) An example of a possible leech-bryozoan association in freshwater. ZooKeys 794: 23-30. https://doi.org/10.3897/zookeys.794.28088
|
Associations of various invertebrate species with bryozoans and sponges are a well-known marine phenomenon but such epizooic communities are far less diverse in freshwater environments. Here an occurrence of numerous leeches Alboglossiphonia cf. papillosa (Braun, 1805), in interstitial spaces between zooids of a colony of the freshwater bryozoan species Plumatella aff. fungosa (Pallas, 1768) in Eastern Siberia is described. To the best of our knowledge, this record appears to be the first known example of a leech-bryozoan association, although such relationships deserve further research.
Bryozoa , bryozoan-associated epibionts, eastern Siberia, Glossiphoniidae , Hirudinea , Plumatellidae
Marine ecosystems share numerous examples of commensal associations of various invertebrate taxa with sedentary animals such as bryozoans and sponges (
Here we describe an occurrence of numerous leeches, Alboglossiphonia cf. papillosa (Braun, 1805) inhabiting interstitial spaces between zooids of a colony of freshwater bryozoan species Plumatella aff. fungosa (Pallas, 1768). We present the results of a molecular and morphological study of both the leech and the bryozoan species and briefly discuss possible explanations of this unusual finding. To the best of our knowledge, it represents the first documented case of a possible leech-bryozoan association.
A fragment of a willow branch with a bryozoan colony was collected by hand in a shallow coastal site of a floodplain lake in the Lena River basin, Yakutia, Eastern Siberia, Russia (Figure
Total genomic DNA was extracted from 96% ethanol-preserved tissue samples using the NucleoSpin Tissue Kit (Macherey-Nagel GmbH & Co. KG, Germany), following the manufacturer’s protocol. For molecular analyses we obtained partial sequences of the following markers: the mitochondrial cytochrome c oxidase subunit I gene (COI), the nuclear 18S ribosomal RNA (18S rRNA) and 28S ribosomal RNA (28S rRNA) genes. We amplified partial sequences of the COI and 18S rRNA genes for Alboglossiphonia cf. papillosa and partial sequences of the COI and 28S rRNA genes for Plumatella aff. fungosa using standard primers (Tables
List of sequenced specimens of Alboglossiphonia cf. papillosa and Plumatella aff. fungosa from Eastern Siberia (a floodplain lake in the Lena River basin).
Gene fragment | Primer’s name | Direction | Sequence (5'-3') | Reference |
---|---|---|---|---|
COI | LoboF1 | Forward | kbtchacaaaycayaargayathgg |
|
LoboR1 | Reverse | taaacytcwggrtgwccraaraayca | ||
18S rRNA | 1F | Forward | tacctggttgatcctgccagtag |
|
4R | Reverse | gaattaccgcggctgctgg | ||
3F | Forward | gttcgattccggagaggga | ||
18Sbi | Reverse | gagtctcgttcgttatcgga |
|
|
18Sa2.0 | Forward | atggttgcaaagctgaaac | ||
9R | Reverse | gatccttccgcaggttcacctac |
|
|
28S rRNA | D23F | Forward | gagagttcaagagtacgtg |
|
D2 | Reverse | tccgtgtttcaagacgg |
|
A bryozoan colony (size of 40×20×25 mm) from Yakutia was heavily invaded by leeches. Twenty-five leeches (Figure
The results of molecular and morphological studies reveal that the leeches belong to Alboglossiphonia cf. papillosa (Braun, 1805), while the bryozoan species was identified as Plumatella aff. fungosa (Pallas, 1768).
Leech-bryozoan association from a floodplain lake in Lena River basin, Yakutia, Eastern Siberia, Russia. A Leeches Alboglossiphonia cf. papillosa in interstitial spaces between zooids of a Plumatella aff. fungosa colony (ethanol-preserved sample). The red arrows indicate leech specimens. B Size frequency histogram of the leech sample (N = 25). C Dorsal and D Ventral view of adult leech. Photographs Svetlana E. Sokolova. Scale bars: 5 mm (A); 1 mm (C, D).
RUSSIA: Eastern Siberia, Yakutia, a floodplain lake of the Lena River near the city of Yakutsk, 62.3076° N, 129.8999° E, 25 specimens from interstitial spaces between zooids of a Plumatella aff. fungosa colony, Bolotov leg. (voucher no. RMBH: Hir13).
Current taxonomy of this leech genus is uncertain. Closely related specimens of Alboglossiphonia cf. papillosa with homologous or very similar COI gene sequence (acc. nos. KM095100 and KM095101) (uncorrected p-distance <1%) were collected from the Gusinoye Lake, Yenisei Basin, Eastern Siberia (
RUSSIA: Eastern Siberia, Yakutia, a floodplain lake of the Lena River near the city of Yakutsk, 62.3076° N, 129.8999° E, colony (size of 40×20×25 mm) on a willow branch fragment, Bolotov leg. (voucher no. RMBH: Por02).
The species phylogenetically relates to Plumatella fungosa from Estonia (acc. no. KF805632) (
To the best of our knowledge, leeches have not previously been found in association with freshwater bryozoans, although the specific bryozoan colonial structure provides microscopic spaces between zooids supporting suitable microhabitats for diverse epizooic invertebrate communities (
Although this is the first recorded instance of a leech-bryozoan association, it may represent a largely overlooked phenomenon because of the hidden lifestyle of these small leeches. For example, the Japanese mussel leech Batracobdella kasmiana (Oka, 1910), which has a hidden life style within the mantle cavity of freshwater mussels, has only recently been discovered in the Russian Far East (
This work was partly funded by grants from the Russian Ministry of Education and Science (project nos. 6.2343.2017/4.6), Federal Agency for Scientific Organizations (project nos. 0409-2016-0022 and 0409-2015-0143), Russian Foundation for Basic Research, RFBR (project nos. 16-34-60152, and 17-45-290066) and the program of Presidium Ural Branch of RAS (no. 0409-2018-0148).