The complete mitochondrial genome of Orancistrocerus aterrimus aterrimus and comparative analysis in the family Vespidae (Hymenoptera, Vespidae, Eumeninae)

Qiao-Hua Zhang; Pan Huang; Bin Chen; Ting-Jing Li

doi:10.3897/zookeys.790.25356

Abstract

To date, only one mitochondrial genome (mitogenome) in the Eumeninae has been reported in the world and this is the first report in China. The mitogenome of O. a. aterrimus is 17 972 bp long, and contains 38 genes, including 13 protein coding genes (PCGs), 23 tRNA genes, two rRNA genes, a long non-coding region (NCR), and a control region (CR). The mitogenome has 79.43% A + T content, its 13 PCGs use ATN as the initiation codon except for cox1 using TTG, and nine genes used complete translation termination TAA and four genes have incomplete stop codon T (cox2, cox3, nad4, and cytb). Twenty-two of 23 tRNAs can form the typical cloverleaf secondary structure except for trnS1. The CR is 1 078 bp long with 84.69% A+T content, comprising 28 bp tandem repeat sequences and 13 bp T-strech. There are two gene rearrangements which are an extra trnM2 located between trnQ and nad2 and the trnL2 in the upstream of nad1. Within all rearrangements of these mitogenomes reported in the family Vespidae, the translocation between trnS1 and trnE genes only appears in Vespinae, and the translocation of trnY in Polistinae and Vespinae. The absent codons of 13 PCGs in Polistinae are more than those both in Vespinae and Eumeninae in the family Vespidae. The study reports the complete mitogenome of O. a. aterrimus, compares the characteristics and construct phylogenetic relationships of the mitogenomes in the family Vespidae.

Keywords

Eumeninae , mitochondrial genomes, Orancistrocerus aterrimus aterrimus , phylogenetic analysis, Vespidae

Introduction

Animal mitochondrial genomes (mitogenomes) have been widely used in studies of molecular evolution, population genetic structure, and phylogeny because of their stable gene content, rapid evolutionary rate, relatively conserved gene arrangement, maternal inheritance, and infrequent recombination (Wolstenholme 1992; Saccone et al. 1999; Oliveira et al. 2008; Li et al. 2017). The family Vespidae has more than 5000 known species worldwide, which are divided into six subfamilies, Euparagiinae, Masarinae, Eumeninae, Stenogastrinae, Polistinae, and Vespinae (Carpenter 1993), but their phylogenetics have not been settled. There have been ten mitogenomes sequences reported in the Vespidae (seven in the subfamily Vespinae, three in Polistinae, and one in Eumeninae) (Table 1). Among these six subfamilies, there are more than 3600 species in the subfamily Eumeninae worldwide, more than half of the known species of Vespidae. The species in Eumeninae, also known as potter wasps, are solitary, and mostly catch caterpillars as food for their next generation in the environment of farmlands, forests, and orchards, which can directly control caterpillar pests. To date, there is only one species (Abispa ephippium) with its mitogenome published (Cameron et al. 2008). Orancistrocerus aterrimus aterrimus, the species under study in this work, belongs to the Eumeninae, and is widely distributed in China (Jiangsu, Anhui, Fujian, Jiangxi, Hunan, Guangxi, Chongqing, Sichuan, Yunnan provinces), and Laos, Vietnam (Li 1985; Selis 2018).

In the present study, the complete mitogenome of O. a. aterrimus was sequenced using Illumina sequencing technique, and its characteristics analyzed, including gene rearrangements, nucleotide composition, codon usage, etc. More importantly, the phylogenetic relationships of 12 species of mitogenomes in Vespidae are constructed and discussed based on nucleotide sequences of 13 PCGs using both Maximum Likelihood (ML) and Bayesian Inference (BI) methods. The study updates phylogenetic research based on the mitogenomes, and provides basic information framework of mitogenomes in Vespidae for further research on the phylogenetic relationships of both genera and subfamilies in this family.

Table 1.

Download as

CSV

XLSX

The information of Vespidae mitogenomes used in the phylogenetic analysis in the present study.

Subfamily	Species	Migenome size (bp)	Gene number	GenBank Accession	Reference
Ingroup (Vespidae)
Eumeninae	Orancistrocerus aterrimus aterrimus	17972	38	KY941926	This study
Eumeninae	Abispa ephippium	16953	41	EU302588	Cameron et al. (2008)
Polistinae	Polistes jokahamae	16616	34	KR052468	Song et al. (2016)
Polistinae	Polistes humilis synoecus	14741	34	EU024653	Cameron et al. (2008)
Polistinae	Parapolybia crocea	16619	37	KY679828	Peng et al. (2017)
Vespinae	Vespula germanica	16342	33	KR703583	Zhou et al. (2016)
Vespinae	Vespa ducalis	15779	37	KX950825	Kim et al. (2017a)
Vespinae	Vespa mandarinia	15902	37	KR059904	Chen et al. (2015)
Vespinae	Vespa bicolor	16937	35	KJ735511	Wei et al. (2014)
Vespinae	Vespa velutina nigrithorax	16475	37	KY091645	Kim et al. (2017b)
Vespinae	Vespa orientalis	16101	37	KY563657	Nizar et al (2017)
Vespinae	Dolichovespula panda	17137	37	KY293679	Fan et al (2017)
Outgroup (Formicidae)
Formicinae	Formica selysi	16752	37	KP670862	Yang et al. (2015)

Materials and methods

Sample collection and DNA preparation

The specimens of O. a. aterrimus were collected from Yangshuo county of Guangxi province, preserved in the 100% ethanol, and stored at -20 °C. Total DNA of a single adult specimen was extracted from the muscle tissues using the DNeasy DNA Extraction Kit (QIAGEN) in accordance with the manufacturer’s instructions. The concentration of genomic DNA in extraction product was assayed on a Qubit fluorometer using a dsDNA High-sensitivity Kit (Invitrogen).

Mitogenomes sequencing and assembling

The Illumina TruSeq library was constructed from the gDNA with the average length of the inserted fragment of 480 bp. The library was sequenced on a full run of Illumina Hiseq 2500 with 500 cycles and paired-end sequencing (250 bp reads). High-quality reads were used in de novo assembly with IDBA-UD after removing adapters, unpaired, short and low quality reads (Peng et al. 2012). With IDBA-UD, these parameters have a similarity threshold of 98% and minimum and maximum k values of 80 and 240 bp, respectively. To identify the mitogenome assemblies from the pooled sequencing files, two different fragments of mtDNA (cox1 and rrnS) were amplified as bait sequences by standard PCR reactions using primers designed with reference of Simon et al. (2006). Using BLASTN search against the reference of bait sequences, matching rate of 100% was confirmed as the mitogenome of O. a. aterrimus. The identical or near-identical overlapping terminal regions of mitogenome sequences were examined and circularized by Geneious (http://www.geneious.com/).

Sequence annotations and analysis

PCGs and rRNA genes were aligned with other published Vespidae insect mitogenomes by Clustal X (Thompson et al. 1997). The majority of the tRNA gene locations and secondary structures were identified by tRNAscan-SE Search Server v.1.21 (Lowe and Eddy 1997), and the remaining tRNA were identified in comparison with other known species of tRNAs in Vespidae (Cameron et al. 2008; Song et al. 2016). The CRand the tandem repeat sequence were analyzed with Tandem Repeats Finder (http://tandem.bu.edu/trf/trf.html) (Benson 1999). Base composition and codon usage in all 12 mitogenomes of Vespidae were calculated by MEGA v 6. 0 (Tamura et al. 2013). In addition, the AT skew = [A - T] / [A + T] and GC skew = [G - C] / [G + C] were computed (Perna and Kocher 1995).

Phylogenetic analysis

Eleven known mitogenome sequences in the family Vespidae and the mitogenome sequence of Formica selysi (KP670862) in the family Formicidae were downloaded from GeneBank, and that of O. a. aterrimus was produced in the present study (Table 1). The phylogenetic tree of 12 mitogenomes sequences in the family Vespidae was constructed using ML and BI methods with MEGA 6.0 (Tamura et al. 2013) and MrBayes 3.1.1 (Huelsenbeck and Ronquist 2001), and the Formica selysi (KP670862) was used as outgroup. The nucleotide sequences of 13 PCGs were applied in the phylogenetic inference, and the best fitting substitution model was detected using Mrmodeltest 2.3 (Nylander 2004). The bootstrap values were calculated based on 1000 replications, and the confidence values of the topology is high.

Results and discussion

Genomic organization

The complete mitogenome of O. a. aterrimus is a double-strand of circular molecular DNA and 17,972 bp. It contains 38 genes: 13 PCGs, 23 tRNAs, two rRNAs, a control region (CR), and a long non-coding region (NCR) (Figure 1), of which 24 genes are situated in the majority strand (J-strand) and the other 14 genes are located in the minority strand (N-strand) (Table 2). An extra trnM2 and a long NCR were found in the mitogenome. The gene trnM2 is 67 bp and located in 2 142-2 208 between trnQ and nad2. The NCR is 1 946 bp long, located in 128-2 073 between trnM1 and trnQ. With the exception of the NCR (1 946 bp), 14 intergenic spacers exist and sum to 174 bp, of which the longest spacer is 48 bp long, located between nad4l and trnT. In addition, a total of 24 bp overlaps was identified in 12 genes, with the overlap length of each gene ranging from 1 to 8 bp.

Figure 1.

The mitochondrial genome of O. a. aterrimus. Arrows indicate the direction of genes. Abbreviations of the gene name are as follows: nad1-4 and nad4L act as nicotinamide adenine dinucleotide hydrogen dehydrogenase subunits 1-6 and 4L; cox1, cox2, and cox3 act as the cytochrome C oxidase subunits; cytb act as cytochrome b; atp8 and atp6 act as adenosine triphosphate synthase subunits 6 and 8; rrnL and rrnS act as large and small rRNA subunits; In addition, CR indicates control region and NCR indicates non-coding region.

Table 2.

Download as

CSV

XLSX

Mitochondrial genome annotation of O. a. aterrimus.

Gene	Direction	Location	Size (bp)	Anticodon	Codon		Intergenic nucleotides
Gene	Direction	Location	Size (bp)	Anticodon	Start	Stop	Intergenic nucleotides
trnI	F	1–63	63	30–32 GAT
trnM1	F	63–127	65	93–95 CAT			-1
non-coding region							1946
trnQ	R	2074–2138	65	2108–2110 TTG			0
trnM2	F	2142–2208	67	2173–2175 CAT			3
nad2	F	2209–3234	1026		ATC	TAA	0
trnW	F	3249–3315	67	3280–3282 TCA			14
trnC	R	3308–3374	67	3342–3344 GCA			-8
trnY	R	3383–3447	65	3416–3418 GTA			8
cox1	F	3446–4981	1536		TTG	TAA	-2
trn L1	F	5006–5073	68	5035–5037 TAA			24
cox2	F	5074–5752	679		ATC	T-	0
trnK	F	5753–5824	72	5785–5787 CTT			0
trnD	F	5824–5893	70	5858–5860 GTC			-1
atp8	F	5894–6049	156		ATC	TAA	0
atp6	F	6049–6720	672		ATG	TAA	-1
cox3	F	6742–7525	784		ATG	T-	21
trnG	F	7526–7593	68	7556–7558 TCC			0
nad3	F	7594–7947	354		ATT	TAA	0
trnA	F	7947–8011	65	7977–7979 TGC			-1
trnR	F	8011–8074	64	8038–8040 TCG			-1
trnN	F	8078–8147	70	8108–8110 GTT			3
trn S1	F	8147–8206	60	8168–8170TCT			-1
trnE	F	8214–8277	64	8244–8246 TTC			7
trnF	R	8277–8342	66	8307–8309 GAA			-1
nad5	R	8344–10032	1689		ATT	TAA	1
trnH	R	10033–10096	64	10065–10067 GTG			0
nad4	R	10097–11402	1306		ATA	T-	0
nad4l	R	11399–11677	279		ATT	TAA	-4
trnT	F	11726–11789	64	11756–11758 TGT			48
trnP	R	11789–11858	70	11823–11825 TGG			-1
nad6	F	11860–12399	540		ATG	TAA	1
cytb	F	12403–13534	1132		ATG	T-	3
trnS2	F	13544–13612	69	13572–13574 TGA			9
trnL2	R	13640–13707	68	13676–13678 TAG			27
nad1	R	13708–14676	969		ATA	TAA	0
rrnL	R	14682–16044	1363				5
trnV	R	16043–16106	64	16074–16076 TAC			-2
rrnS	R	16107–16894	788				0
Control region		16895–17972	1078				0

Gene rearrangements

The gene order of 13 PCGs and two rRNAs in O. a. aterrimus mitogenome is consistent with the putative hymenopteran ancestor: the sawfly Perga condei (Hymenoptera: Symphyta: Pergidae:) (Castro and Dowton 2005). However, there are two rearrangements of tRNAs in the mitogenome (Figure 2), namely, an extra trnM2 and trnL2 in the upstream of nad1, contributing to the novel gene order: trnL2 - nad1 - rrnL - trnV - rrnS - CR - trnI - trnM1 - trnQ - trnM2 - nad2 (Figure 2). In the mitogenome of Abispa ephippium, another species in the subfamily Eumeninae, the gene order of rearrangements is trnL2 - trnM1 - trnQ - trnM2 - trnI, trnL1 - trnL1 - trnL1 - trnL1 and trnS2 - nad1 (Figure 2) (Cameron et al. 2008). In the subfamily Polistinae, the translocation between nad1 and trnL1 is present in three reported species. In addition, the translocation of trnY in Parapolybia crocea occurs, trnQ, trnM and trnY genes are lost in Polistes humilis mitogenome, and in Polistes jokahamae mitogenome, not only trnD is in the upstream of trnK but also trnI, trnQ and trnY are missing (Figure 2) (Cameron et al. 2008; Song et al. 2016; Peng et al. 2017). In the subfamily Vespinae, except for the incomplete mitogenomes of Vespula germanica and Vespa bicolor, there is the same rearrangements in other four reported species, such as the translocation of trnY, the translocation between trnQ and trnM genes, between trnS1 and trnE genes, and between nad1 and trnL2^(CUN) genes, respectively and Dolichovespula panda is different from other four species: the translocation between trnS1 and trnE genes in exchange for shuffling of trnN and trnE (Figure 2) (Chen et al. 2016; Fan et al. 2017; Kim et al. 2017a; Kim et al. 2017b; Nizar et al. 2017). In general, the rearrangement frequency in Eumeninae is lower than those of both Vespinae and Polistinae. The rearrangement of tRNAs is a typical event in the mitogenomes of Hymenoptera (Dowton and Austin 1999; Dowton et al. 2009; Chen et al. 2016).

Figure 2.

Mitochondrial gene arrangement of 12 species of Vespidae. The red fonts indicate the rearrangement of the genes.

Nucleotide composition

To date, the nucleotide compositions of ten complete mitogenomes have been reported in the family Vespidae. In the subfamily Eumeninae, the overall A + T content of O. a. aterrimus and Abispa ephippium mitogenomes is 79.43% and 80.61%, respectively (Table 3). Among all Vespidae mitogenomes, there are no significant differences of the A + T content of Polistinae, i.e., P. humilis being 84.73%, P. jokahamae 83.41%, and Parapolybia crocea 82.94%, respectively. In the subfamily Vespinae, there are a little differences of the A + T content from Vespa mandarinia 79.39% to Dolichovespula panda being 84.61%. Generally speaking, the A + T content of Eumeninae is lower than those of both Vespinae and Polistinae. According to these different regions of O. a. aterrimus mitogenome, the A + T content of 13 PCGs is 78.27% near to A. ephippium (78.67%). In tRNAs, rRNAs, and CR, the A + T content is 83.41%, 84.29% and 84.69%, respectively. From the A + T content of all known Vespidae complete mitogenomes (Table 3), a universal feature is presumed that A + T content of tRNAs and rRNAs higher than that of PCGs.

Table 3.

Download as

CSV

XLSX

Nucleotide composition of different regions in all complete Vespidae mitogenomes.

Species	Regions	Size(bp)	A%	T%	G%	C%	(A+T)%	AT-skew	GC-skew
Orancistrocerus aterrimus aterrimus	Whole genome	17972	39.53	39.9	8.06	12.51	79.43	-0.005	-0.216
	Protein coding genes	11122	33.15	45.12	10.02	11.72	78.27	-0.153	-0.078
	tRNA genes	1525	42.69	40.72	9.25	7.34	83.41	0.024	0.115
	rRNA genes	2151	41.89	42.4	10.79	4.93	84.29	-0.006	0.373
	Control region	1078	39.8	44.9	6.49	8.81	84.69	-0.06	-0.152
Abispa ephippium	Whole genome	16953	39.55	41.05	6.02	13.38	80.61	-0.019	-0.38
	Protein coding genes	11305	35.2	43.48	10.12	11.21	78.67	-0.105	-0.051
	tRNA genes	1787	44.66	38.84	8.95	7.55	83.49	0.07	0.085
	rRNA genes	2180	43.62	38.35	5.14	12.89	81.97	0.064	0.43
	Control region	308	43.83	46.1	1.3	8.77	89.94	-0.025	-0.742
Polistes jokahamae	Whole genome	16616	41.97	41.45	5.8	10.79	83.41	0.006	-0.301
	Protein coding genes	10852	36.77	46.61	8.11	8.51	83.38	-0.118	-0.024
	tRNA genes	1318	44.76	42.64	6.98	5.61	87.4	0.024	0.108
	rRNA genes	2257	43.95	41.25	4.3	10.5	85.2	0.032	0.419
	Control region	1096	39.05	46.53	6.84	7.57	85.58	-0.087	-0.051
Polistes humilis	Whole genome	14741	43.09	41.65	5.32	9.95	84.73	0.017	-0.303
	Protein coding genes	10852	36.77	46.61	8.11	8.51	83.38	-0.118	-0.024
	tRNA genes	1258	47.22	41.02	6.52	5.25	88.24	0.07	0.108
	rRNA genes	1932	43.27	43.22	9.16	4.35	86.49	0.001	0.356
	Control region	*	*	*	*	*	*	*	*
Parapolybia crocea	Whole genome	16619	43.39	39.55	5.91	11.15	82.94	0.046	-0.307
	Protein coding genes	11022	35.48	45.16	9.54	9.82	80.65	-0.12	-0.015
	tRNA genes	1486	44.01	42.13	7.67	6.19	86.14	0.022	0.107
	rRNA genes	2176	40.3	45.96	9.38	4.37	86.26	-0.066	0.365
	Control region	1316	42.25	46.05	5.17	6.53	88.3	-0.043	-0.117
Vespa ducalis	Whole genome	15779	40.32	39.8	5.8	14.08	80.12	0.006	-0.417
	Protein coding genes	11159	34.32	43.46	10.36	11.86	77.78	-0.118	-0.067
	tRNA genes	1487	45.46	40.15	8.14	6.25	85.61	0.062	0.131
	rRNA genes	2299	44.58	39.58	11.44	4.39	84.17	0.059	0.445
	Control region	166	46.99	45.78	0	7.23	92.77	0.013	-1
Vespa mandarinia	Whole genome	15902	38.88	40.51	6.07	14.53	79.39	-0.021	-0.41
	Protein coding genes	11119	33.73	43.37	10.56	12.35	77.09	-0.125	-0.078
	tRNA genes	1505	45.12	40.47	8.37	6.05	85.58	0.054	0.161
	rRNA genes	1569	43.91	39.64	12.11	4.33	83.56	0.051	0.473
	Control region	200	49	39.5	0.5	11	88.5	0.107	-0.913
Vespa velutina nigrithorax	Whole genome	16475	40.3	41.44	5.43	12.83	81.74	-0.014	-0.406
	Protein coding genes	11197	34.99	44.75	9.42	10.83	79.74	-0.122	-0.07
	tRNA genes	1514	44.58	41.35	8.12	5.94	85.93	0.038	0.155
	rRNA genes	2319	45.11	40.06	10.52	4.31	85.17	0.059	0.419
	Control region	132	50.76	41.67	0	7.58	92.42	0.098	-1
Vespa orientalis	Whole genome	16101	40.65	40.3	5.86	13.19	80.95	0.004	-0.384
	Protein coding genes	10653	34.5	44.08	9.74	11.68	78.58	-0.122	-0.09
	tRNA genes	1481	45.51	40.51	7.97	6.01	86.02	0.058	0.14
	rRNA genes	2079	43.67	39.15	11.5	5.68	82.83	0.055	0.339
	Control region	60	48.33	41.67	8.33	1.67	90	0.074	0.667
Dolichovespula panda	Whole genome	17136	42.8	41.81	5.39	10	84.61	0.012	-0.3
	Protein coding genes	11276	35.82	46.78	8.78	8.62	82.6	-0.133	0.009
	tRNA genes	1506	45.88	40.44	7.9	5.78	86.32	0.063	0.155
	rRNA genes	2126	43.7	40.87	10.68	4.75	84.57	0.033	0.384
	Control region	586	67.24	32.42	0	0.34	99.66	0.349	-1

Two other parameters, AT-skew and GC-skew, have been widely used to measure the nucleotide compositional behaviors of mitogenome in addition to the A + T content (Enrico et al. 2011). The AT skew of O. a. aterrimus mitogenome is -0.005 near to 0, and the GC skew (-0.216) is negative. The base composition bias plays an important role in researching the mechanism of replication and transcription of mitogenomes (Wei et al. 2010).

Among the PCGs of 12 Vespidae species (containing two incomplete mitogenomes), the A + T content of cox1 is the lowest in 13 PCGs, ranging from 70.18% (Vespa mandarinia) to 75.29% (P. humilis) (Figure 3). The A + T content of atp8, nad2, and nad4L is highest (Figure 3). This result ascertains cox1 is conserved relatively again, which is the reason for former abundant phylogenetic analysis in other insects (Rivera and Currie 2009; Santos et al. 2015). In addition, it is a common phenomenon that T content is more than A, and C content is slightly more than G (Figure 3).

Figure 3.

Nucleotide composition of all 13 PCGs of eleven species of Vespidae.

Protein coding genes

In the 13 PCGs of the O. a. aterrimus mitogenome, nine PCGs are encoded in the J-strand, and the other four PCGs are located in the N-strand. The total length of PCGs is 11 122 bp. All PCGs use the conventional start codons ATN except for cox1 using TTG which was also employed as the initiation codon in other insects (Sheffield et al. 2008; Li et al. 2012a). The termination codons of nine PCGs in O. a. aterrimus mitogenome use complete TAA (nad2, cox1, atp8, atp6, nad3, nad5, nad4l, nad6 and nad1), and other four genes have incomplete stop codons T (cox2, cox3, nad4 and cytb). In general, the termination codons of insect mitogenomes PCGs were the TAA or incomplete T (Ojala et al. 1981; Li et al. 2012a).

There is a total of 3697 codons in O. a. aterrimus mitogenome, excluding termination codons, which is within the range of the common insect mitogenomes codon number (3585-3746) (Cha et al. 2007). According to the relative synonymous codon usage (RSCU), all of these 12 Vespidae species frequently used UUU, UUA, AUU and AUA (Figure 4), leading to the high A + T content in the PCGs of the family Vespidae mitogenomes. CUG is absent in O. a. aterrimus mitogenome and CGC and AGC are absent in A. ephippium. Some codons are also lacking in other species of Vespidae. For example, CGC and AGC in Vespa orientalis, CUG, GCG, CGC in V. bicolor and CCG, ACC, ACG, GCG, UGC, and CGC in Dolichovespula panda are absent, respectively. There are several codons missing in Polistes jokahamae, namely, CUG, GUC, ACG, GCG, CGC, CGG, AGC; and CUG, GUC, GCG, CGC, and GGC are also lacked in P. humilis (Figure 4). Thus, the amount of absent codons in Vespinae and Polistinae is more than in Eumeninae.

Figure 4.

Relative synonymous codon usage (RSCU) in Vespidae. Codon families are displayed along the x-axis.

Transfer RNA and ribosomal RNA genes

There are 23 tRNAs found in O. a. aterrimus mitogenome and their lengths range from 60 bp (trnS1) to 72 bp (trnK) including an extra trnM2, whereas usually there are 22 tRNAs in other insects (Boore 1999; Chen et al. 2015). Among 23 anticodons of these tRNAs, 21 are coincident with the majority of insects mitogenomes (Lee et al. 2008; Hua et al. 2016), but trnI and trnS1 change from CCT to GAT, and GCT to TCT, respectively. Except for trnS1, the other 22 tRNAs have the capability of folding into typical clover-leaf secondary structures. The secondary structure of trnS1 lacks the dihydrouridine DHU arm and reduces its shape to a simple loop (Figure 5), which is a common phenomenon in metazoan mitogenomes (Wolstenholme 1992; Li et al. 2012b). There are 20 mismatches in 13 tRNAs, including 18 unmatched GU base pairs, an unmatched AG, and an unmatched UU (Figure 5).

Figure 5.

Secondary structures of 23 tRNAs of O. a. aterrimus mitochondrial genome. Watson-Crick bonds are showed by dashes, GU pairs by filled dots, and AG and UU by open dots.

The length of rrnL is 1 363 bp long, located between nad1 and trnV, and rrnS 788 bp long in minority strand between trnV and CR. The A + T content of two genes is 84.29% (rrnL and rrnS) (Table 3).

A control region and a non-coding region

The CR plays an important role in regulating of replication and transcription of mitogenomes (Taanman 1999; Saito et al. 2005). The CR of O. a. aterrimus mitogenome is 1078 bp long, located between rrnS and trnI. The A + T content of this region (84.69%) is higher than other region of the O. a. aterrimus mitogenome. There is a tandem repeat model of 28 bp (TATTCCATTTAAGTTCGTAAAAACTAAT) which occurs more than eight times in the O. a. aterrimus mitogenome. Tandem repeat structures in the CR are different in different species (Peng et al. 2017). There is also a poly-T stretch of 13 bp, which may be as recognition site for the initiation of replication in the mitogenomes (Andrews et al. 1999). In the O. a. aterrimus mitogenome, a NCR is situated in position 128 - 2 073 (1 946 bp) between trnM1 and trnQ, which is reported in most insect mitogenomes (Saito et al. 2005; Cameron et al. 2008; Jiang et al. 2016). The A + T content of NCR is 73.69%, among which there is 97 bp (close to trnQ gene) with obviously high A + T content 90.72%. In addition, two tandem repetitive sequences are found in the NCR, which repeated 17 and 18 times, respectively.

Phylogenetic relationships

The best fitting model GTR + G + I was selected for ML analysis. The phylogeny of mitogenomes in Vespidae was constructed based on the nucleotide sequences of 13 PCGs of 13 species using ML and BI methods (Figure 6). The phylogenetic relationships between 12 species in the family Vespidae are (((((Vespa bicolor + Vespa velutina nigrithorax) + Vespa orientalis) + (Vespa mandarinia + Vespa ducalis)) + Vespula germanica+ Dolichovespula panda) + (Parapolybia crocea+ (Polistes humilis synoecus + Polistes jokahamae))) + (Orancistrocerus aterrimus aterrimus + Abispa ephippium) (Figure 6). O. a. aterrimus and A. ephippium belong to the subfamily Eumeninae, which is concordant with morphological classification. In the present study, Eumeninae is the sister group with (Polistinae + Vespinae), which is different from morphological classification “(Eumeninae + (Stenogastriinae + (Vespinae + Polistinae))) ” (Carpenter 1982, 2003). So far, there is no reported mitogenome in the subfamily Stenogastriinae, so the relationships among the four subfamilies Eumeninae, Stenogastriinae, Vespinae and Polistinae based on mitogenomes need to be further explored in our follow-up studies.

Figure 6.

The phylogenetic relationships were established by the 13 PCGs using ML (A) and BI (B) methods. Numbers abutting branches were bootstrap percentages with 1000 replicates (A) and Bayesian posterior probabilities (B). Red pentagram refers to the mitogenome sequences of O. a. aterrimus.

Conclusions

According to nine complete mitogenomes reported in the family Vespidae, gene numbers of two species (38 and 41 genes) of the subfamily Eumeninae are more than those of the other seven species (34 - 37 genes) of both Polistinae and Vespinae. The rearrangements of tRNAs are common in Vespidae, but rearrangement rules are different in different subfamilies. The translocation between trnS1 and trnE only happens in the subfamily Vespinae, and there are the same rearrangements in these four complete mitogenomes of Vespa mandarinia, V. ducalis, V. orientalis, and V. velutina nigrithorax. The translocation of trnY occurs in both Vespinae and Polistinae, whereas trnY location in Eumeninae is consistent with that of the sawfly Perga condei. The number of absent codons in Eumeninae is less than Vespinae and Polistinae. The phylogenic results of mitogenomes show that O. a. aterrimus and Abispa ephippium belong to Eumeninae and (Polistinae + Vespinae) and Eumeninae constitute a sister group. Lastly, these results of this study might suggest that Eumeninae derived earlier than both Polistinae and Vespinae, which is consistent with reported research based on morphology.

Acknowledgements

We are very grateful to James M. Carpenter and Rogério Lopes for their critical comments. This study was funded by the National Natural Science Foundation of China (Nos: 31772490, 31372247, 31000976, 31372265), Young Talent Incubation Program of Chongqing Normal University (14CSDG07), and the Par-Eu Scholars Program.

References

Andrews RM, Kubacka I, Chinnery PF, Lightowlers RN, Turnbull DM, Howell N (1999) Reanalysis and revision of Cambridge reference sequence for human mitochondrial DNA. Nature Genetics 23(2): 147. https://doi.org/10.1038/13779

Benson G (1999) Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Research 27: 573–580. https://doi.org/10.1093/nar/27.2.573

Boore JL (1999) Animal mitochondrial genomes. Nucleic Acids Research 27(8): 1767–1780. https://doi.org/10.1093/nar/27.8.1767

Cameron SL, Dowton M, Castro LR, Ruberu K, Whiting MF, Austin AD, Diement K, Stevens J (2008) Mitochondrial genome organization and phylogeny of two vespid wasps. Genome 51(10): 800–808. https://doi.org/10.1139/G08-066

Carpenter JM (1982) The phylogenetic relationships and natural classification of the Vespoidea (Hymenoptera). Systematic Entomology 7: 11–38. https://doi.org/10.1111/j.1365-3113.1982.tb00124.x

Carpenter JM (1993) Biogeographic patterns in the Vespidae (Hymenoptera): Two views of Africa and South America. Biological relationships between Africa and South America. Yale University Press, New Haven, 139–155. https://doi.org/10.2307/j.ctt22726mc.11

Carpenter JM (2003) On “Molecular phylogeny of Vespidae (Hymenoptera) and the evolution of sociality in wasps”. American Museum Novitates 3389: 1–20. https://doi.org/10.1206/0003-0082(2003)389<0001:OMPOVH>2.0.CO;2

Castro LR, Dowton M (2005) The position of the Hymenoptera within the Holometabola as inferred from the mitochondrial genome of Perga condei (Hymenoptera: Symphyta: Pergidae). Molecular Phylogenetics & Evolution 34(3): 469–479. https://doi.org/10.1016/j.ympev.2004.11.005

Cha SY, Yoon HJ, Lee EM, Yoon MH, Hwang JS, Jin BR, Han YS, Kim I (2007) The complete nucleotide sequence and gene organization of the mitochondrial genome of the bumblebee, Bombus ignitus (Hymenoptera: Apidae). Gene 392(1–2): 206–220. https://doi.org/10.1016/j.gene.2006.12.031

Chen PY, Wei SJ, Liu JX (2015) The mitochondrial genome of the Vespa mandarinia Smith (Hymenoptera: Vespidae: Vespinae) and a phylogenetic analysis of the Vespoidea. Mitochondrial DNA 27(6): 4414–4415. https://doi.org/10.3109/19401736.2015.1089550

Chen PY, Zheng BY, Liu JX, Wei SJ (2016) Next-Generation sequencing of two mitochondrial genomes, from Family Pompilidae (Hymenoptera: Vespoidea) Reveal Novel Patterns of Gene Arrangement. International Journal of Molecular Sciences 17: 1641. https://doi.org/10.3390/ijms17101641

Dowton M, Austin AD (1999) Evolutionary dynamics of a mitochondrial rearrangement “hot spot” in the Hymenoptera. Molecular Biology and Evolution 16(2): 298–309. https://doi.org/10.1093/oxfordjournals.molbev.a026111

Dowton M, Cameron SL, Dowavic JI, Austin AD, Whiting MF (2009) Characterization of 67 mitochondrial tRNA gene rearrangements in the Hymenoptera suggests that mitochondrial tRNA gene position is selectively neutral. Molecular Biology and Evolution 26: 1607–1617. https://doi.org/10.1093/molbev/msp072

Enrico N, Massimiliano B, and Tomaso P (2011) The mitochondrial genome of the ascalaphid owlfly Libelloides macaronious and comparative evolutionary mitochondriomics of neuropterid insects. BMC Genomics 12(5): 221.

Fan XL, Gong YJ, Chen PY, Tan QQ, Tan JL, Wei SJ (2017) Next-generation sequencing of the mitochondrial genome of Dolichovespula panda (Hymenoptera: Vespidae) with a phylogenetic analysis of Vespidae. Journal of Asia-Pacific Entomology 20(3): 971–976. https://doi.org/10.1016/j.aspen.2017.07.009

Hua YQ, Din YR, Yan ZT, Si FL, Luo QC, Chen B (2016) The complete mitochondrial genome of Anopheles minimus (Diptera: Culicidae) and the phylogenetics of known Anopheles mitogenomes. Insect Science 23(3): 353–365. https://doi.org/10.1111/1744-7917.12326

Huelsenbeck JP, Ronquist F (2001) MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17: 754–755. https://doi.org/10.1093/bioinformatics/17.8.754

Jiang P, Li H, Song F, Cai Y, Wang JY, Liu JP, Cai WZ (2016) Duplication and remolding of tRNA genes in the mitochondrial genome of Reduvius tenebrosus (Hemiptera: Reduviidae). International Journal of Molecular Sciences 17(6): 951. https://doi.org/10.3390/ijms17060951

Kim JS, Jeong JS, Jeong SY, Kim MJ, Kim I (2017a) Complete mitochondrial genome of the black-tailed hornet, Vespa ducalis (Hymenoptera: Vespidae): Genomic comparisons in Vespoidea. Entomological Research 47: 129–136. https://doi.org/10.1111/1748-5967.12218

Kim JS, Jeong JS, Kim I (2017b) Complete mitochondrial genome of the yellow-legged Asian hornet, Vespa velutina nigrithorax (Hymenoptera: Vespidae). Mitochondrial DNA Part B: Resources 2(1): 82–84. https://doi.org/10.1080/23802359.2017.1285211

Lee YS, Oh J, Kim YU, Kim N, Yang S, Hwang UW (2008) Mitome: dynamic and interactive database for comparative mitochondrial genomics in metazoan animals. Nucleic Acids Research 36: 938–942. https://doi.org/10.1093/nar/gkm763

Li H, Leavengood Jr JM, Chapman EG, Burkhardt D, Song F, Jiang P, Liu JP, Zhou XG, Cai WZ (2017) Mitochondrial phylogenomics of Hemiptera reveals adaptive innovations driving the diversification of true bugs. Proceedings of the Royal Society B: Biological Sciences 284: 1–10. https://doi.org/10.1098/rspb.2017.1223

Li H, Liu H, Shi AM, Štys P, Zhou XG, Cai WZ (2012a) The complete mitochondrial genome and novel gene arrangement of the unique-headed bug Stenopirates sp.. (Hemiptera: Enicocephalidae). PLoS ONE 7: e29419. https://doi.org/10.1371/journal.pone.0029419

Li H, Liu HY, Song F, Shi AM, Zhou XG, Cai WZ (2012b) Comparative mitogenomic analysis of damsel bugs representing three tribes in the family Nabidae (Insecta: Hemiptera). PLoS ONE 7: e45925. https://doi.org/10.1371/journal.pone.0045925

Li TS (1985) Economic insect faund of China, Hymenoptera: Vespoidea. Science Press, Beijing, 120–121.

Lowe TM, Eddy SR (1997) tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Research 25: 955–964.

Nizar JH, Kosai AN, Bent P, Love D, Nikolaj B, Thomas SP (2017) Complete mitochondrial genome of the Oriental hornet, Vespa orientalis F. (Hymenoptera: Vespidae). Mitochondrial DNA Part B: Resources 2(1): 139–140. https://doi.org/10.1080/23802359.2017.1292480

Nylander JAA (2004) MrModeltest v2. Program distributed by the author. Uppsala University: Evolutionary Biology Centre.

Ojala D, Montoya J, Attardi G (1981) tRNA punctuation model of RNA procession in human mitochondria. Nature 290: 470–474. https://doi.org/10.1038/290470a0

Oliveira DCSG, Rhitoban R, Lavrov DV, Werren JH (2008) Rapidly evolving mitochondrial genome and directional selection in mitochondrial genes in the parasitic wasp Nasonia (Hymenoptera: Pteromalidae). Molecular Biology and Evolution 25: 2167–2180. https://doi.org/10.1093/molbev/msn159

Peng Y, Chen B, Li TJ (2017) Complete sequence and analysis of Parapolybia crocea mitochondrial genome (Hymenoptera: Vespidae). Acta Entomologica Sinica 60(4): 464–474.

Peng Y, Leung HCM, Yiu SM, Chin FYL (2012) IBDA-UD: a de novo assembler for single-cell and metagenomic sequencing data woth highly uneven depth. Bioinformatics 28: 1420–1428. https://doi.org/10.1093/bioinformatics/bts174

Perna NT, Kocher TD (1995) Patterns of nucleotide composition at fourfold degenerate sites of animal mitochondrial genomes. Journal of Molecular Evolution 41: 353–358. https://doi.org/10.1007/BF01215182

Rivera J, Currie DC (2009) Identification of Nearctic black flies using DNA barcodes (Diptera: Simuliidae). Molecular Ecology Resources 9: 224–236. https://doi.org/10.1111/j.1755-0998.2009.02648.x

Saccone C, De Giorgi C, Gissi C, Pesole G, Reyes A (1999) Evolutionary genomics in Metazoa: the mitochondrial DNA as a model system. Gene 238: 195–209. https://doi.org/10.1016/S0378-1119(99)00270-X

Saito S, Tamura K, Aotsuka T (2005) Replication origin of mitochondrial DNA in insects. Genetics 171(4): 1695–1705. https://doi.org/10.1534/genetics.105.046243

Santos BF, Payne A, Pickett KM, Carpenter JM (2015) Phylogeny and historical biogeography of the paper wasp genus Polistes (Hymenoptera: Vespidae): implications for the overwintering hypothesis of social evolution. Cladistics 2015 31(5): 535–549. https://doi.org/10.1111/cla.12103

Selis M (2018) Additions to the knowledge of solitary wasps (Hymenoptera: Vespidae: Eumeninae), with description of eight new species. Zootaxa 4403(3): 441–468. https://doi.org/10.11646/zootaxa.4403.3.2

Sheffield NC, Song H, Cameron SL, Whiting MF (2008) A comparative analysis of mitochondrial genomes in Coleoptera (Arthropoda: Insecta) and genome descriptions of six new beetles. Molecular Biology and Evolution 25: 2499–2509. https://doi.org/10.1093/molbev/msn198

Simon C, Buckley TR, Frati F, Stewart JB, Beckenbach AT (2006) Incorporating Molecular Evolution into Phylogenetic Analysis, and a New Compilation of Conserved Polymerase Chain Reaction Primers for Animal Mitochondrial DNA. Annual Review of Ecology Evolution & Systematics 37(1–2): 545–579. https://doi.org/10.1146/annurev.ecolsys.37.091305.110018

Song SN, Chen PY, Wei SJ, Chen XX (2016) The mitochondrial genome of Polistes jokahamae and a phylogenetic analysis of the Vespoidea (Insecta: Hymenoptera). Mitochondrial DNA 27(4): 1–2.

Taanman JW (1999) The mitochondrial: structure, transcription, translation and replication. Biochimica et Biophysica Acta 1410(2): 103–123. https://doi.org/10.1016/S0005-2728(98)00161-3

Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetics analysis version 6. 0. Molecular Biology and Evolution 30(12): 2725–2729. https://doi.org/10.1093/molbev/mst197

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25: 4876–4882. https://doi.org/10.1093/nar/25.24.4876

Wei SJ, Niu FF, Tan JL (2014) The mitochondrial genome of the Vespa bicolor Fabricius (Hymenoptera: Vespidae: Vespinae). Mitochondrial DNA 27(2): 1–2.

Wei SJ, Shi M, Chen XX, Sharkey MJ, Achterberg C van, Ye GY, He JH (2010) New views on strand asymmetry in insect mitochondrial genomes. PLoS ONE 5(9): e12708. https://doi.org/10.1371/journal.pone.0012708

Wolstenholme DR (1992) Animal mitochondrial DNA: structure and evolution. International Review of Cytology 141(6): 173–216. https://doi.org/10.1016/S0074-7696(08)62066-5

Yang S, Li X, Cai LG, Qian ZQ (2015) Characterization of the complete mitochondrial genome of Formica selysi (Insecta: Hymenoptera: Formicidae: Formicinae). Mitochondrial DNA 27: 3378–3380.

Zhou Y, Hu YL, Xu ZF, Wei SJ (2016) The mitochondrial genome of the German wasp Vespula germanica (Fabricius, 1793) (Hymenoptera: Vespoidea: Vespidae). Mitochondrial DNA 27(4): 1–2.