Research Article
Print
Research Article
Systematics of South American snail-eating snakes (Serpentes, Dipsadini), with the description of five new species from Ecuador and Peru
expand article infoAlejandro Arteaga§, David Salazar-Valenzuela|, Konrad Mebert, Nicolás Peñafiel|, Gabriela Aguiar, Juan C. Sánchez-Nivicela#, R. Alexander Pyron¤«, Timothy J. Colston«¤, Diego F. Cisneros-Heredia»˄, Mario H. Yánez-Muñoz», Pablo J. Venegas˅, Juan M. Guayasamin|˄, Omar Torres-Carvajal¦
‡ Tropical Herping, Quito, Ecuador
§ American Museum of Natural History, New York, United States of America
| Universidad Tecnológica Indoamérica, Quito, Ecuador
¶ Universidade Estadual de Santa Cruz, Ilhéus, Brazil
# Museo de Zoología de la Universidad del Azuay, Cuenca, Ecuador
¤ National Museum of Natural History, Smithsonian Institution, Washington, United States of America
« The George Washington University, Washington, United States of America
» Instituto Nacional de Biodiversidad, Quito, Ecuador
˄ Universidad San Francisco de Quito, Quito, Ecuador
˅ División de Herpetología-Centro de Ornitología y Biodiversidad, Lima, Peru
¦ Pontificia Universidad Católica del Ecuador, Quito, Ecuador
Open Access

Abstract

A molecular phylogeny of the Neotropical snail-eating snakes (tribe Dipsadini) is presented including 43 (24 for the first time) of the 77 species, sampled for both nuclear and mitochondrial genes. Morphological and phylogenetic support was found for four new species of Dipsas and one of Sibon, which are described here based on their unique combination of molecular, meristic, and color pattern characteristics. Sibynomorphus is designated as a junior subjective synonym of Dipsas. Dipsas latifrontalis and D. palmeri are resurrected from the synonymy of D. peruana. Dipsas latifasciata is transferred from the synonymy of D. peruana to the synonymy of D. palmeri. A new name, D. jamespetersi, is erected for the taxon currently known as Sibynomorphus petersi. Re-descriptions of D. latifrontalis and D. peruana are presented, as well as the first photographic voucher of an adult specimen of D. latifrontalis, along with photographs of all known Ecuadorian Dipsadini species. The first country record of D. variegata in Ecuador is provided and D. oligozonata removed from the list of Peruvian herpetofauna. With these changes, the number of Dipsadini reported in Ecuador increases to 22, 18 species of Dipsas and four of Sibon.

Keywords

Dipsadini, Dipsas, Ecuador, new species, Peru, phylogeny, Sibon, Sibynomorphus, snail-eating snakes, systematics

Introduction

With 70 currently recognized species (Table 1), the snail-eaters (tribe Dipsadini) are among the most diverse groups of arboreal snakes (Wallach et al. 2014; Uetz et al. 2016). Some authors have suggested that their tree-dwelling lifestyle and specialized diet resulted this large an adaptive radiation (e.g., MacCulloch and Lathrop 2004; Sheehy 2012). In the last decade, the limits of the tribe have been redefined to include five genera (Dipsas, Plesiodipsas, Sibon, Sibynomorphus, and Tropidodipsas; Harvey et al. 2008), but recent studies suggest that not all of them are monophyletic (Sheehy 2012; Figueroa et al. 2016). Consequently, the limits between genera, species, and species groups appear to be poorly defined, and in need of revision for a robust and stable taxonomy.

One of the first modern attempts to clarify the taxonomy and summarize knowledge on the tribe Dipsadini was published by Peters (1960). Peters considered Dipsadini to include the genera Dipsas, Sibon and Sibynomorphus. Later, Zaher (1999) and Harvey et al. (2008) added Tropidodipsas and Plesiodipsas in the tribe. Peters also created seven species groups within Dipsas, three within Sibon (Table 1), and recognized D. boettgeri, D. latifrontalis, D. latifasciata, D. polylepis, and D. peruana as distinct species based on coloration and lepidosis. However, he considered D. palmeri and D. praeornata to be synonyms of D. latifrontalis.

After Peters, several authors continued to address the systematics of the group (Downs 1961, Hoge 1964, Peters and Orejas-Miranda 1970, Kofron 1982, Orcés and Almendáriz 1987, Porto and Fernandes 1996, Fernandes et al. 1998, Fernandes et al. 2002, Cadle and Myers 2003, Passos et al. 2004, Passos et al. 2005, Cadle 2005, Cadle 2007, Harvey 2008, Harvey and Embert 2008, Harvey et al. 2008). Of these, the works by Cadle and Myers (2003), Cadle (2007), Harvey (2008), and Harvey and Embert (2008) are worth addressing further because they focused on Ecuadorian species for which there is still taxonomic uncertainty. Cadle and Myers (2003) removed D. variegata from the herpetofauna of Ecuador, since previous records were based on museum misidentifications. Cadle (2007) reviewed the status of species of Sibynomorphus in Ecuador and Peru, and referred three additional specimens (AMNH 110587, BMNH 1935.11.3.108, and MUSM 2192) to S. oligozonatus, including the first country record for Peru. Cadle (2005) also reviewed three specimens of D. gracilis collected in Peru; however, Harvey (2008) concluded that only one of them corresponded to D. gracilis. In the same work, Harvey also redefined Peters’ (1960) species groups (Table 1). Finally, Harvey and Embert (2008) transferred D. boettgeri, D. latifrontalis, and D. polylepis to the synonymy of D. peruana, based on both the difficulty of segregating these species using morphological characters and their “more or less continuous distribution along the eastern slopes of the Andes”.

Here, we combine morphological analysis and molecular phylogenetics to revise generic and species limits within Dipsadini. We combine all available molecular sampling with new samples from Ecuador, Peru, Brazil and Costa Rica, and find support for five new species, as well as a number of changes to the geographic distribution of several Andean species.

Taxonomy of Dipsadini prior to this paper.

Genus Group Species Authority Reference
Dipsas D. articulata D. articulata Cope, 1868 Harvey 2008
D. bicolor Günther, 1895 Peters 1960
D. brevifacies Cope, 1866 Harvey 2008
D. gaigeae Oliver, 1837 Harvey 2008
D. gracilis Boulenger, 1902 Harvey 2008
D. maxillaris Werner, 1910 Peters 1960
D. tenuissima Taylor, 1954 Harvey 2008
D. viguieri Bocourt, 1884 Harvey 2008
D. catesbyi D. catesbyi Sentzen, 1796 Harvey 2008
D. copei Günther, 1872 Harvey 2008
D. pavonina Schlegel, 1837 Harvey 2008
D. elegans D. elegans Boulenger, 1896 Harvey 2008
D. ellipsifera Boulenger, 1898 Harvey 2008
D. oreas Cope, 1868 Harvey 2008
D. incerta D. alternans Fischer, 1885 Harvey 2008
D. incerta Jan, 1863 Harvey 2008
D. praeornata Werner, 1909 Harvey 2008
D. sazimai Fernandes et al., 2010 Fernandes et al. 2010
D. indica D. bucephala Shaw, 1802 Harvey 2008
D. cisticeps Boettger, 1885 Harvey 2008
D. indica Laurenti, 1768 Harvey 2008
D. pratti D. baliomelas Harvey, 2008 Harvey 2008
D. chaparensis Reynolds & Foster, 1992 Harvey 2008
D. peruana Boettger, 1898 Harvey 2008
D. pratti Boulenger, 1897 Harvey 2008
D. sanctijoannis Boulenger, 1911 Harvey 2008
D. schunkii Boulenger, 1908 Harvey 2008
D. temporalis D. pakaraima MacCulloch & Lathrop, 2004 Harvey 2008
D. temporalis Werner, 1909 Harvey 2008
D. vermiculata Peters, 1960 Harvey 2008
D. variegata D. albifrons Sauvage, 1884 Harvey 2008
D. andiana Boulenger, 1896 Harvey 2008
D. nicholsi Dunn, 1933 Harvey 2008
D. trinitatis Parker, 1926 Harvey 2008
D. variegata Duméril et al., 1854 Harvey 2008
Plesiodipsas Unassigned P. perijanensis Aleman, 1953
Sibon S. annulatus S. annulatus Günther, 1872 Savage 2002
S. anthracops Cope, 1868 Savage 2002
S. dimidiatus Günther, 1872 Savage 2002
S. lamari Solórzano, 2001 Solórzano 2001
S. linearis Pérez-Higareda et al., 2002 Pérez-Higareda et al. 2002
S. manzanaresi McCranie, 2007 McCranie 2007
S. merendonensis Rovito et al., 2012 Rovito et al. 2012
S. miskitus McCranie, 2006 McCranie 2006
S. sanniolus Cope, 1866 Savage 2002
Sibon S. argus S. argus Cope, 1875 Savage 2002
S. longifrenis Stejneger, 1909 Savage 2002
S. nebulatus S. carri Shreve, 1951 Peters 1960
S. dunni Peters, 1957 Savage 2002
S. nebulatus Linnaeus, 1758 Savage 2002
Unassigned S. noalamina Lotzkat et al., 2012
S. perissostichon Köhler et al., 2010
Sibynomorphus Unassigned S. lavillai Scrocchi et al., 1993
S. mikanii Schlegel, 1837
S. neuwiedi Ihering, 1911
S. oligozonatus Orcés & Almendáriz, 1989
S. oneilli Rossman & Thomas, 1979
S. petersi Orcés & Almendáriz, 1989
S. turgidus Cope, 1868
S. vagrans Dunn, 1923
S. vagus Jan, 1863
S. ventrimaculatus Boulenger, 1885
S. williamsi Carillo de Espinoza, 1974
Tropidodipsas T. fasciata T. fasciata Günther, 1858 Kofron 1987
T. philippii Jan, 1863 Kofron 1987
T. sartorii T. annulifera Boulenger, 1894 Kofron 1988
T. sartorii Cope, 1863 Kofron 1988
T. zweifeli Liner & Wilson, 1970 Kofron 1988
Unassigned T. fischeri Boulenger, 1894
T. repleta Smith et al., 2005

Materials and methods

Ethics statement

This study was carried out in strict accordance with the guidelines for use of live amphibians and reptiles in field research (Beaupre et al. 2004) compiled by the American Society of Ichthyologists and Herpetologists (ASIH), the Herpetologists’ League (HL) and the Society for the Study of Amphibians and Reptiles (SSAR). All procedures with animals (see below) were reviewed by the Ministerio de Ambiente del Ecuador (MAE) and specifically approved as part of obtaining the following field permits for research and collection: MAE-DNB-CM-2015-0017 (granted to Universidad Tecnológica Indoamérica), 018-IC-FAU-DNBAP/MA, 010-IC-FAU-DNBAPVS/MA, 004-IC-FAU/FLO-DPZCH-MA (granted to Museo Ecuatoriano de Ciencias Naturales del Instituto Nacional de Biodiversidad) and 001-10 IC-FAU-DNB/MA, 001-11 IC-FAU-DNB/MA, 002-16 IC-FAU-DNB/MA, 003-15 IC-FAU-DNB/MA, 003-17 IC-FAU-DNB/MA, 005-14 IC-FAU-DNB/MA, 008-09 IC-FAU-DNB/MA, MAE-DNB-ARRGG-CM-2014-0002 (granted to Pontificia Universidad Católica del Ecuador). Specimens were euthanized with 20% benzocaine, fixed in 10% formalin or 70% ethanol, and stored in 70% ethanol. Museum vouchers were deposited at Museo de Zoología of the Universidad Tecnológica Indoamérica (MZUTI), Museo de Zoología (QCAZ) of Pontificia Universidad Católica del Ecuador, Museo de Zoología (ZSFQ) of Universidad San Francisco de Quito, División de Herpetología (DHMECN) of Instituto Nacional de Biodiversidad and Coleção Herpetológica da UnB (CHUNB).

Common names

Criteria for common name designation are as proposed by Caramaschi et al. (2006), as modified by Coloma and Guayasamin (2011–2017), and are as follows (in order of importance): (i) the etymological intention (implicit or explicit) that the authors used when naming the species (specific epithet); (ii) a common name that is already widely used in the scientific literature; (iii) a common name that has an important ancestral or cultural meaning; (iv) a common name based on any distinctive aspect of the species (distribution, morphology, behavior, etc.).

Sampling

Tissue samples from 85 individuals representing 28 species (including five new species described here) were sampled from Ecuador, Peru, Guatemala, Costa Rica, Nicaragua, Brazil, and Mexico. All specimens included in the genetic analyses were morphologically identified according to Arteaga et al. (2013), Cadle (2005), Cadle (2007), Cadle and Myers (2003), Duellman (1978), Harvey (2008), Harvey and Embert (2008), Peters (1957) and Savage (2002). We created photo vouchers (Figs 1, 2) for all Ecuadorian species of Dipsadini. We generated sequence data for samples marked with an asterisk under Appendix 1, which includes museum vouchers at MZUTI, QCAZ, Museo de Zoología de la Universidad del Azuay (MZUA), División de Herpetología del Instituto Nacional de Biodiversidad (DHMECN), Museum of Vertebrate Zoology at Berkeley (MVZ), Bioparque Amaru Cuenca (AMARU), Coleção Herpetológica da UnB (CHUNB), Museo de Zoología de la Universidad San Francisco de Quito (ZSFQ), and Centro de Ornitología y Biodiversidad (CORBIDI), along with individuals not accessioned in musem collections (CAMPO, JMG and TJC).

Figure 1. 

Photographs of some species of Dipsas in life: a D. andiana MZUTI 5413 from Bilsa, province of Esmeraldas, Ecuador b D. andiana from Mindo, province of Pichincha, Ecuador c D. bobridgelyi MZUTI 5414 from Buenaventura, Province of El Oro, Ecuador d D. catesbyi from Gareno, province of Napo, Ecuador e D. catesbyi from Gareno, province of Napo, Ecuador f D. elegans from Calacalí–Mindo, province of Pichincha, Ecuador g D. ellipsifera from Pimampiro, province of Imbabura, Ecuador h D. gracilis from Canandé, province of Esmeraldas, Ecuador i D. gracilis from Mashpi, province of Pichincha, Ecuador j D. indica from Gareno, province of Napo, Ecuador k D. jamespetersi AMARU 1123 from province of Azuay, Ecuador l D. klebbai from El Chaco, province of Napo, Ecuador m D. klebbai from El Chaco, province of Napo, Ecuador n D. latifrontalis from San Isidro, state of Mérida, Venezuela o D. oligozonata from Poetate, province of Azuay, Ecuador p D. oreas MZUTI 5414 from Buenaventura, province of El Oro, Ecuador q D. oreas from Poetate–Corraleja, province of Azuay, Ecuador r D. palmeri from Agoyán, province of Tungurahua, Ecuador s D. palmeri MZUTI 4975 from Reserva San Francisco, province of Zamora, Ecuador t D. pavonina from Maycu, province of Zamora, Ecuador u D. temporalis from Colombia v D. variegata from Gareno, province of Napo, Ecuador w D. vermiculata from Miazi, province of Zamora, Ecuador, and x D. vermiculata from Narupa, province of Napo, Ecuador.

Figure 2. 

Photographs of some species of Sibon in life: a S. annulatus from Verdecanandé, province of Esmeraldas, Ecuador b Sibon bevridgelyi MZUA.RE.0424 from Palmales Nuevo, province of El Oro, Ecuador c S. bevridgelyi MZUTI 3269 from Buenaventura, province of El Oro, Ecuador d S. dunni CAMPO 533 from Pimampiro, province of Imbabura, Ecuador e S. nebulatus from Milpe, province of Pichincha, Ecuador, and f S. nebulatus from Canandé, province of Esmeraldas, Ecuador.

Laboratory techniques

Genomic DNA was extracted from 96% ethanol-preserved tissue samples (liver, muscle tissue or scales) using either a guanidinium isothiocyanate extraction protocol, or a modified salt precipitation method based on the Puregene DNA purification kit (Gentra Systems). We amplified the 16S gene using primer pairs 16Sar-L / 16Sbr-H-R from Palumbi et al. (1991) and 16sF.0 (Pellegrino et al. 2001) / 16sR.0 (Whiting et al. 2003). Additionally, the Cytb gene was obtained with primer pairs GLUDG-L (Palumbi et al. 1991) / ATRCB3 (Harvey et al. 2000) and LGL765 (Bickham et al. 1995) / CytbV (Torres-Carvajal et al. 2015), whereas the gene coding for the subunit 4 of the NADH dehydrogenase was amplified with the primers ND4 and Leu developed by Arévalo et al. (1994). The c-mos gene was retrieved with primers S77 and S78 developed by Lawson et al. (2005). PCR reactions contained 2 mM (Cytb and ND4) or 3 mM (16S and c-mos) MgCl2, 200 µM dNTP mix, 0.2 µM (16S, Cytb and c-mos) or 0.8 µM (ND4) of each primer and 1.25 U (16S) or 0.625 U (ND4, Cytb and c-mos) Taq DNA Polymerase Recombinant (Thermo Fisher Scientific) in a 25 µL total volume. The nucleotide sequences of the primers and the PCR conditions applied to each primer pair are detailed in Appendix 2. PCR products were cleaned with either ExoSAP-IT (Affymetrix, Cleveland, OH), or Exonuclease I and Alkaline Phosphatase (Illustra ExoProStar by GE Healthcare) before they were sent to Macrogen Inc (Korea) for sequencing. All PCR products were sequenced in both forward and reverse directions with the same primers that were used for amplification. The edited sequences were deposited in GenBank (Appendix 1).

DNA sequence analyses

A total of 298 DNA sequences were used to build a phylogenetic tree of the tribe Dipsadini, of which 222 were generated during this work and 76 were downloaded from GenBank. Among the new sequences, 103 are 201–520 bp long fragments of the 16S gene, 91 are 586–1,090 bp long fragments of the Cytb gene, 45 are 443–583 bp long fragments of the c-mos gene, 31 are 242–473 bp long fragments of the 12S gene, and 28 are 593–699 bp long fragments of the ND4 gene. New sequences were edited and assembled using the program Geneious ProTM 5.4.7 (Drummond et al. 2010) and aligned with those downloaded from GenBank (Appendix 1) using MAFFT v.7 (Katoh and Standley 2013) under the default parameters in Geneious ProTM 5.4.7. Genes were combined into a single matrix with 11 partitions, one per non-coding gene and three per protein-coding gene corresponding to each codon position. The best partition strategies along with the best-fit models of evolution were obtained in PartitionFinder 2 (Lanfear et al. 2016) under the Bayesian information criterion.

Phylogenetic relationships were assessed under both a Bayesian inference (BI) and a maximum likelihood (ML) approach in MrBayes 3.2.0 (Ronquist and Huelsenbeck 2013) and RAxML v8.2.9 (Stamatakis 2006), respectively. For the ML analysis, nodal support was assessed using the rapid-bootstrapping algorithm with 1000 non-parametric bootstraps. All ML estimates and tests were run under the GTRCAT model, as models available for use in RAxML are limited to variations of the general time-reversible (GTR) model of nucleotide substitution. For the BI analysis, four independent analyses were performed to reduce the chance of converging on a local optimum. Each analysis consisted of 6,666,667 generations and four Markov chains with default heating settings. Trees were sampled every 1,000 generations and 25% of them were arbitrarily discarded as ‘‘burn-in.” The resulting 5,000 saved trees per run were used to calculate posterior probabilities (PP) for each bipartition in a 50% majority-rule consensus tree. We used Tracer 1.6 (Rambaut et al. 2018) to assess convergence and effective sample sizes (ESS) for all parameters. Additionally, we verified that the average standard deviation of split frequencies between chains and the potential scale reduction factor (PSRF) of all the estimated parameters approached values of ≤0.01 and 1, respectively. Genetic distances between new species and their closest morphological relative were calculated using the uncorrected distance matrix in PAUP 4.0 (Swofford 2002). GenBank accession numbers are listed in Appendix 1.

Morphological data

Terminology for Dipsadini cephalic shields follows proposals by Peters (1960) and Harvey and Embert (2008). Diagnoses and descriptions generally follow Fernandes et al. (2010), and ventral and subcaudal counts follow Dowling (1951). When providing the standard deviation, we use the ± symbol. We examined comparative alcohol-preserved specimens from the herpetology collections at Museo de Zoología de la Universidad Tecnológica Indoamérica (MZUTI), Museum d’Histoire Naturelle de la Ville de Genève (MHNG), Museo de Zoología de la Pontificia Universidad Católica del Ecuador (QCAZ), National Museum of Natural History (USNM), División de Herpetología del Instituto Nacional de Biodiversidad (DHMECN), Museo de Zoología de la Universidad del Azuay (MZUA), American Museum of Natural History (AMNH), Museo de Zoología de la Universidad San Francisco de Quito (ZSFQ), Museum of Natural Science of the Louisiana State University (LSUMZ), Museum of Comparative Zoology of Harvard University (MCZ), Natural History Museum and Biodiversity Research Center of University of Kansas (KU), British Museum of Natural History (BMNH), Museo de Historia Natural de la Escuela Politécnica Nacional (EPN), and Museo de la Universidad Nacional de San Marcos (MUSM) (Table 2). Morphological measurements were taken with measuring tapes to the nearest 1 mm, or with digital calipers to the nearest 0.1 mm. Abbreviations are as follows: snout-vent length (SVL); tail length (TL). Sex was determined by establishing the presence/absence of hemipenes through a subcaudal incision at the base of the tail unless hemipenes were everted.

Results

Molecular phylogeny and taxonomic consequences

We consider strong support to be bootstrap values of >70% and posterior probability values >95% following Felsenstein (2004). Overall, there is low support for the relationship between the genera Dipsas, Sibon, and Tropidodipsas (Fig. 3). The genus Sibynomorphus is not monophyletic and the included species are nested in four mutually exclusive clades within Dipsas. Two of the three included species of Tropidodipsas, T. fischeri, and T. fasciata, form a poorly supported clade, whereas T. sartorii is strongly supported as sister lineage to all other included samples of Dipsadini. The genus Sibon is monophyletic, and sister to T. fischeri and T. fasciata in the ML analysis, although this relationship is not strongly supported. In the BI analysis, Sibon is sister to Dipsas. We excluded Sibon noalamina (voucher SMF 91539) from the analyses as the short sequence available in GenBank (gene fragment 16S) represented a rogue taxon that assumed varying phylogenetic positions in the tree collection used to build the consensus tree.

Figure 3. 

Phylogenetic relationships within Dipsadini derived from analysis of 3,375 bp of DNA (gene fragments 12S, 16S, Cytb, ND4 and c-mos). Support values on intraspecic branches are not shown for clarity. Voucher numbers for sequences are indicated for each terminal when available. a Maximum likelihood analysis. Black dots indicate clades with bootstrap values from 90–100%. Grey dots indicate values from 70–89%. White dots indicate values from 50–69% (values <50% not shown) b Bayesian inference analysis. Black dots indicate clades with posterior probability values from 95–100%. Grey dots indicate values from 70–94%. White dots indicate values from 50–69% (values <50% not shown).

Sibon longifrenis is recovered as the sister taxon to all other included species of Sibon. Deep intraspecific divergence is found between samples of S. annulatus from Central America (MVZ 269290, ADM 0007, ADM 242) and that from Ecuador (MZUTI 3034). The widespread species S. nebulatus is paraphyletic with respect to both S. dunni and a new species from Ecuador. Nonetheless, within S. nebulatus, the included subspecies S. n. nebulatus (Linnaeus, 1758) and S. n. leucomelas (Boulenger, 1896) are monophyletic, while the single Colombian specimen of S. n. hartwegi (Peters 1960) is sister to all other members of the Ecuadorian S. nebulatus group. However, posterior probabilites from our genetic data for the formation of monophyletic Ecuadorian clades S. n. leucomelas, S. dunni, and Sibon. sp. are variable, and as low as 48% PP for the node separating Sibon sp. from S. nebulatus leucomelas and S. dunni.

Eight Sibynomorphus species were included in the molecular analyses. These are S. mikanii, S. neuwiedi, S. oligozonatus, S. petersi, S. turgidus, S. vagus, S. ventrimaculatus, and S. williamsi. In the ML analysis, all of them are nested within different Dipsas subclades, whereas in the BI analysis, the clade containing S. mikanii and S. turgidus is not nested within Dipsas. Crucially, Dipsas mikanii Schlegel, 1837 is the type species of Sibynomorphus (Fitzinger, 1843). Thus, we synonymize Sibynomorphus with Dipsas primarily based on the ML analysis, which mirrors the results of Sheehy (2012).

Based on our transfer of the genus Sibynomorphus Fitzinger to the synonymy of Dipsas, we propose the following binomial nomenclature for the eleven species traditionally included in the genus Sibynomorphus: Dipsas lavillai comb. n., D. mikanii, D. neuwiedi comb. n., D. oligozonata comb. nov., D. oneilli comb. n., D. turgida comb. nov., D. vagrans comb. n., D. vaga comb. n., D. ventrimaculata comb. n., and D. williamsi comb. n. However, we refrain from applying D.petersi” for Sibynomorphus petersi here, because the name Dipsasindicapetersi (Hoge & Romano, 1975), another taxon and putative species from southeastern Brazil, is often already named as Dipsas petersi (e.g., Centeno et al. 2008, Wallach et al. 2014), and this name predates Sibynomorphus petersi (Orces & Almendáriz, 1989). Therefore, the latter is now a secondary junior homonym in conflict upon transfer to Dipsas Laurenti, and thus requires a replacement name. We therefore erect the name Dipsas jamespetersi, which still honors James A. Peters, for the taxon Sibynomorphus petersi Orces & Almendariz, 1989.

There are several clades within Dipsas peruana sensu lato. One is D. peruana, the other is a new species from northern Ecuador, which we describe below, and the third is the lineage corresponding to the population distributed along the Amazonian slopes of the Andes between central Ecuador and northern Peru. Below, we resurrect the name D. palmeri (Boulenger, 1912) for this lineage, as the type locality of D. palmeri (El Topo, province of Tungurahua, Ecuador) is located within the geographic range of the included samples (Fig. 4) and the holotype agrees in coloration and lepidosis with other specimens (Appendix 3) in the same region that were included in the genetic analyses.

Figure 4. 

Distribution of various species of Dipsas, and potential geographical barriers between taxa.

Dipsas oligozonata is the strongly supported sister lineage of a clade that includes three species: D. williamsi and two new species from western Ecuador and northern Peru, which we describe below. Dipsas indica is paraphyletic with respect to D. bucephala. Dipsas jamespetersi is paraphyletic with respect to a sample of D. vaga (KU 219121).

Based on the species included in the phylogenetic analysis, the Dipsas articulata and D. indica groups, sensu Harvey 2008 (Table 1), are recovered as monophyletic. The other groups included in the phylogenetic analysis (i.e., catesbyi, oreas, pratti, temporalis and variegata) are not monophyletic. The two included members of the D. catesbyi group (i.e., D. catesbyi and D. pavonina) are not sister taxa. The included members of the Dipsas oreas group form a paraphyletic unit, because besides including D. elegans, D. ellipsifera, and D. oreas, this group also includes D. andiana, a species that was considered a member of the D. variegata group (Harvey 2008, and Table 1). Accordingly, we transfer D. andiana to the D. oreas group. The two included members of the D. pratti group (i.e., D. peruana and D. pratti) are placed in different branches of the phylogeny. The same is true for the included members of the D. temporalis group (i.e., D temporalis and D. vermiculata), whereby D. vermiculata clusters with D. variegata, and accordingly we move it into that group. We refrain from merging the Dipsas temporalis and D. pratti groups because we did not examine the specimens of D. pratti included in the analysis (MHUA 14278). We also refrain from assigning further species groups until a more complete taxon sampling is made available.

New records for Ecuador

One individual (Fig. 1v) of Dipsas variegata photographed (not collected) at Gareno Lodge, province of Napo (S1.03559, W77.39864; 336 m), represents the first record of this species in Ecuador (Fig. 4). This individual agrees in coloration with the description of the species provided by Cadle and Myers (2003) and Mebert et al. (submitted), including dorso-lateral blotches/saddles resembling vertically stretched rhomboids or bars, often with a light center or spots, border of blotches being zig-zag shaped and following the outline of adjacent dorsal scales, variably numbered and shaped spots in the interspaces, cephalic blotches lacking yellow borders, and a light-colored eye. It shows also the typical truncated head (see Peters 1960 for description of head truncation) of D. variegata, in particular the short, but high preorbital region including an upturned chin, a convex supraocular, narrow and vertically elongated anterior labials (here 2nd–6th supralabials), and 15 dorsal scale rows. This D. variegata expands the known distribution 1,186 km SW from the nearest localities along the Venezuelan Andes (Natera-Mumaw et al. 2015) and 1,343 km NW from the nearest locality in southeastern Peru (Catenazzi et al. 2013).

Systematic accounts

We seek here to name or provide re-descriptions only for species that are monophyletic in our molecular phylogeny and share diagnostic features of their coloration pattern and lepidosis. Based on these species delimitation criteria, which follow the general species concept of de Queiroz (2007), we describe four new Dipsas, one new Sibon and revalidate D. palmeri and D. latifrontalis.

Sibon bevridgelyi sp. n.

Figs 2b, 6, 7

Proposed standard English name

Bev Ridgely’s Snail-Eater

Proposed standard Spanish name

Caracolera de Bev Ridgely

Holotype

MZUTI 5416 (Figs 6, 7), adult male collected by Matthijs Hollanders on August 01, 2017 at Reserva Buenaventura, province of El Oro, Ecuador (S3.65467, W79.76794; 524 m).

Paratypes

AMNH 22092, adult male collected by George H. Tate on December 01, 1921 at Bucay, province of Guayas, Ecuador (S2.19788, W79.12909; 433 m). CORBIDI 3791, adult male collected by Pablo Venegas and Caroll Landauro on May 07, 2009 at El Caucho, department of Tumbes, Peru (S3.81438, W80.27101; 379 m). CORBIDI 3792, adult female collected by Pablo Venegas and Caroll Landauro on May 07, 2009 at El Caucho, department of Tumbes, Peru (S3.81438, W80.27101, 379 m). CORBIDI 7894, adult female collected by Vilma Durán and Germán Chávez on October 21, 2010 at El Caucho, department of Tumbes, Peru (S3.81844, W80.26856; 478 m). CORBIDI 7994, adult female collected by Pablo Venegas on September 24, 2010 at El Caucho, department of Tumbes, Peru (S3.81244, W80.26716; 481 m). DHMECN 8976, juvenile collected by Michael Harvey and Luis A. Oyagata at Cerro San Sebastián, Parque Nacional Machalilla, province of Manabí, Ecuador (S1.60002, W80.69974, 602 m). DHMECN 9483, adult male collected by Mario Yánez-Muñoz, María Pérez, Miguel Alcoser, Marco Reyes-Puig and Gabriela Bautista in 2012 at the type locality. DHMECN 10061, adult male collected by Manuel Morales, María Perez Lara and Karem López at Reserva Biológica Ayampe, province of Manabí, Ecuador (S1.65417, W80.81333; 43 m). DHMECN 11526, adult of undetermined sex collected by Juan Carlos Sánchez-Nivicela, Karem López, Verónica Urgilés, Bruno Timbe, Elvis Celi and Valentina Posse at Remolino, province of El Oro, Ecuador (S3.56551, W79.91948; 229 m). KU 152205, adult of undetermined sex collected at 30 km E Pasaje, province of Azuay, Ecuador (S3.31439, W79.57970; 561 m). MCZ R-17099, a juvenile of undetermined sex collected at Valle del Chanchán, province of Chimborazo, Ecuador (S2.27383, W79.08735; 697 m). MCZ R-3564, a juvenile of undetermined sex collected by Samuel Walton Garman on January 1, 1875 at Daule River, province of Guayas, Ecuador (S1.87009, W80.00530; 5 m). MZUA.RE.0142, adult female collected by Jose Manuel Falcón at Sarayunga, province of Azuay, Ecuador (S3.31431, W79.58069; 552 m). MZUA.RE.0328, adult male collected by Keyko Cruz on April 04, 2016 at Jauneche, province of Los Ríos, Ecuador (S1.33333, W79.58333; 41 m). MZUA.RE.0424, adult male collected by Fausto Siavichay, Valentina Posse and Xavier Clavijo on June 29, 2017 at 2 km N Palmales Nuevo, province of El Oro, Ecuador (S3.65158, W80.09625; 129 m). MZUTI 3269, adult male collected by Lucas Bustamante on November 07, 2013 at the type locality. QCAZ 14444, adult male collected by Fernando Ayala, Steven Poe and Chris Anderson on January 10, 2016 at Proyecto Minas San Francisco, province of Azuay, Ecuador (S3.30829, W79.47079; 862 m). QCAZ 14446, adult male collected by Fernando Ayala, Steven Poe and Chris Anderson on January 10, 2016 at Ponce Enríquez–El Coca, province of Azuay, Ecuador (S3.03197, W79.64615; 1206 m). ZSFQ D503, adult male collected by Diego Cisneros-Heredia on June 07, 2000 at Cerro La Mocora, Parque Nacional Machalilla, province of Manabí, Ecuador (S1.60379, W80.70191; 818 m).

Diagnosis

Sibon bevridgelyi is placed in the genus Sibon based on phylogenetic evidence (Fig. 3) and on having the labial beneath primary temporal conspicuosly higher than other labials. The species differs from all described species of Sibon based on the following combination of characters: (1) 15/15/15 smooth dorsals with enlarged vertebral row (1.3–1.7 times as wide as adjacent rows); (2) seven supralabials with 4th and 5th contacting orbit or eight supralabials with 5th and 6th contacting orbit; (3) one pair of infralabials in contact behind symphysial; (4) postmental absent; (5) 175–193 ventrals in males, 193 in the single female; (6) 80–94 divided subcaudals in males, 98 in the single female; (7) dorsal and ventral ground color pale yellow with or without irregular black bands, and with a black stippled disruptive pattern of irregular rusty to reddish brown blotches that are separated from each other by light interspaces (Figs 6, 2b, c); bands incomplete and stippling not prominent or absent on ventral surfaces; head heavily speckled or blotched with black or rusty pigment; eyes light slate blue to pale goldenrod with black speckles and reticulations; (8) 349–732 mm SVL in males, 786 mm in the single female; (9) 124–268 mm TL in males, 204 mm in the single female.

Comparisons

Sibon bevridgelyi is most similar to S. nebulatus, from which it differs on the basis of its distinctive coloration (Figs 6, 2b, c). In S. nebulatus (Figs 2e, f), the dorsal and ventral color is a combination of mainly black to dark-brown blotches or bands on a gray to grayish brown background (interblotch) color; the dorso-lateral blotches can partly be bordered by white to rosy scales or edges. In some regions, the blackish pattern and gray ground color is often replaced by dark and light brown tones (e.g., in Venezuela, adjacent regions in Colombia, and Trinidad and Tobago); the spaces between the blotches are heavily invaded by blotch color and strongly stippled, spotted and mottled with white and black pigment. Although S. bevridgelyi also has a disruptive pattern, the diagnostic white and gray pigment of S. nebulatus from Central America and northern South America is lacking in S. bevridgelyi. Instead of white pigment, there is golden yellow; instead of gray, the dominant ground color is bright rusty brown to maroon. Additionally, the infralabials and the whitish throat in S. nebulatus from Central America and northern South America are heavily stippled or at least partly interrupted with black pigment, whereas in S. bevridgelyi the infralabials and the throat are immaculate or have few scattered blotches (Fig. 7b). Finally, the black blotches and stippling diagnostic of S. nebulatus are lacking in the majority of the specimens of S. bevridgelyi. Specimens of S. nebulatus with rosy gray or reddish brown ground color have white (instead of yellowish) blotches and stippling. Genetic divergence in a 521 bp long fragment of the mitochondrial Cytb gene between S. bevridgelyi and S. nebulatus leucomelas is 1.9–2.5%, whereas intraspecific distances are less than 0.4% in both species.

Description of holotype

Adult male, SVL 602 mm, tail length 186 mm (31% SVL); head length 20.9 mm (3% SVL) from tip of snout to commissure of mouth; head width 12.4 mm (59% head length) taken at broadest point; snout-orbit distance 21 mm; head distinct from neck; snout short, blunt in dorsal and lateral outline; rostral 3.5 mm wide, broader than high; internasals 1.9 mm wide, broader than long; prefrontals 4.4 mm wide, longer than broad, entering orbit; supraocular 4.4 mm long, longer than broad; frontal 4.1 mm long, pentagonal and rounded, in contact with prefrontals, supraoculars, and parietals; parietals 7.7 mm long, longer than broad; nasal weakly divided, in contact with first three supralabials, loreal, prefrontal, internasal, and rostral; loreal 3.7 mm long, longer than high, entering the orbit; eye diameter 3.9 mm; pupil semi-elliptical; no preocular; two postoculars; temporals 1+3 on the right side, 2+3 on the left side; eight supralabials with 5th and 6th contacting orbit on the right side, seven supralabials with 4th and 5th contacting orbit on the left side; symphysial separated from chinshields by the first pair of infralabials; nine infralabials, 1–7 contacting chinshields; anterior pair of chinshields broader than long, posterior pair longer than broad; dorsal scales in 15/15/15 rows, smooth, without apical pits; 184 ventrals; 80 divided subcaudals; cloacal plate single.

Natural history

Specimens of Sibon bevridgelyi have been found active at night (20h56–03h56) on arboreal vegetation 30–500 cm above the ground in secondary and primary semideciduous foothill forest, pastures, and cacao plantations, usually close to streams. QCAZ 14444 was found feeding on a snail. In captivity, MZUA.RE.0142 fed on slugs and snails. By daytime, one individual (not collected) was found hidden under tree bark, and another (ZSFQ D503) was found coiled on the center of a palm tree about 2 m above the ground. DHMECN 9483 was collected in sympatry with Dipsas andiana and D. bobridgelyi at Reserva Biológica Buenaventura.

Distribution

Northwestern Peru in the department of Piura, and southwestern Ecuador in the provinces of Azuay, Chimborazo, El Oro, Guayas, Los Ríos and Manabí at elevations between 5 and 1206 m (Fig. 8).

Etymology

The specific epithet honors the late Prof. Beverly S. Ridgely, life-long birder and conservationist, and father of Robert S. Ridgely, well known in Ecuadorian ornithological circles and co-author of The Birds of Ecuador. Though he never got to visit Buenaventura, from afar Bev continued to delight in the conservation successes of Fundación Jocotoco, which now owns and manages one of the few protected areas where the Vulnerable Sibon bevridgelyi is known to occur.

Conservation status

We consider Sibon bevridgelyi to be Vulnerable following B2a,b(i,iii) IUCN criteria (IUCN 2001) because its area of occupancy is estimated to be less than 2,000 km2, it is known only from 15 patches of forest lacking connectivity between them, and its habitat is severely fragmented and declining in extent and quality due to deforestation. Furthermore, only three of the localities (Parque Nacional Machalilla, Reserva Buenaventura, and Reserva Ayampe) where S. bevridgelyi occurs are currently protected.

Dipsas bobridgelyi sp. n.

Figs 1c, 9, 10

Proposed standard English name

Bob Ridgely’s Snail-Eater

Proposed standard Spanish name

Caracolera de Bob Ridgely

Holotype

MZUTI 5417 (Figs 9, 10), adult male collected by Matthijs Hollanders on August 01, 2017 at Reserva Buenaventura, province of El Oro, Ecuador (S3.65467, W77.76794; 524 m).

Paratypes

DHMECN 11527, adult female collected by Juan Carlos Sánchez-Nivicela, Karem López, Verónica Urgilés, Bruno Timbe, Elvis Celi and Valentina Posse at Remolino, province of El Oro, Ecuador (S3.56551, W79.91948; 229 m). MZUTI 3266, adult female collected by Lucas Bustamante on October 06, 2013. MZUTI 5414, adult male collected by Matthijs Hollanders and Paulina Romero on June 08, 2017. QCAZ 1706, adult male collected by Fernando Ayala, Steven Poe, and Chris Anderson on March 03, 1994 at Ponce Enríquez, province of Azuay, Ecuador (S3.06547, W79.74358; 39 m).

Diagnosis

Dipsas bobridgelyi is placed in the genus Dipsas based on phylogenetic evidence (Fig. 3), and the absence of a labial that is noticeably higher than other labials and in contact with the postocular, primary, and secondary temporals. The species differs from all described species of Dipsas based on the following combination of characters: (1) 15/15/15 smooth dorsals with enlarged vertebral row (2.1–2.2 times as wide as adjacent rows); (2) loreal and prefrontal in contact with orbit; (3) 9 supralabials with 4th and 5th contacting orbit; (4) one pair of infralabials in contact behind symphysial; (5) 180–201 ventrals in males, 178–184 in females; (6) 95–117 divided subcaudals in males, 96–98 in females; (7) dorsal and ventral color made up of 30–35 bold black body rings (up to 7–12 vertebral scales long) separated from each other by narrow (up to 3–4 vertebral scales long) dingy white interspaces; dorsal aspect of interspaces heavily speckled with rusty and black pigment; ventral surfaces lacking speckling; ground color of head dingy white with various degrees of scattered black pigment that coalesce on the top of the head, and various degrees of rusty speckling concentrated on the snout, nape and sides of the head; iris rich dark brown; (8) 372–478 mm SVL in males, 286–404 mm in females; (9) 158–212 mm TL in males, 117–158 mm in females.

Comparisons

Dipsas bobridgelyi is most similar to D. gracilis, from which it differs in coloration. In D. gracilis (Figs 1h, i), the black rings are up to 10–16 vertebral scales long and the interspaces are up to 5–7 scales long, whereas in D. bobridgelyi the black rings and interspaces are shorter, up to 8–9 and 3–4 vertebral scales long, respectively. In D. gracilis, the head plates are either completely black or black scattered with reddish brown, whereas in D. bobridgelyi the head plates are heavily stippled with white and tan pigment, especially on the prefrontals and internasals. In all known specimens of D. bobridgelyi, the ground color of the interspaces is white with contrasting reddish-tan pigment in the center, whereas in D. gracilis the ground color of the light interspaces on body and tail is either completely light brown or light reddish white, gradually becoming reddish brown towards the center. Finally, the nape and temporal region of the head in D. gracilis are either immaculate light reddish brown or marked with bold black speckles, whereas in D. bobridgelyi they are an irregular mix of fine speckling of white, rusty, and black pigments. Genetic divergence in a 689 bp long fragment of the mitochondrial Cytb gene between D. bobridgelyi and D. gracilis is 8.7–9.0%, whereas intraspecific distances are less than 0.3% in both species.

Description of holotype

Adult male, SVL 372 mm, tail length 158 mm (43% SVL); head length 15.1 mm (4% SVL) from tip of snout to commissure of mouth; head width 8.1 mm (54% head length) taken at broadest point; snout-orbit distance 4.3 mm; head distinct from neck; snout short, blunt in dorsal and lateral outline; rostral 2.4 mm wide, broader than high; internasals 2.3 mm wide, broader than long; prefrontals 2.5 mm wide, longer than broad and contacting orbit; supraocular 3.2 mm long, longer than broad; frontal 3.9 mm long, hexagonal, in contact with prefrontals, supraoculars, and parietals; parietals 4.7 mm long, longer than broad; nasal divided, in contact with first three supralabials, loreal, prefrontal, internasal, and rostral; loreal 1.8 mm long, slightly higher than long, entering the orbit; eye diameter 2.7 mm; pupil semi-elliptical; no preocular; two postoculars; temporals 2+3; nine supralabials, 4th and 5th contacting orbit; symphysial separated from chinshields by the first pair of infralabials; 13 infralabials, 1–7 contacting chinshields; anterior pair of chinshields longer than broad, posterior pair broader than long; dorsal scales in 15/15/15 rows, smooth, without apical pits; 182 ventrals; 101 divided subcaudals; cloacal plate single.

Natural history

Individuals of Dipsas bobridgelyi have been found active at night (19h00–23h26) on arboreal vegetation 100–250 cm above the ground in secondary semi-deciduous foothill forest. MZUTI 5414 was found feeding on a snail.

Distribution

Foothills of the southwestern Ecuadorian Andes in the provinces of Azuay and El Oro, and northwestern Peruvian Andes in the department of Tumbes, at elevations between 39 and 572 m (Fig. 4).

Etymology

This species is named in honor of Dr. Robert “Bob” S. Ridgely, a leading ornithologist and distinguished conservationist who has dedicated almost 50 years of his life to the study and conservation of birds and biodiversity across Latin America. Bob is the President of Rainforest Trust and for the past twenty years has been a major driver of conservation in Ecuador through Fundación Jocotoco, which he helped establish twenty years ago. In 1980, Bob visited the type locality of Dipsas bobridgelyi (Buenaventura, meaning "good fortune"), now known to be a key area for the conservation of biodiversity. Bob embarked on conservation and worked diligently to raise funds through Rainforest Trust for the past 18 years to purchase private properties and establish what is now the Reserva Buenaventura of Fundación Jocotoco.

Conservation status

We consider Dipsas bobridgelyi to be Endangered following the IUCN criteria B1a,b(i,iii) (IUCN 2001) because its extent of occurrence is estimated to be less than 5,000 km2, it is known only from 4 patches of forest lacking connectivity between them, and its habitat is severely fragmented and declining in extent and quality due to deforestation. Furthermore, only two of the localities (Buenaventura reserve and Reserva Nacional de Tumbes) where D. bobridgelyi occurs are currently protected.

Remarks

Cadle (2005) and Harvey (2008) examined MUSM 17589 from Tumbes department, Peru, and concluded that it was Dipsas gracilis. Although we did not examine this specimen, we believe that it corresponds to D. bobridgelyi based on Cadle’s (2005) color description (i.e., head white with many irregular black markings on the top and sides).

Dipsas georgejetti sp. n.

Figs 11, 12

Proposed standard English name

George Jett’s Snail-Eater

Proposed standard Spanish name

Caracolera de George Jett

Holotype

MZUTI 5411 (Figs 11, 12), adult male collected by Melissa Costales on August 31, 2017 at Cabuyal, province of Manabí, Ecuador (S0.19698, W80.29059; 15 m).

Paratypes

DHMECN 11639, adult male collected by Jacinto Bravo in 2014 at Montecristi, province of Manabí, Ecuador (S1.04694, W80.65766; 136 m). DHMECN 11646, adult male collected by Félix Almeida in 2014 at Rocafuerte, province of Manabí, Ecuador (S0.92371, W80.45212; 19 m). MZUA.RE.0121 and MZUA.RE.0122, adult female and adult male, respectively, collected by Juan Carlos Sánchez-Nivicela at El Aromo, province of Manabí, Ecuador (S1.04665, W80.83227; 295 m). QCAZ 10589, adult male collected at El Aromo, province of Manabí, Ecuador (S1.04665, W80.83227; 295 m). QCAZ 9125, adult male collected at Cerro Blanco, province of Guayas, Ecuador (S2.17465, W80.02135; 147 m). USNM 142595, juvenile of undetermined sex collected on December 1959 at 10 mi N of Guayaquil, province of Guayas (S1.96418, W79.87988; 5 m). ZSFQ D606, juvenile male collected by Diego F. Cisneros-Heredia at the foothills of Cerro La Mocora, Parque Nacional Machalilla, province of Manabí, Ecuador (S1.59817, W80.75431; 308 m).

Diagnosis

Dipsas georgejetti is placed in the genus Dipsas based on phylogenetic evidence (Fig. 3) and the absence of a labial that is noticeably higher than other labials and in contact with the postocular, primary and secondary temporals. The species differs from all described species of Dipsas based on the following combination of characters: (1) 15/15/15 smooth dorsals with a slightly enlarged vertebral row (1–1.4 times as wide as adjacent rows); (2) loreal and prefrontal in contact with orbit; (3) 7 supralabials with 4th and 5th (3th–5th in DHMECN 11646) contacting orbit; (4) no infralabials in contact behind symphysial; (5) 172–180 ventrals in males, 177 in one female; (6) 69–86 divided subcaudals in males, 58 in one female; (7) dorsal ground color light sandy brown with a pattern of 53–61 drab to brown black-edged middorsal blotches that are wider (6–7 vertebral scales long) and solid down to the edges of the ventrals on the first one third of the body, but becoming narrower (1–3 vertebral scales long) and broken up laterally towards the tail; interspaces finely speckled with brown pigment; ground color of the head light sandy brown with bold dark brown to black irregular blotches scattered on head plates and edging supralabials; ventral surfaces sandy brown with fine black speckling; iris sandy brown with dense dark brown speckling; (8) 270–711 mm SVL in males, 856 mm in one female; (9) 87–170 mm TL in males, 150 mm in one female.

Comparisons

Dipsas georgejetti is most similar to D. oswaldobaezi, D. williamsi, D. oligozonata, and D. vagrans, in that order, all of which were previously included in the genus Sibynomorphus. From D. oswaldobaezi (Figs 13, 14) and D. williamsi, it differs in having 7 supralabials with 4th and 5th bordering the eye (instead of 6 with 3rd and 4th bordering the eye). It further differs from D. williamsi in having the first supralabial not in contact with prefrontal (vs. in broad contact in D. williamsi). From D. oligozonata (Fig. 1o) and D. vagrans, it differs in having more than 160 ventrals. Dipsas georgejetti further differs from D. oligozonata in having distinct bold crossbands at least middorsally along the whole length of the body, instead of being present only on the anterior half of the body. Genetic divergence in a 529 bp long fragment of the mitochondrial Cytb gene between D. georgejetti and D. oswaldobaezi is 8.3%, whereas intraspecific distances are less than 0.4% in D. georgejetti. For the same fragment, the distance between D. georgejetti and D. williamsi is 7.8–7.9%.

Description of holotype

Adult male, SVL 315 mm, TL 87 mm (28% SVL); head length 13.6 mm (4% SVL) from tip of snout to commissure of mouth; head width 8.4 mm (62% head length) taken at broadest point; snout-orbit distance 3.5 mm; head distinct from neck; snout short, blunt in dorsal and lateral outline; rostral 2.0 mm wide, broader than high; internasals 1.7 mm wide, broader than long; prefrontals 2.5 mm wide, longer than broad and contacting orbit; supraocular 3.4 mm long, longer than broad; frontal 3.3 mm long, pentagonal, in contact with prefrontals, supraoculars, and parietals; parietals 5.5 mm long, longer than broad; nasal divided, in contact with first two supralabials, loreal, prefrontal, internasal, and rostral; loreal 1.7 mm long, slightly higher than long, entering orbit; eye diameter 2.8 mm; pupil semi-elliptical; no preocular; two postoculars; temporals 2+2; seven supralabials, 4th and 5th contacting orbit; symphysial in contact with first pair of chinshields; nine infralabials, 1–6 contacting chinshields; anterior pair of chinshields longer than broad, posterior pair broader than long; dorsal scales in 15/15/15 rows, smooth, without apical pits; 178 ventrals; 69 divided subcaudals; cloacal plate single.

Natural history

The holotype was active during a dry night after a sunny day. It was perched on tangled vegetation 130 cm above the ground in dry shrubland besides recently cleared pasture. MZUA.RE0121 and MZUA.RE0122 were found actively moving at night between the branches 80–200 cm above the ground. ZSFQ D606 was found active during daytime after bulldozers opened a track in old-growth forest.

Distribution

Deciduous and semideciduous forests along the central Pacific coast in Ecuador in the provinces of Manabí and Guayas, at elevations between 5 and 317 m (Fig. 5).

Etymology

The specific name georgejetti honors George Jett, who has been a long-time donor to Rainforest Trust and has supported the reserves of Fundación Jocotoco in Ecuador. He is an international traveler with a passion for reptiles, amphibians, and birds.

Conservation status

We consider Dipsas georgejetti to be Vulnerable following the IUCN criteria A1c,B1a,b(iii, iv) (IUCN 2001) because its extent of occurrence is estimated to be 10,193 km2, it is known only from 9 localities effectively corresponding to 4 patches of forest lacking connectivity between them, and its habitat is severely fragmented and declining in extent and quality due to deforestation. At the type locality, D. georgejetti was found in a patch of deciduous forest of 13 km2 that was being cleared to accommodate cattle pastures. One of the localities, 15 km N of Guayaquil, where D. georgejetti was collected in 1959, is now completely deforested, which suggests that this arboreal species is no longer present there.

Figure 5. 

Distribution of Dipsas georgejetti, D. oligozonata, D. oswaldobaezi, and D. williamsi in Ecuador and Peru. Figures represent known localities.

Figure 6. 

Adult male holotype of Sibon bevridgelyi. MZUTI 5416.

Dipsas oswaldobaezi sp. n.

Figs 13, 14

Sibynomorphus oligozonatus Cadle, 2007: 195 (part).

Proposed standard English name

Oswaldo Báez’ Snail-Eater

Proposed standard Spanish name

Caracolera de Oswaldo Báez

Holotype

QCAZ 10369 (Fig. 13), adult female collected by Silvia Aldás and Gabriel Zapata on March 03, 2010 at Quebrada El Faique, province of Loja, Ecuador (S4.17889, W80.04226; 1004 m).

Paratypes

BMNH1935.11.3.108, adult female collected by Clodoveo Carrión in the valley of Catamayo, province of Loja, Ecuador (S3.98064, W79.35928; 1289 m). MUSM 2192, adult male collected by Otavio Ruíz in Piura (department or city not specified), Peru. MZUA.RE.0286, adult of undetermined sex collected by Valentina Posse on December 2015 at Huaquillas, province of El Oro, Ecuador (S3.54115, W80.08646; 39 m). QCAZ 14051, adult of undetermined sex collected by Paul Székely and Diana Székely on March 18, 2015 at Reserva Ecológica Arenillas, province of El Oro, Ecuador (S3.62110, W80.17513; 41 m). QCAZ 14060, adult of undetermined sex collected by Paul Székely and Diana Székely on June 16, 2015 at Guabillo, province of El Oro, Ecuador (S3.60346, W80.18139; 44 m). QCAZ 15108, adult female collected by Diego Almeida, Darwin Núñez, Eloy Nusirquia, Santiago Guamán and Guadalupe Calle on November 12, 2016 at Reserva La Ceiba-Pilares, province of Loja, Ecuador (S4.27502, W80.32805; 534 m) (Fig. 14).

Diagnosis

Dipsas oswaldobaezi is placed in the genus Dipsas based on phylogenetic evidence (Fig. 3) and the absence of a labial that is noticeably higher than other labials and in contact with the postocular, primary and secondary temporals. The species differs from all described species of Dipsas based on the following combination of characters: (1) 15/15/15 smooth dorsals with a slightly enlarged vertebral row (1–1.2 times as wide as adjacent rows); (2) loreal and prefrontal in contact with orbit; (3) six supralabials with 3rd and 4th contacting orbit; (4) no infralabials in contact behind symphysial; (5) 163–179 ventrals in males, 177–179 in females; (6) 68–70 divided subcaudals in males, 65–66 in females; (7) dorsal ground color light sandy brown with a pattern of 55–63 drab to brown black-edged middorsal blotches that are wider (7–9 vertebral scale rows) and solid down to the edges of the ventrals on the first one third of the body, but becoming narrower (1–3 vertebral scales long) and broken up laterally towards the tail; interspaces finely speckled with brown pigment; ground color of the head light sandy brown with a thin light cream nuchal collar and bold dark brown to black irregular blotches scattered on head plates and edging supralabials; ventral surfaces sandy brown with fine black speckling (Fig. 13b); iris sandy brown with dense dark brown speckling; (8) 277–348 mm SVL in males, 407–428 mm in females; (9) 85–114 mm TL in males, 110–122 mm in females.

Comparisons

Dipsas oswaldobaezi is most similar to D. williamsi, D. georgejetti, D. oligozonata, and D. vagrans, in that order, all of which were previously included in the genus Sibynomorphus. From D. williamsi, it differs in having 7–9 infralabials (vs. 10 in D. williamsi), first supralabial not in contact with prefrontal (vs. in broad contact in D. williamsi), and dorsal blotches that are lighter in the middle (vs. dark solid blotches). From D. georgejetti (Figs 11, 12), it differs in having 6 supralabials with 3rd and 4th bordering the eye (vs. 7 supralabials with 4th and 5th bordering the eye in D. georgejetti). From D. oligozonata (Fig. 1o) and D. vagrans, it differs in having more than 160 ventrals. Dipsas oswaldobaezi further differs from D. oligozonata in having distinct bold crossbands at least middorsally along the whole length of the body, instead of being present only on the anterior half of the body. Genetic divergence in a 529 bp long fragment of the mitochondrial Cytb gene between D. oswaldobaezi and D. williamsi is 4.0–4.2%, whereas intraspecific distances are less than 0.2% in D. williamsi. For the same fragment, the distance between D. oswaldobaezi and D. georgejetti is 8.3%.

Description of holotype

Adult female, SVL 277 mm, tail length 85 mm (31% SVL); head length 9.5 mm (3.4% SVL) from tip of snout to commissure of mouth; head width 7.3 mm (76% head length) taken at broadest point; snout-orbit distance 3.3 mm; head distinct from neck; snout short, blunt in dorsal and lateral outline; rostral 2.1 mm wide, broader than high; internasals 1.2 mm wide, broader than long; prefrontals 2.2 mm wide, slightly broader than long and contacting orbit; supraocular 2.6 mm long, longer than broad; frontal 2.9 mm long, pentagonal, in contact with prefrontals, supraoculars, and parietals; parietals 4.2 mm long, longer than broad; nasal not divided, in contact with first supralabial, loreal, prefrontal, internasal, and rostral; loreal 1.3 mm long, longer than high, entering orbit; eye diameter 2.2 mm; pupil semi-elliptical; no preocular; two postoculars; temporals 2+2; 6 supralabials, 3rd and 4th contacting orbit; symphysial separated from chinshields by the first pair of infralabials; 9/8 (right/left) infralabials, 1–6/1–5 contacting chinshields; both pairs of chinshields longer than broad; dorsal scales in 15/15/15 rows, smooth, without apical pits; 179 ventrals; 70 divided subcaudals; cloacal plate single.

Natural history

Individuals of Dipsas oswaldobaezi have been found active by night on vegetation or at ground level in forested environments, pastures, or rural gardens. One individual (QCAZ 15108) was found hidden under leaf litter during daytime. Two individuals (MZUA.RE.0286 and QCAZ 14060) were found dead on roads.

Distribution

Deciduous and semideciduous lowland to lower montane forests and dry lowland shrublands in southwestern Ecuador (provinces of Loja and El Oro) and northwestern Peru (department of Tumbes), at elevation between 39 and 1289 m (Fig. 5).

Etymology

The specific name oswaldobaezi honors Dr. Oswaldo Báez, a renowned Ecuadorian biologist and researcher who has dedicated his life to the teaching of science, scientific thinking, and the conservation of nature. Oswaldo Báez has played a major role in science education in Ecuador through many popular science articles and books.

Conservation status

We consider Dipsas oswaldobaezi to be Vulnerable following the IUCN criteria B1a,b(iii, iv) (IUCN 2001) because its extent of occurrence is estimated to be 8,605 km2; it is known only from eight localities effectively corresponding to four patches of forest lacking connectivity between them, and its habitat is severely fragmented and declining in extent and quality due to deforestation.

Remarks

In his revision of Dipsas oligozonata, Cadle (2007) allocated three additional specimens (AMNH 110587, BMNH 1935.11.3.108 and MUSM 2192) to a species known only from the holotype (EPN 3612), collected at Zhila, province of Azuay (S3.50280, W79.18808; 2795 m) (Fig. 5). AMNH 110587 was collected ca. 34 km airline distance from the type locality at an elevation of 2204 m, and it resembles the holotype in both color and lepidosis. However, BMNH 1935.11.3.108 and MUSM 2192 have more than 160 ventral scales and have broad dark brown crossbars that are at least twice as long as those present in both the holotype, AMNH 110587 and in the other four specimens of D. oligozonata examined by us (Table 2; Fig. 1o), all of which have fewer than 160 ventral scales and come from elevations between 2102 and 2891 m in the watershed of the Río Jubones (Fig. 5). The coloration and ventral scale counts in BMNH 1935.11.3.108 and MUSM 2192 are more similar to D. oswaldobaezi, and we designated them as paratypes of this species.

Figure 7. 

Adult male holotype of Sibon bevridgelyi MZUTI 5416 in (a) dorsal and (b) ventral view. Scale bar: 1 cm.

Figure 8. 

Distribution of Sibon nebulatus and S. bevridgelyi in Ecuador. Figures represent known localities.

Locality data for specimens examined in this study. Coordinates represent actual GPS readings taken at the locality of collection or georeferencing attempts from gazetteers under standard guidelines, though some variation from the exact collecting locality will be present. Similarly, elevations are taken from Google Earth, and may not exactly match the elevations as originally reported. Specimens listed here but not under Appendix 3 were examined indirectly (e.g., through photographs).

Species Voucher Country Province Locality Latitude Longitude Elev. (m)
D. andiana MZUA.RE.0230 Ecuador Cañar Ocaña -2.48807, -79.18758 923
D. andiana MHNG 2250.053 Ecuador Cotopaxi Las Pampas -0.43021, -78.96663 1590
D. andiana MZUTI 5413 Ecuador El Oro Reserva Buenaventura -3.65477, -79.76830 497
D. andiana MZUTI 3501 Ecuador Pichincha Mashpi lodge 0.16567, -78.88656 860
D. andiana MZUTI 3505 Ecuador Pichincha Valle Hermoso–Los Bancos -0.01371, -79.09462 571
D. andiana ZSFQ D116 Ecuador Pichincha Tandayapa 0.00205, -78.67880 1734
D. andiana ZSFQ D117 Ecuador Pichincha Hacienda La Joya 0.08291, -78.98311 763
D. andiana ZSFQ D115 Ecuador Manabí 5km W Puerto López -1.59045, -80.84087 7
D. bobridgelyi QCAZ 1706 Ecuador Azuay Ponce Enríquez -3.06547, -79.74358 39
D. bobridgelyi DHMECN 11527 Ecuador El Oro Remolino -3.56551, -79.91948 229
D. bobridgelyi MZUTI 3266 Ecuador El Oro Reserva Buenaventura -3.65467, -79.76794 524
D. bobridgelyi MZUTI 5414 Ecuador El Oro Reserva Buenaventura -3.65310, -79.76336 572
D. bobridgelyi MZUTI 5417 Ecuador El Oro Reserva Buenaventura -3.65467, -79.76794 524
D. catesbyi MHNG 2220.054 Ecuador Morona Santiago Macas -2.31670, -78.11670 972
D. catesbyi MHNG 2238.005 Ecuador Morona Santiago San Pablo de Kantesiya -0.25001, -76.41849 250
D. catesbyi USNM 283949 Ecuador Morona Santiago Sucúa -2.45663, -78.16784 829
D. catesbyi DHMECN 11555 Ecuador Napo El Reventador -0.04669, -77.52898 1428
D. catesbyi QCAZ 181 Ecuador Napo Hollín–Loreto -0.74087, -77.51945 1020
D. catesbyi MHNG 2220.052 Ecuador Napo San Rafael -0.10354, -77.58337 1246
D. catesbyi QCAZ 210 Ecuador Napo San Rafael -0.09669, -77.58995 1464
D. catesbyi MHNG 2206.086 Ecuador Orellana Hacienda Primavera -0.48689, -76.63581 267
D. catesbyi MHNG 2435.097 Ecuador Pastaza Puyo -1.46678, -77.98335 953
D. catesbyi QCAZ 5108 Ecuador Pastaza Villano B -1.49961, -77.48234 341
D. catesbyi MHNG 2249.001 Ecuador Sucumbíos El Reventador -0.04480, -77.52858 1476
D. catesbyi QCAZ 28 Ecuador Sucumbíos El Reventador -0.04669, -77.52898 1428
D. catesbyi MHNG 2238.014 Ecuador
D. catesbyi MHNG 2307.091 Ecuador
D. catesbyi MZUTI 4736 Ecuador
D. catesbyi MZUTI 4999 Ecuador
D. elegans MHNG 2435.084 Ecuador Cotopaxi Cutzualo -0.54497, -78.91891 1952
D. elegans MHNG 2440.098 Ecuador Cotopaxi Galápagos -0.40583, -78.96667 1781
D. elegans DHMECN 1693 Ecuador Cotopaxi Hacienda “La Mariela” -1.14757, -79.09126 1256
D. elegans MHNG 2457.078 Ecuador Cotopaxi Las Damas -0.38402, -78.96741 1678
D. elegans MHNG 2249.019 Ecuador Cotopaxi Las Pampas -0.43021, -78.96663 1590
D. elegans MHNG 2413.074 Ecuador Cotopaxi Palo Quemado -0.61962, -78.99066 2402
D. elegans USNM 285957 Ecuador Pichincha 2.9 km SW of Tandayapa 0.00578, -78.67867 1844
D. elegans MHNG 2399.072 Ecuador Pichincha Ilaló -0.26166, -78.44444 2579
D. elegans MZUTI 3695 Ecuador Pichincha Tambotanda -0.02011, -78.65101 1875
D. elegans MZUTI 3317 Ecuador Pichincha Tandapi -0.42278, -78.79611 1550
D. elegans MHNG 2457.079 Ecuador Santo Domingo Chiriboga -0.22841, -78.76725 1813
D. elegans MHNG 2308.002 Ecuador Santo Domingo Hacienda Las Palmeras -0.24520, -78.84806 1876
D. elegans MHNG 2220.093 Ecuador
D. elegans MZUTI 3316 Ecuador
D. ellipsifera MZUTI 4931 Ecuador Carchi Chilma Bajo 0.86274, -78.05080 2071
D. ellipsifera QCAZ 14855 Ecuador Carchi Quebrada Golondrinas 0.83210, -78.12324 1737
D. ellipsifera QCAZ 15225 Ecuador Carchi Río Pailón 0.95643, -78.23448 1669
D. ellipsifera MHNG 2220.048 Ecuador Imbabura Cotacachi 0.29395, -78.26682 2446
D. gracilis QCAZ 4137 Ecuador Cañar Manta Real -2.55367, -79.36425 257
D. gracilis QCAZ 3504 Ecuador Esmeraldas Angostura 1.02164, -78.86295 31
D. gracilis QCAZ 10549 Ecuador Esmeraldas Caimito 0.69546, -80.08990 118
D. gracilis QCAZ 14495 Ecuador Esmeraldas Estero Gasparito 0.91296, -78.84066 80
D. gracilis QCAZ 2629 Ecuador Esmeraldas Fauna Granja Tropical 0.66152, -79.53875 29
D. gracilis QCAZ 7321 Ecuador Esmeraldas La Mayronga 1.04361, -79.27786 14
D. gracilis QCAZ 13738 Ecuador Esmeraldas Tundaloma 1.18166, -78.74945 74
D. gracilis MZUA.RE.0280 Ecuador Guayas Naranjal -2.72302, -79.63172 58
D. gracilis MZUA.RE.0281 Ecuador Guayas Naranjal -2.72302, -79.63172 58
D. gracilis QCAZ 12478 Ecuador Guayas Río Patul -2.55548, -79.37180 266
D. gracilis QCAZ 8432 Ecuador Los Ríos Buena Fe -0.89306, -79.48957 104
D. gracilis MHNG 2309.038 Ecuador Los Ríos Río Palenque -0.58333, -79.36667 173
D. gracilis QCAZ 10196 Ecuador Los Ríos Río Palenque -0.58333, -79.36667 173
D. gracilis USNM 285477 Ecuador Los Ríos Río Palenque -0.58333, -79.36667 173
D. gracilis USNM 285478 Ecuador Los Ríos Río Palenque -0.58333, -79.36667 173
D. gracilis USNM 285479 Ecuador Los Ríos Río Palenque -0.58333, -79.36667 173
D. gracilis USNM 285480 Ecuador Los Ríos Río Palenque -0.58333, -79.36667 173
D. gracilis DHMECN 2902 Ecuador Manabí El Aguacate 0.65348, -80.05190 43
D. gracilis QCAZ 11427 Ecuador Manabí Jama Coaque -0.11455, -80.12337 321
D. gracilis QCAZ 4654 Ecuador Manabí Lalo Loor -0.08337, -80.15004 75
D. gracilis MHNG 1363.023 Ecuador Manabí Maicito -0.27265, -79.57179 173
D. gracilis MHNG 1363.024 Ecuador Manabí Maicito -0.27265, -79.57179 173
D. gracilis MHNG 1363.026 Ecuador Manabí Maicito -0.27265, -79.57179 173
D. gracilis MHNG 1363.027 Ecuador Manabí Maicito -0.27265, -79.57179 173
D. gracilis QCAZ 4649 Ecuador Manabí Reserva Jama Coaque -0.11556, -80.12472 299
D. gracilis MHNG 2453.019 Ecuador Manabí Zapallo Grande 0.78165, -78.98345 100
D. gracilis QCAZ 14494 Ecuador Pichincha Cachaco–Lita 0.78886, -78.36794 1108
D. gracilis MZUTI 1386 Ecuador Pichincha El Abrazo del Árbol -0.00913, -78.81321 1064
D. gracilis QCAZ 7532 Ecuador Pichincha El Monte -0.06912, -78.76195 1316
D. gracilis QCAZ 15718 Ecuador Pichincha Finca Ecológica Orongo 0.15304, -78.66737 1173
D. gracilis MZUTI 3503 Ecuador Pichincha Mashpi lodge 0.16681, -78.88111 905
D. gracilis QCAZ 15542 Ecuador Pichincha Rainforest Monterreal 0.01557, -78.88407 860
D. gracilis QCAZ 7322 Ecuador Pichincha Road to Mindo -0.03116, -78.75617 1638
D. gracilis QCAZ 3693 Ecuador Santo Domingo 8.5 km NW Santo Domingo -0.17700, -79.21099 454
D. gracilis QCAZ 3694 Ecuador Santo Domingo 8.5 km NW Santo Domingo -0.17700, -79.21099 454
D. gracilis QCAZ 11238 Ecuador Santo Domingo Finca de Germán Cortez -0.00027, -79.41194 194
D. gracilis QCAZ 2040 Ecuador Santo Domingo La Perla 0.13417, -79.49432 132
D. gracilis DHMECN 129 Ecuador
D. gracilis MZUTI 4199 Ecuador
D. indica MZUA.RE.0059 Ecuador Morona Santiago Rosa de Oro
D. indica MHNG 2435.093 Ecuador Orellana Coca -0.46167, -76.99310 253
D. indica MHNG 2413.076 Ecuador Orellana Hacienda Primavera -0.48689, -76.63581 267
D. indica MZUTI 4735 Ecuador Pastaza Tzarentza -1.35696, -78.05814 1355
D. jamespetersi MZUA.RE.0147 Ecuador Azuay La Paz -3.31481, -79.15166 3148
D. jamespetersi MZUTI 5307 Ecuador Azuay Poetate -3.41645, -79.26964 2269
D. jamespetersi USNM 237040 Ecuador Loja 0.5 km E of Loja -3.99277, -79.18327 2263
D. jamespetersi MHNG 2512.047 Ecuador Loja 24 km S Loja -4.22083, -79.24164 1562
D. jamespetersi MHNG 2512.048 Ecuador Loja 24 km S Loja -4.22083, -79.24164 1562
D. jamespetersi MHNG 2399.071 Ecuador Loja 5 km E Loja -3.98899, -79.16576 2610
D. jamespetersi MHNG 2457.09 Ecuador Loja 5 km E Loja -3.98899, -79.16576 2610
D. jamespetersi MHNG 2512.049 Ecuador Loja 5 km E Loja -3.98899, -79.16576 2610
D. jamespetersi MHNG 2512.05 Ecuador Loja 5 km E Loja -3.98899, -79.16576 2610
D. jamespetersi MHNG 2521.087 Ecuador Loja 5 km E Loja -3.98899, -79.16576 2610
D. jamespetersi QCAZ 15100 Ecuador Loja Guachanamá -4.04081, -79.88290 2787
D. jamespetersi MHNG 2413.082 Ecuador Loja Loja -4.00789, -79.21128 2166
D. latifrontalis BMNH1946.1.20 Venezuela Mérida Aricagua 8.16162, -71.15776 1078
D. klebbai QCAZ 1605 Ecuador Napo 2 km E Borja -0.41543, -77.83032 1608
D. klebbai DHMECN 568 Ecuador Napo Borja -0.42624, -77.84277 1698
D. klebbai MHNG 2220.035 Ecuador Napo El Chaco -0.33763, -77.80957 1595
D. klebbai MHNG 2220.056 Ecuador Napo El Chaco -0.33763, -77.80957 1595
D. klebbai MHNG 2250.063 Ecuador Napo El Chaco -0.33763, -77.80957 1595
D. klebbai MHNG 2250.064 Ecuador Napo El Chaco -0.33763, -77.80957 1595
D. klebbai MZUTI 5412 Ecuador Napo Pacto Sumaco -0.66377, -77.59895 1556
D. klebbai MCZ 164674 Ecuador Napo Río Azuela -0.14869, -77.65463 1402
D. klebbai MCZ 164675 Ecuador Napo Río Azuela -0.14869, -77.65463 1402
D. klebbai USNM 286323 Ecuador Napo Río Azuela -0.14869, -77.65463 1402
D. klebbai MHNG 2220.038 Ecuador Napo San Rafael -0.09669, -77.58995 1464
D. klebbai MHNG 2220.039 Ecuador Napo San Rafael -0.09669, -77.58995 1464
D. klebbai MZUTI 63 Ecuador Napo Yanayacu -0.60042, -77.89053 2110
D. klebbai MHNG 2220.04 Ecuador Sucumbíos El Reventador -0.04480, -77.52858 1476
D. klebbai MHNG 2220.041 Ecuador Sucumbíos El Reventador -0.04480, -77.52858 1476
D. klebbai QCAZ 250 Ecuador Sucumbíos El Reventador -0.04669, -77.52898 1428
D. klebbai QCAZ 14281 Ecuador Sucumbíos La Bonita 0.47209, -77.54661 1953
D. klebbai MHNG 2529.029 Ecuador
D. klebbai ZSFQ D304 Ecuador Napo Cascada de San Rafael -0.10007, -77.58034 1182
D. georgejetti USNM 142595 Ecuador Guayas 10 mi N of Guayaquil -1.96418, -79.87988 5
D. georgejetti QCAZ 9125 Ecuador Guayas Cerro Blanco -2.17465, -80.02135 147
D. georgejetti ENS 12817 Ecuador Manabí 17 km NW Portoviejo -1.00209, -80.31334 187
D. georgejetti MZUTI 5411 Ecuador Manabí Cabuyal -0.19698, -80.29059 15
D. georgejetti QCAZ 10589 Ecuador Manabí El Aromo -1.04665, -80.83276 295
D. georgejetti DHMECN 11639 Ecuador Manabí Montecristi -1.04694, -80.65766 136
D. georgejetti MZUA.RE.0121 Ecuador Manabí El Aromo -1.04665, -80.83276 295
D. georgejetti MZUA.RE.0122 Ecuador Manabí El Aromo -1.04665, -80.83276 295
D. georgejetti DHMECN 11646 Ecuador Manabí Rocafuerte -0.92371, -80.45212 19
D. georgejetti ZSFQ D606 Ecuador Manabí Cerro La Mocora, foothill -1.59817, -80.65431 308
D. oligozonata MZUA.RE.0081 Ecuador Azuay Girón -3.15891, -79.14755 2102
D. oligozonata QCAZ 4472 Ecuador Azuay Granja Orgánica Susudel -3.38885, -79.17847 2802
D. oligozonata QCAZ 4492 Ecuador Azuay Susudel -3.40543, -79.18378 2376
D. oligozonata MZUA.RE.0240 Ecuador Azuay Via a Shaglli -3.19178, -79.39623 2891
D. oligozonata MZUA.RE.0020 Ecuador
D. oligozonata MZUA.RE.0357 Ecuador
D. oreas QCAZ 10140 Ecuador Azuay Luz María -2.68548, -79.40992 1661
D. oreas DHMECN 3478 Ecuador Azuay Naranjo Lanto -2.92628, -79.39963 1847
D. oreas DHMECN 7647 Ecuador Azuay Reserva Biológica Yunguilla -3.22684, -79.27520 1748
D. oreas DHMECN 7666 Ecuador Azuay Reserva Biológica Yunguilla -3.22684, -79.27520 1748
D. oreas MZUA.RE.0239 Ecuador Azuay San Rafael de Sharug -3.27311, -79.54543 1593
D. oreas MZUA.RE.0290 Ecuador Azuay San Rafael de Sharug -3.27311, -79.54543 1593
D. oreas QCAZ 9190 Ecuador Azuay Vía La Paz–Cuenca -3.09021, -79.00800 2726
D. oreas USNM 62797 Ecuador Chimborazo Pallatanga–Guayaquil -2.07459, -78.98123 1404
D. oreas USNM 62798 Ecuador Chimborazo Pallatanga–Guayaquil -2.07459, -78.98123 1404
D. oreas USNM 62800 Ecuador Chimborazo Pallatanga–Guayaquil -2.07459, -78.98123 1404
D. oreas DHMECN 10785 Ecuador El Oro Playa Limón -3.50096, -79.74701 816
D. oreas DHMECN 2572 Ecuador El Oro Reserva Buenaventura -3.65467, -79.76794 524
D. oreas MZUTI 3351 Ecuador El Oro Reserva Buenaventura -3.64882, -79.75640 898
D. oreas MZUTI 5415 Ecuador El Oro Reserva Buenaventura -3.63432, -79.74985 1048
D. oreas MZUTI 5418 Ecuador El Oro Reserva Buenaventura -3.63370, -79.75040 1068
D. oreas MHNG 2514.028 Ecuador Loja 33 km E San Pedro -3.97222, -79.25983 2493
D. oreas MHNG 2521.084 Ecuador Loja 6 km S Loja -4.03770, -79.19975 2144
D. oreas QCAZ 10068 Ecuador Loja Cazerío Balzones -4.01502, -80.01635 1346
D. oreas QCAZ 13875 Ecuador Loja Jimbura -4.66668, -79.45322 2513
D. oreas QCAZ 11290 Ecuador Loja Vía al Cerro Toledo -4.38444, -79.15992 2214
D. oreas QCAZ 678 Ecuador Loja Vilcabamba -4.25792, -79.21962 1546
D. oreas QCAZ 6020 Ecuador Loja Yangana–Vilcabamba -4.32455, -79.20041 1742
D. palmeri QCAZ 11411 Ecuador Morona Santiago 9 de Octubre–Macas -2.21820, -78.29920 1767
D. palmeri QCAZ 5609 Ecuador Morona Santiago Chiguinda -3.28125, -78.69829 2223
D. palmeri DHMECN 11197 Ecuador Morona Santiago Concesión ECSA -3.57524, -78.43609 1211
D. palmeri QCAZ 13307 Ecuador Morona Santiago Laguna Chimerella -2.07956, -78.20338 1795
D. palmeri QCAZ 13304 Ecuador Morona Santiago Laguna Cormorán -2.07153, -78.21590 1747
D. palmeri QCAZ 13562 Ecuador Pastaza Tzarentza -1.35696, -78.05814 1355
D. palmeri QCAZ 4710 Ecuador Tungurahua 3 km E Río Verde -1.40249, -78.28369 1474
D. palmeri AMNH 24126 Ecuador Tungurahua Abitagua -1.41667, -78.16667 1353
D. palmeri MZUTI 4804 Ecuador Tungurahua Agoyán -1.39795, -78.38415 1661
D. palmeri MZUA.RE.0044 Ecuador Tungurahua Baños -1.39650, -78.42945 1847
D. palmeri QCAZ 14071 Ecuador Tungurahua Baños -1.39650, -78.42945 1847
D. palmeri QCAZ 3288 Ecuador Tungurahua Baños -1.39650, -78.42945 1847
D. palmeri QCAZ 4710 Ecuador Tungurahua Caserío Machay -1.40062, -78.28085 1531
D. palmeri DHMECN 9229 Ecuador Tungurahua Chamanapamba -1.40114, -78.39975 1808
D. palmeri DHMECN 9230 Ecuador Tungurahua Chamanapamba -1.40114, -78.39975 1808
D. palmeri MZUTI 3956 Ecuador Tungurahua La Candelaria -1.43051, -78.31246 1920
D. palmeri AMNH 37939 Ecuador Tungurahua Palmera -1.41613, -78.19663 1225
D. palmeri DHMECN 9232 Ecuador Tungurahua Parque Juan Montalvo -1.40005, -78.42070 1803
D. palmeri QCAZ 13992 Ecuador Tungurahua Río Verde -1.39406, -78.30405 1603
D. palmeri QCAZ 4564 Ecuador Tungurahua Río Verde -1.39406, -78.30405 1603
D. palmeri DHMECN 12841 Ecuador Tungurahua Ulba -1.39622, -78.39418 1702
D. palmeri DHMECN 9219 Ecuador Tungurahua Vizcaya -1.34789, -78.40518 2282
D. palmeri QCAZ 6021 Ecuador Zamora Chinchipe 18.2 km W Zamora -3.97643, -79.02075 1609
D. palmeri QCAZ 3001 Ecuador Zamora Chinchipe 182 km Zamora–Loja -3.95600, -79.02599 1665
D. palmeri QCAZ 14338 Ecuador Zamora Chinchipe Estación San Francisco -3.96128, -79.05556 1775
D. palmeri QCAZ 12771 Ecuador Zamora Chinchipe Reserva Numbami -4.17233, -78.95928 1615
D. palmeri MZUTI 4971 Ecuador Zamora Chinchipe Reserva San Francisco -3.97051, -79.07814 1850
D. palmeri MZUTI 4975 Ecuador Zamora Chinchipe Reserva San Francisco -3.97140, -79.07909 1730
D. palmeri QCAZ 12772 Ecuador Zamora Chinchipe Reserva San Francisco -3.97051, -79.07814 1850
D. palmeri MZUTI 5419* Ecuador Zamora Chinchipe Romerillos Alto -4.23230, -78.94222 1547
D. palmeri QCAZ 12510 Ecuador Zamora Chinchipe Zumba -4.86517, -79.13384 1230
D. palmeri MZUA.RE.0119 Ecuador
D. palmeri BMNH 1946.1.2077 Peru Cajamarca Jaén -5.72978, -78.84836 1438
D. palmeri MCZ 17404 Peru Cajamarca Tabaconas -5.31429, -79.29622 1892
D. pavonina MZUA.RE.0198 Ecuador Morona Santiago Kushapuk -3.04373, -78.03648 326
D. pavonina QCAZ 5554 Ecuador Morona Santiago Tiink -3.34389, -78.46805 730
D. pavonina MHNG 2309.039 Ecuador Napo Archidona -0.90856, -77.80814 571
D. pavonina MHNG 2521.088 Ecuador Napo Tena -0.98330, -77.81670 522
D. pavonina MZUTI 4972 Ecuador Zamora Chinchipe Maycu -4.38030, -78.74584 981
D. peruana LSUMZ 27372 Peru Amazonas 28 km SE Ingenio -6.05753, -77.98919 2235
D. peruana KU 212590 Peru Amazonas Pomacochas -5.82155, -77.91692 2150
D. peruana MCZ 178175 Peru Cuzco Amaibamba -13.27703, -73.28636 1858
D. peruana LSUMZ 27369–70 Peru Cuzco Bosque Aputinye -12.92300, -72.67455 1502
D. peruana KU 117109 Peru Cuzco Machu Picchu -13.17104, -72.50585 2400
D. peruana AMNH 147037 Peru Cuzco Paucartambo Mirador -13.06972, -71.55527 1818
D. peruana AMNH 147037 Peru Cuzco Paucartambo Mirador -13.06972, -71.55527 1810
D. peruana USNM 60718 Peru Cuzco Pucyura -13.07450, -72.93437 2666
D. peruana CORBIDI 11839 Peru Cuzco Rocotal -13.10627, -71.57064 2004
D. peruana SMF 20801 Peru Cuzco Santa Ana -12.86755, -72.71670 1639
D. peruana LSUMZ 45499 Peru Huánuco Playa Pampa -9.95160, -75.69605 2091
D. peruana BMNH 1946.1.2078 Peru Pasco Huancabamba -10.42265, -75.51718 1775
D. peruana USNM 299232 Peru Puno 10 km NNE Ollachea -13.78330, -70.46730 2598
D. peruana USNM 299234 Peru Puno 11 km NNE Ollachea -13.78661, -70.47248 2601
D. peruana USNM 299233 Peru Puno 12 km NNE Ollachea -13.78330, -70.46730 2598
D. peruana AMNH 52444 Peru San Martín Cumbre Ushpayacu-Mishquiyacu -6.99468, -76.03371 1279
D. temporalis MZUTI 3331 Ecuador Esmeraldas Tundaloma Lodge 1.18317, -78.75245 74
D. temporalis MHNG 2521.083 Ecuador Imbabura 16 km W Lita 0.90235, -78.54504 799
D. vagrans AMNH 63373 Peru San Martín Bellavista -7.05346, -76.58928 316
D. vermiculata MHNG 2521.085 Ecuador Morona Santiago 69 km S Vilcabamba -4.84920, -79.12731 1310
D. vermiculata DHMECN 11197 Ecuador Morona Santiago Concesión ECSA -3.57245, -78.46982 790
D. vermiculata MHNG 2436.014 Ecuador Napo El Reventador -0.04480, -77.52858 1476
D. vermiculata MZUTI 5080 Ecuador Pastaza Kallana -1.469629, -77.27838 325
D. vermiculata QCAZ 13825 Ecuador Pastaza Sendero Higuerones -4.11464, -78.96702 981
D. vermiculata MZUTI 4738 Ecuador Pastaza Tzarentza -1.35696, -78.05814 1355
D. vermiculata MZUTI 3663 Ecuador Zamora Chinchipe Maycu -4.20719, -78.63987 869
D. vermiculata MZUA.RE.0261 Ecuador Zamora Chinchipe Nangaritza -4.43169, -78.63869 1011
D. oswaldobaezi QCAZ 14051 Ecuador El Oro Arenillas -3.62110, -80.17513 41
D. oswaldobaezi QCAZ 14060 Ecuador El Oro Guabillo -3.60346, -80.18139 44
D. oswaldobaezi MZUA.RE.0286 Ecuador El Oro Huaquillas -3.54115, -80.08646 39
D. oswaldobaezi QCAZ 10369 Ecuador Loja Quebrada El Faique -4.17889, -80.04226 1004
D. oswaldobaezi QCAZ 15108 Ecuador Loja Reserva La Ceiba-Pilares -4.27502, -80.32805 534
D. oswaldobaezi BMNH1935.11.3.108 Ecuador Loja Catamayo -3.98064, -79.35928 1289
D. oswaldobaezi MUSM 2192 Peru Piura Piura -5.17882, -80.62231 32
S. annulatus MZUTI 3034 Ecuador Esmeraldas Reserva Itapoa 0.51307, -79.13401 321
S. bevridgelyi MZUA.RE.0424 Ecuador Azuay 2 km N Palmales Nuevo -3.65158, -80.09625 129
S. bevridgelyi KU 152205 Ecuador Azuay 30 KM E Pasaje -3.31439, -79.57970 561
S. bevridgelyi QCAZ 14446 Ecuador Azuay Ponce Enríquez–El Coca -3.03197, -79.64615 1206
S. bevridgelyi QCAZ 14444 Ecuador Azuay Proyecto Minas San Francisco -3.30829, -79.47079 862
S. bevridgelyi MZUA.RE.0142 Ecuador Azuay Sarayunga -3.31431, -79.58069 552
S. bevridgelyi MCZ R-17099 Ecuador Chimborazo Valle del Chanchán -2.27383, -79.08735 697
S. bevridgelyi DHMECN 11526 Ecuador El Oro Remolino -3.56551, -79.91948 229
S. bevridgelyi DHMECN 9483 Ecuador El Oro Reserva Buenaventura -3.65467, -79.76794 524
S. bevridgelyi MZUTI 3269 Ecuador El Oro Reserva Buenaventura -3.65343, -79.76722 473
S. bevridgelyi MZUTI 5416 Ecuador El Oro Reserva Buenaventura -3.65467, -79.76794 524
S. bevridgelyi AMNH 22092 Ecuador Guayas Reserva Ayampe -1.65417, -80.81833 43
S. bevridgelyi MCZ R-3564 Ecuador Guayas Río Daule -1.87009, -80.00539 5
S. bevridgelyi MZUA.RE.0328 Ecuador Los Ríos Jauneche -1.33333, -79.58333 41
S. bevridgelyi DHMECN 8976 Ecuador Manabí San Sebastián -1.60002, -80.69974 602
S. bevridgelyi DHMECN 10061 Ecuador Manabí Puerto López -1.55598, -80.81200 3
S. bevridgelyi ZSFQ D503 Ecuador Manabí Cerro La Mocora, tophill -1.60379, -80.70191 818
S. bevridgelyi CORBIDI 3791 Peru Tumbes El Caucho -3.81438, -80.27101 379
S. bevridgelyi CORBIDI 3792 Peru Tumbes El Caucho -3.81438, -80.27101 379
S. bevridgelyi CORBIDI 7894 Peru Tumbes El Caucho -3.81844, -80.26856 478
S. bevridgelyi CORBIDI 7994 Peru Tumbes El Caucho -3.81244, -80.26716 481
S. nebulatus MZUTI 4810 Ecuador Cotopaxi El Jardín de los Sueños -0.83142, -79.21337 349
S. nebulatus DHMECN 9585 Ecuador Esmeraldas Canandé 0.52580, -79.20880 310
S. nebulatus DHMECN 5645 Ecuador Esmeraldas Lita–San Lorenzo 1.18236, -78.79528 42
S. nebulatus MZUTI 3911 Ecuador Esmeraldas Reserva Itapoa 0.51307, -79.13401 321
S. nebulatus DHMECN 5647 Ecuador Esmeraldas Tundaloma 1.18236, -78.75250 74
S. nebulatus DHMECN 10312 Ecuador Imbabura Selva Alegre 0.26667, -78.58333 1299
S. nebulatus USNM 285501 Ecuador Los Ríos Hacienda Cerro Chico -0.62444, -79.42940 170
S. nebulatus MZUA.RE.0174 Ecuador Los Ríos Macul -1.12980, -79.65730 65
S. nebulatus USNM 285498 Ecuador Los Ríos Río Palenque -0.58333, -79.36667 173
S. nebulatus USNM 285499 Ecuador Los Ríos Río Palenque -0.58333, -79.36667 173
S. nebulatus USNM 285500 Ecuador Los Ríos Río Palenque -0.58333, -79.36667 173
S. nebulatus DHMECN 2882 Ecuador Manabí Aguacate 0.65348, -80.05190 43
S. nebulatus MZUTI 5342 Ecuador Manabí Jama Coaque -0.11556, -80.12472 299
S. nebulatus DHMECN 1704 Ecuador Pichincha Curipogio 0.13112, -78.67632 1171
S. nebulatus USNM 283534 Ecuador Santo Domingo Rancho Santa Teresita -0.25277, -79.37946 288

Systematics of the Dipsas peruana complex

Based on differences in coloration and the topology of the molecular phylogeny obtained here (Fig. 3), we partition Dipsas peruana sensu Harvey and Embert (2008) into four allopatric species. This includes restriction of D. peruana to Peruvian-Bolivian populations, the resurrection of D. palmeri for populations ranging from northern Peru to central Ecuador, the description of a new species for northern Ecuador, and the resurrection of D. latifrontalis for populations in Colombia and Venezuela (Fig. 4).

Dipsas klebbai sp. n.

Figs 1l, m, 15, 16

Dipsas peruana Harvey & Embert, 2008: 79 (part).

Proposed standard English name

Klebba’s Snail-Eater

Proposed standard Spanish name

Caracolera de Klebba

Holotype

MZUTI 5412 (Figs 15, 16), adult male collected by Phillip Torres on April 28, 2016 at Pacto Sumaco, province of Napo, Ecuador (S0.66377, W77.59895; 1556 m).

Paratypes

DHMECN 568, adult female collected by Thomas Begher on 1980 at Borja, province of Napo, Ecuador (S0.42054, W77.84104; 1717 m). MCZ 164674–75, two adults of undetermined sex collected by Giovani Onore on June 01, 1983 at Río Azuela, province of Napo, Ecuador (S0.148693, W77.65463; 1402 m). MHNG 2220.035, 2220.056, 2250.063, 2250.064, one juvenile female and three adult males, respectively, collected by Giovani Onore on 1984 at El Chaco, province of Napo, Ecuador (S0.33763, W77.80957; 1595 m). MHNG 2220.038–039, adult female and adult male, respectively, collected by Giovani Onore on November 1984 at San Rafael, province of Napo, Ecuador (S0.09669, W77.58995; 1464 m). MHNG 2220.04, 2220.041, adult females collected by Giovani Onore on May 1984 at El Reventador, province of Napo, Ecuador (S0.04480, W77.52858; 1476 m). MZUTI 63, adult male collected by Alejandro Arteaga on August 08, 2011 at Yanayacu, province of Napo, Ecuador (S0.60042, W77.89053; 2110 m). MNHG 2529.029, adult female collected by Eugen Kramer on February 22, 1992 at Napo province, Ecuador. QCAZ 12488, collected by Pablo Medrano on March 02, 2015 at Río Quijos, province of Napo, Ecuador (S0.45224, W77.94249; 1929 m). QCAZ 12600, collected by Pablo Medrano on March 27, 2014 at Santa Rosa, province of Napo, Ecuador (S0.39630, W77.82343; 1113 m). QCAZ 13124, collected by Fabián Vallejo on November 21, 2014 at Las Palmas, province of Napo, Ecuador (S0.54691, W77.87762; 1903 m). QCAZ 14281, adult male collected by Andrea Narváez on December 02, 2016 at La Bonita, province of Sucumbíos, Ecuador (N0.47209, W77.54661; 1953 m). QCAZ 1496, collected on October 18, 1992 at Sardinas, province of Napo, Ecuador (S0.38484, W77.83782; 1641 m). QCAZ 1605, adult male collected by Victor Utreras on February 04, 1992 at 2 km E Borja, province of Napo, Ecuador (S0.41543, W77.83032; 1608 m). QCAZ 250, adult male collected at El Reventador, province of Napo, Ecuador (S0.04480, W77.52858; 1476 m). QCAZ 358–59, collected on January 10, 1984 at Cascada de San Rafael, province of Napo, Ecuador (S0.10354, W77.58337; 1246 m). QCAZ 4500, collected by Estefanía Boada on August 01, 2011 at Hostería Cumandá, province of Napo, Ecuador (S0.45249, W77.88071; 1856 m). QCAZ 9696, collected by Steven Poe on August 04, 2009 at 2.3 km N of turnoff to Baeza, province of Napo, Ecuador (N0.45236, W77.88212; 1840 m). USNM 386323, adult female collected on February 24, 1979 at Río Azuela, province of Napo, Ecuador (S0.148693, W77.65463; 1402 m). ZSFQ D304, female collected by Jean-Marc Touzet and Diego F. Cisneros-Heredia at Cascada de San Rafael, province of Napo, Ecuador (S0.10007, W77.58034; 1182 m).

Diagnosis

Dipsas klebbai is placed in the genus Dipsas based on phylogenetic evidence (Fig. 3), and the absence of a labial that is noticeably higher than other labials and in contact with the postocular, primary and secondary temporals. The species differs from all described species of Dipsas based on the following combination of characters: (1) 15/15/15 smooth dorsals with enlarged vertebral row (1.5–1.8 times as wide as adjacent rows); (2) one loreal and one preocular in contact with orbit; (3) 9–11 supralabials with (usually) 4th to 6th contacting orbit; (4) one pair of infralabials in contact behind symphysial; (5) 181–201 ventrals in males, 187–194 in females; (6) 99–123 divided subcaudals in males, 98–106 in females; (7) dorsal and ventral ground color light brown with various degrees of fine black speckling and 27–36 dark brown to black, cream-edged oblong blotches that are longer that interspaces and become smaller towards the tail (Fig. 2m, n); on first half of body, the dark bands meet ventrally to form full body rings; on second half they fail to meet ventrally; head black with different degrees of whitish edging on the labial scales, and a thin (1–2 scales long) cream to light brown irregular nuchal collar; dorsal blotches usually incomplete ventrally, extending far onto ventrals and occasionally fusing midventrally; cream edges of neighboring blotches fused in first 6–9 blotches; (8) 401–749 mm SVL in males, 525–630 mm in females; (9) 169–330 mm TL in males, 209–240 mm in females.

Figure 9. 

Adult male holotype of Dipsas bobridgelyi. MZUTI 5417.

Figure 10. 

Adult male holotype of Dipsas bobridgelyi. MZUTI 5417. Scale bar: 1 cm.

Comparisons

Dipsas klebbai is compared to species previously subsumed under D. peruana: D. latifrontalis, D. palmeri, and D. peruana. From D. latifrontalis (Fig. 1n) and D. palmeri (Figs 1r, s), it differs in having longer oblong to rectangular body blotches up to 7–13 vertebral scales long (vs. fewer than 8 vertebral scales long in D. latifrontalis and D. palmeri) that are also longer than the interspaces (Fig. 1l, m). Specimens of D. klebbai can be separated from specimens of D. peruana, with the exception of BMNH 1946.1.2078, based on the presence of the following characteristics (condition of D. peruana in parentheses): posterior body blotches twice to four times as long as interspaces (vs. posterior body blotches ca. equal in length or marginally longer than interspaces); interspaces never completely obscured by black pigment (vs. completely melanized in some specimens); dorsal surface of head black (vs. dark brown with dingy cream reticulations); dorsal body blotches fused ventrally on the first half of the body (vs. rarely fused); longest body blotch at least 7 vertebral scales long (vs. longest body blotch 4–7 vertebral scales long). Genetic divergence in a 684 bp long fragment of the mitochondrial Cytb gene between D. klebbai and D. palmeri is 8.2–9.2%, whereas intraspecific distances are less than 1.1% in both species. For the same fragment, the distance between D. klebbai and D. peruana is 10.7–11.0%.

Description of holotype

Adult male, SVL 608 mm, tail length 262 mm (43% SVL); head length 20.3 mm (3% SVL) from tip of snout to commissure of mouth; head width 12.7 mm (62% head length) taken at broadest point; snout-orbit distance 5.4 mm; head distinct from neck; snout short, blunt in dorsal and lateral outline; rostral 4.0 mm wide, broader than high; internasals 2.6 mm wide, as broad as long; prefrontals 3.9 mm wide, broader than long, excluded from entering orbit by preocular; supraocular 4.3 mm long, broader than long; frontal 4.5 mm long, hexagonal, in contact with prefrontals, supraoculars, and parietals; parietals 6.6 mm long, longer than broad; nasal divided, in contact with first two supralabials, loreal, prefrontal, internasal, and rostral; loreal 2.6 mm long, slightly longer than high, entering orbit; eye diameter 4.5 mm; pupil semi-elliptical; one preocular; two postoculars; temporals 2+2; ten supralabials, 5th and 6th contacting orbit; symphysial separated from chinshields by the first pair of infralabials; 14 infralabials, 2–7 contacting chinshields; anterior pair of chinshields longer than broad, posterior pair broader than long; dorsal scales in 15/15/15 rows, smooth, without apical pits; 188 ventrals; 116 divided subcaudals; cloacal plate single.

Natural history

At night (21h53–02h13), specimens of Dipsas klebbai have been found active during or after light rain on arboreal vegetation 50–500 cm above the ground in a variety of environments ranging from primary montane cloud forests and evergreen montane forests to silvopastures and forest borders, occasionally close to rivers. By day, individuals have been found hidden underground in pastures or among shrubs in rural gardens, or coiled on leaves at 300 cm above the ground. At dusk, after warm days, individuals of Dipsas klebbai have been seen crossing roads. QCAZ 13124 laid six eggs on December 2014. Five eggs were found inside a rotten trunk at El Chaco, province of Napo Ecuador.

Distribution

Endemic to the eastern slopes of the Ecuadorian Andes in the provinces of Napo and Sucumbíos at elevations between 1246 and 2120 m (Fig. 4).

Etymology

Named after Casey Klebba, in recognition of his appreciation of and passion for Andean wildlife, and his invaluable support of AA’s field expeditions to remote areas of Ecuador. After a visit to Peru in 2011, Casey became an active supporter of conservation and scientific projects in Ecuador.

Conservation status

All known localities of occurrence for Dipsas klebbai fall within the limits or within the buffer zone of the following protected areas: Parque Nacional Cayambe Coca, Parque Nacional Sumaco Napo Galeras, Reserva Ecológica Antisana, and Reserva Ecológica Cofán Bermejo. Furthermore, the species is common in degraded environments, which suggests a degree of tolerance for habitat modification. For these reasons, and because it does not meet the criteria (IUCN 2001) for qualifying in a threatened category, we here list it as Least Concern following IUCN guidelines.

Remarks

In their revision of Dipsas peruana, Harvey and Embert (2008) included specimens of D. klebbai. However, they found no characters that could diagnose these specimens from the rest of Ecuadorian and Peruvian specimens of D.peruana” in order to establish species boundaries. They also grouped the then valid D. boettgeri, D. latifrontalis, and D. polylepis under D. peruana. The authors were right to point out that the different populations cannot be separated based on characters of lepidosis. However, they did not include molecular data in their analyses, and also failed to notice the geographically structured differences in the length of the body blotches and their relationship to the length of the interspaces.

Figure 11. 

Adult male holotype of Dipsas georgejetti. MZUTI 5411.

Figure 12. 

Adult male holotype of Dipsas georgejetti. MZUTI 5411. Scale bar: 1 cm.

Dipsas palmeri (Boulenger, 1912)

Fig. 1r, s

Leptognathus palmeri Boulenger, 1912: 422. Holotype BMNH, a male from El Topo, province of Tungurahua, Ecuador.

Leptognathus latifasciatus Boulenger, 1913: 72. Holotype BMNH 1946.1.2007, a juvenile male from Upper Marañón, department of Cajamarca, Peru.

Dipsas peruana Harvey & Embert, 2008: 79 (part).

Proposed standard English name

Palmer’s Snail-Eater

Proposed standard Spanish name

Caracolera de Palmer

Diagnosis

Dipsas palmeri differs from all described species of Dipsas based on the following combination of characters: (1) 15/15/15 smooth dorsals with enlarged vertebral row; (2) one loreal and one preocular in contact with orbit; (3) 8–10 supralabials with (usually) 4th to 6th contacting orbit; (4) one pair of infralabials in contact behind symphysial; (5) 172–202 ventrals in males, 181–200 in females; (6) 91–118 divided subcaudals in males, 86–102 in females; (7) dorsal and ventral ground color light brown with various degrees of fine black speckling and with 32–41 brown to blackish, white-edged circular blotches that are longer than interspaces in the first half of the body, but shorter in the second half (Figs 1r, s); adult head gray with different degrees of whitish edging on the labial scales, and a thin (1–2 scales long) white to light grayish brown irregular parietal collar; dorsal blotches incomplete ventrally, extending marginally onto ventrals but not fusing midventrally; (8) 215–907 mm SVL in males, 642–1187 mm in females; (9) 78–390 mm TL in males, 246–298 mm in females.

Comparisons

Dipsas palmeri is compared to species previously subsumed under D. peruana: D. latifrontalis, D. klebbai (Fig. 1l, m), and D. peruana. From D. latifrontalis (Fig. 1n), it differs in having the first 19–35 dorsal blotches edged with white or cream, vs. the first 9–10 in D. latifrontalis. The only known adult of D. latifrontalis photographed in life has bronze interspaces (Fig. 1n), a coloration not seen in any adult of D. palmeri. From D. klebbai, it differs in having shorter blotches (longest blotch up to 3–7 vertebral scales long) that are circular (instead of oblong) and that are only longer than the interspaces on the first half of the body. From D. peruana, it differs in having dorsal blotches that are shorter than interspaces on posterior half of the body, and in lacking melanized interspaces in adult individuals.

Distribution

Eastern slopes of the Ecuadorian and Peruvian Andes south of the Jatunyacu–Napo river valley in Ecuador and north of the Huancabamba depression at elevations between 1211 and 2282 m (Fig. 4).

Conservation status

An estimated 31 out of the 42 known localities of occurrence for Dipsas palmeri are located within the limits or the buffer area of the following protected areas: Bosque Protector del Alto Nangaritza, Parque Nacional Llanganates, Parque Nacional Podocarpus and Parque Nacional Sangay. Furthermore, the presence of the species in degraded environments suggests a degree of tolerance for habitat modification. For these reasons, and because it does not meet the criteria for qualifying in a threatened category, we here list it as Least Concern following IUCN guidelines.

Remarks

Neither Peters (1960) nor Harvey and Embert (2008) recognized the geographic morphological distinctiveness of Dipsas palmeri from Ecuador and Peru. Certainly, D. palmeri is most similar in coloration and lepidosis to D. latifrontalis (Fig. 1n) from Venezuela, and that is why Peters considered them synonyms. However neither Peters (1960) nor Harvey and Embert (2008) saw live specimens of D. latifrontalis in order to recognize the differences in life color pattern between the two species.

Two other junior synonyms of Dipsas peruana are D. latifasciata and D. polylepis, both of which occur in Peru (Fig. 4). Of these, only the latter must remain a synonym of D. peruana; the former should be transferred to the synonymy of D. palmeri, as defined here. Examination of photographs of the specimen of D. latifasciata (BMNH 1946.1.2077) reveals this species has dorsal blotches shorter than interspaces on posterior half of the body, a character seen in D. palmeri but not in D. peruana. The holotype was collected by A. E. Pratt in “Upper Marañón”, with no further specific locality mentioned. However, the type locality can be restricted to the immediate environs of the town of Jaén, as the “Upper Marañón” is considered the segment of the Marañón river that goes from the town of Jaén until the river meets the Santiago River. Additionally, in a letter to his wife in 1913, the explorer explains how he crossed the Ecuadorian Andes and arrived at the town of Jaén in northern Peru, where he stayed and collected specimens for the BMNH before proceeding to Iquitos along the Marañón river, with no mention of visiting any locality east of the river at elevations where D. palmeri and D. peruana are known to occur. Harvey and Embert (2008) pointed out that the Huancabamba depression could be a geographic barrier separating species within the D. peruana complex, but they did not find evidence to support this view. Our results suggest that the Huancabamba depression is a major geographic barrier separating D. palmeri (north) from D. peruana (south).

Dipsas peruana (Boettger, 1898)

Leptognathus peruana Boettger, 1898: 128. Holotype SMF 20801, a female from Santa Ana, department of Cuzco, Peru.

Leptognathus boettgeri Werner, 1901: 11. Holotype MTKD D 1671 M, a female from Chanchamayo, department of Junín, Peru.

Leptognathus boliviana Werner, 1909: 240. Holotype ZMH, a female from department of Beni, Bolivia.

Leptognathus polylepis Boulenger, 1912: 422. Holotype BMNH 1946.1.2078, a female from Huancabamba, department of Pasco, Peru.

Proposed standard English name

Peruvian Snail-Eater

Proposed standard Spanish name

Caracolera Peruana

Diagnosis

Dipsas peruana differs from all described species of Dipsas based on the following combination of characters: (1) 15/15/15 smooth dorsals with moderately enlarged vertebral row; (2) one loreal and one preocular in contact with orbit; (3) 8–9 supralabials with 4–6 or 3–5 contacting orbit; (4) one pair of infralabials in contact behind symphysial; (5) 177–200 ventrals in males, 180–203 in females; (6) 75–127 divided subcaudals in males, 79–105 in females; (7) dorsal and ventral ground color brown to dark brown (light brown in juveniles) with 33–43 blackish brown to complete black, white to cream edged circular to vertically elliptical blotches that are longer than interspaces; head dark brown with dingy cream reticulations and different degrees of whitish edging on the labial scales, and a thin (1–3 scales long) white to light grayish brown irregular nuchal collar; dorsal blotches extending marginally onto ventrals and rarely fusing midventrally; (8) 199 mm SVL in males, 610–725 mm in females; (9) 85 mm TL in males, 155–241 mm in females.

Comparisons

Dipsas peruana sensu stricto is compared to species previously subsumed under D. peruana sensu lato: D. latifrontalis, D. palmeri, and D. klebbai. From D. latifrontalis and D. palmeri, it differs in having dorsal blotches along the entire body similar in length or longer than interspaces (shorter than interspaces in D. latifrontalis and D. palmeri), and in having melanized interspaces in some adult individuals. With the exception of BMNH 1946.1.2078, specimens of D. peruana can be separated from specimens of D. klebbai by possessing at least one of the following characteristics: posterior body blotches similar in length or marginally longer than interspaces (twice to four times as long in D. klebbai); short circular to vertically elliptical body blotches usually only up to 4–7 vertebral scales long; melanized interspaces; dorsal surface of the head not completely black; and dorsal body blotches rarely fused ventrally.

Distribution

Eastern slopes of the Peruvian and Bolivian Andes south of the Huancabamba depression at elevations between 1279 and 2671 m (Fig. 4).

Figure 13. 

Adult female holotype of Dipsas oswaldobaezi QCAZ 10369 in a dorsal and b ventral view. Scale bar: 1 cm.

Figure 14. 

Adult female paratype of Dipsas oswaldobaezi. QCAZ 15108.

Dipsas latifrontalis (Boulenger, 1905)

Leptognathus latifrontalis Boulenger, 1905: 561. Holotype BMNH 1946.1.20.98, a female from Aricagua, state of Mérida, Venezuela.

Dipsas peruana Harvey & Embert, 2008: 79 (part).

Proposed standard English name

Broad-fronted Snail-Eater

Proposed standard Spanish name

Caracolera frentona

Diagnosis

Dipsas latifrontalis differs from all described species of Dipsas based on the following combination of characters: (1) 15/15/15 smooth dorsals with moderately enlarged vertebral row; (2) one loreal and one preocular in contact with orbit; (3) 8–10 supralabials with 3rd to 6th contacting orbit; (4) one pair of infralabials in contact behind symphysial; (5) 192 ventrals in one male (CVULA 7883), 194 in the female holotype; (6) 109 divided subcaudals in the single male, 95 in the female holotype; (7) dorsal and ventral ground color bronze (light brown in juveniles) with 32–36 dark reddish brown to black, circular to vertically elliptical blotches that are longer than interspaces and white to cream edged on first half of body; head grayish brown to black with different degrees of whitish edging on the labial scales, and with or without a thin (1–2 scales long) dingy white irregular nuchal collar; dorsal blotches extending marginally onto ventrals and occasionally fusing on the anterior part of the body; (8) 800 mm SVL in the holotype female; (9) 220 mm TL in the holotype female.

Comparisons

Dipsas latifrontalis is compared to species previously subsumed under D. peruana: D. palmeri, D. peruana, and the herein described D. klebbai. From D. palmeri, it differs in having the first 9–10 dorsal blotches edged with white or cream, vs. the first 19–35 in D. palmeri. The only known adult of D. latifrontalis photographed in life has bronze interspaces (Fig. 1n), a coloration not seen in any adult of D. palmeri (see also Remarks below). From D. klebbai, it differs in having shorter blotches (longest blotch up to 6–8 vertebral scales long) that are circular (instead of oblong) and that are only longer than the interspaces on the first half of the body. From D. peruana, it differs in having dorsal blotches in posterior half of the body shorter than interspaces, and in lacking melanized interspaces in adult individuals.

Distribution

Known only from two localities in the Venezuelan Andes and one in the Northern Colombian Andes at elevations between 1000 and 1400 m (Fig. 4).

Remarks

Neither Peters (1960) nor Harvey and Embert (2008) examined the holotype of Dipsas latifrontalis, and they used Boulenger (1905) description to assign specimens of D. palmeri and D. peruana, respectively, to D. latifrontalis. We examined pictures of the holotype of D. latifrontalis from the BMNH, provided to us by César L. Barrio-Amorós. In coloration, the holotype is nearly identical to the uncollected adult presented in Figure 1n (San Isidro, Barinas province, Venezuela), with faint cream edging restricted to blotches 1–9, and indistinct blotches on the posterior part of the body. The previously only known photograph of a D. latifrontalis is of a juvenile from the same location as the specimen in Figure 1n (Rivas et al. 2012).

All Dipsas latifrontalis depicted in Lotzkat et al. (2008) and Natera-Mumaw et al. (2015) refer to a different species related to the D. incerta group, except for the holotype of D. latifrontalis BMNH 1946.1.20.98 (formerly 1905.5.31.76).

Figure 15. 

Adult male holotype of Dipsas klebbai. MZUTI 5412.

Figure 16. 

Adult male holotype of Dipsas klebbai. MZUTI 5412. Scale bar: 1 cm.

Discussion

Higher-level relationships within Dipsadini are still far from being resolved. The monotypic Plesiodipsas perijanensis was not included in our analysis or other recent molecular phylogenies. The species of Dipsas+Sibynomorphus and Sibon included here form monophyletic groups, but this is not the case for the genus Tropidodipsas, for which T. sartorii and T. fasciata + T. fischeri are the successive sister lineages of Dipsas+Sibynomorphus and Sibon (Fig. 3). This arrangement mirrors the results of Sheehy’s (2012) unpublished PhD thesis, which presented evidence that groups consisting of T. sartorii, T. annulifera, T. fischeri, T. philippii, and T. fasciatus, as well as several new species of Tropidodipsas were not each other’s closest relatives, and some merited recognition as distinct genera. Sheehy (2012) also presented phylogenetic evidence that Sibon sanniolus and Dipsas gaigeae do not belong to their nominal genera. Instead, each is more closely related to Tropidodipsas sensu stricto (D. gaigeae) or “T.sartorii + Geophis + “T.annulifera (S. sanniolus) than any species of Dipsas or Sibon.

Decades ago, Parker (1926) and Smith and Taylor (1945) suggested that Sibynomorphus and Dipsas were synonyms. More recently, Zaher et al. (2009), Grazziotin et al. (2012), and Sheehy (2012) recognized that Dipsas is paraphyletic with respect to Sibynomorphus, a conclusion we corroborate based on the results of our ML molecular phylogeny. In fact, members of former Sibynomorphus fall into four different clades across the phylogeny of Dipsas. In general, we suggest that the former Sibynomorphus species represent cases of convergent evolution; apparently from within several independent Dipsas clades or they represent an ancient morphotype successfully persisting through today.

Additionally, many traditional infrageneric groups are either non-monophyletic, or poorly supported and weakly placed. We recognize that this may reflect inadequate sampling of taxa (only 43 of 77 species are included) or characters (only four mtDNA and one nuclear locus were used). From the eight Dipsas species groups recognized by Harvey (2008) (Table 1), we only found phylogenetic support for the D. articulata and D. indica species groups. Two groups of species that are monophyletic in our molecular phylogeny and are similar in coloration and lepidosis are: 1) D. georgejetti + D. oligozonata + D. oswaldobaezi + D. williamsi, and 2) D. klebbai + D. palmeri + D. peruana. The sampled members of the D. oreas group are monophyletic if D. andiana is placed in this group, as it is the strongly supported (in both BI and ML analyses) sister taxon of D. oreas. We therefore place D. andiana in the D. oreas group and propose that the same be done for the morphologically similar D. nicholsi from Panama.

Dipsas bobridgelyi is most similar in coloration to D. gracilis (Fig. 1h, i). These species are recovered as sister taxa in our phylogenetic analyses (Fig. 3) and have non-overlapping, but adjacent distribution ranges in western Ecuador (Fig. 4). This scenario suggests a parapatric speciation event, as the distribution of D. gracilis is congruent with Chocoan evergreen forest in northwestern Ecuador whereas the distribution of D. bobridgelyi is congruent with Tumbesian semi-deciduous forests in southwestern Ecuador.

Although we did not examine MUSM 17589 from Tumbes department, Peru, the description of the coloration and head scales of this specimen provided by Cadle (2005) and Harvey (2008) suggests that it is a Dipsas bobridgelyi, rather than a D. gracilis, as was originally suggested by both authors before the description of D. bobridgelyi herein. There is no other voucher of D. gracilis from Peru and it is unlikely that two morphologically and phylogenetically, and likely also ecologically very close species, occur in sympatry. Hence, from a biogeographic perspective, we suggest D. gracilis does not occur in Peru and that all specimens from south of the southern limit of D. gracilis in southwestern Ecuador and adjacent northwestern Peru represent D. bobridgelyi.

Peters (1960) recognized a geographic morphological structure within the widely distributed Sibon nebulatus when he defined the subspecies nebulatus, leucomelas, hartwegi, and popayanensis. Here, our genetic results corroborate that S. nebulatus leucomelas from Ecuador and S. nebulatus hartwegi are distinct from the two Central American samples from Belize and northeastern Costa Rica, a divergence already put forward by Sheehy (2012). Yet, S. nebulatus is paraphyletic with respect to both S. dunni and S. bevridgelyi, which group with S. nebulatus leucomelas from Ecuador. Elevation of the two subspecies S. nebulatus leucomelas and S. nebulatus hartwegi to full species status would resolve this paraphyly. However, we refrain from taking this step because our sample size for S. nebulatus hartwegi is small, even though plenty of photographic data from references (e.g., Natera-Mumaw et al. 2015) and online sources confirm that long nuchal bands and often brownish color pattern are typical of S. nebulatus hartwegi occurring from Medellin, Colombia, east into Venezuela. In addition, the supposedly diagnostic darker ground color of S. nebulatus leucomelas with copious blackish stippling of the interspaces and head (Peters 1960) is not exclusive of this subspecies. There is ample evidence (photographic vouchers, preserved specimens, online photo sources) that this color pattern is rather consistent in S. n. nebulatus from Nicaragua through Panama, and can even be observed in single specimens as far as the northern limit of the species in Mexico. Furthermore, we have no genetic data of S. nebulatus from southern Costa Rica, Panama, and Colombia, which could confirm a clear split between two species, rather than a gradient of two intergrading subspecies.

Sibon bevridgelyi and S. nebulatus leucomelas were not recovered as sister taxa in our phylogenetic analyses (Fig. 3), despite being similar in coloration and lepidosis, and having adjacent marginally overlapping distribution ranges in western Ecuador (Fig. 8), a pattern that would suggest an allopatric speciation event. Our phylogeny suggests a more complex scenario that includes S. dunni from the dry valley of the Mira River in northwestern Ecuador. In any case, the three species are segregated geographically in western Ecuador, with S. n. leucomelas occupying the evergreen lowland and forest of northwestern Chocoan Ecuador, S. bevridgelyi the semi-deciduous forest in southwestern Ecuador, and S. dunni dry montane shrublands. Whether the current low genetic divergence between these three taxa constitutes a scenario of recent or ongoing gene flow between them is worth addressing further using nuclear markers. Strong local selection may have affected traits other than the mitochondrial genes.

Unlike the previous examples, the pattern of cladogenesis recovered in our phylogeny for the species of the Dipsas peruana complex (Fig. 3) suggest that a series of allopatric speciation events could be responsible for the current observed pattern of geographic genetic divergence between D. peruana and D. palmeri + D. klebbai. Two geographic barriers (i.e., Napo and Marañón rivers; Fig. 4) are located between the geographic ranges of the aforementioned species, and these features of the Andean geography have previously been recognized as important barriers to gene flow (Hackett 1993, Funk et al. 2007, Lynch Alfaro et al. 2015).

A different scenario of speciation can be interpreted from the current distribution (Fig. 5) of the clade comprised by Dipsas georgejetti, D. oligozonata, D. oswaldobaezi, and D. williamsi. All of these species are adapted to dry shrublands, and the distribution of this vegetation type in northern Peru and south-central Ecuador is not continuous. We hypothesize that the discontinuity of dry shrubland west of the Andes in Ecuador and Peru is what explains best the observed pattern of geographic genetic divergence in this group of snakes.

We suspect that there are numerous additional species to be described across all genera of Dipsadini. Our results and the results of other recent researchers such as Sheehy (2012) indicate that additional taxonomic changes are also needed at the species-group and genus level to create a robust, stable taxonomy that agrees with the molecular phylogeny. Other morphological data such as visceral topology (e.g., Wallach 1995) suggest that morphological synapomorphies may exist for these clades, but are complex and difficult to identify accurately. Hence, in order to clarify species richness and higher-level to detailed relationships in Dipsadini, a systematically intensive revision that includes genetic, biogeographic, and morphological data from the greatest number of species representing the known genera is needed.

Author contributions

Conceived and designed the work: AA JMG DSV OTC. Performed the analyses: AA RAP NP. Gathered morphological data: AA KM GA JCSN TJC RAP DSV DFCH PJV MYM OTC. Contributed reagents/materials/analysis tools: RAP JMG DSV NP GRC PJV TJC DFCH. Wrote the paper: AA DSV KM NP GA JCSN RAP DFCH PJV MYM JMG OTC.

Acknowledgments

This article was greatly improved by comments of Robert Jadin, Sebastian Lotzkat, and one anonymous reviewer. For granting access to their protected forests, we are grateful to Martin Schaefer and David Agro of Fundación Jocotoco, Ana Cristina de la Torre of Pacoche Lodge, Andrés Chiriboga of Tundaloma Lodge, and Renzo Paladines of Naturaleza y Cultura Internacional. Special thanks to Lucas Bustamante, Jose Vieira, Gabriela Morales, Melissa Costales, Frank Pichardo, Sebastián Di Doménico, Jorge Castillo, James Muchmore, Matthijs Hollanders, Paulina Romero, Aaron Pomerantz, Phil Torres, Ernesto Arbeláez, Fausto Siavichay, Diego Piñán, Carlos Morochz, Hannah Som, Carlos Gómez, Carlos Londoño, Valentina Rubio, Darwin Núñez, and Abel Batista for their assistance and companionship in the field. For providing ecological information about Sibon bevridgelyi, we are grateful to Jose Manuel Falcón. For providing live images of Dipsas and Sibon, we are grateful to Jose Vieira, Sebastián Di Doménico, Frank Pichardo, Matthijs Hollanders, Lucas Bustamante, Daniel Quihua, Luis Vera, Alessandro Catennazi, and Juan Carlos Chaparro. For providing images of preserved specimens, we are grateful to Gustavo Pazmiño, Diego Quirola, César Barrio, Micaela Stacey, Luke Welton, Jackson Roberts, and Joseph Martinez. For granting access to specimens under their care, we are grateful to Andreas Schmitz (MHNG), Christopher Raxworthy and Frank Burbrink (AMNH), and Kevin de Queiroz, Addison Wynn, Rayna Bell, and Kenneth Tighe (USNM). Fieldwork was made possible with the support of Tropical Herping, Universidad Tecnológica Indoamérica, Pontificia Universidad Católica del Ecuador and Secretaría de Educación Superior, Ciencia, Tecnología e Innovación (SENESCYT). Laboratory work was carried out at Universidad Tecnológica Indoamérica and Pontificia Universidad Católica del Ecuador in Quito. Sequencing was made possible with support of the George Washington University, Universidad Tecnológica Indoamérica, the U.S. National Science Foundation (DBI-0905765 and DEB-1441719 to RAP), Universidad Tecnológica Indoamérica (Principal investigators: JMG and DSV), and Pontificia Universidad Católica del Ecuador and SENESCYT under the ‘Arca de Noé’ Initiative (principal investigators: S.R. Ron and OTC). TJC would like to thank SEMANART and the Mexican National Commission of National Protected Areas for granting collection permits (SPGA/DGVS/05912/12 and SPGA/DGVS/12101/14) and Operation Wallacea and the University of Mississippi Graduate College for funding.

References

  • Aleman C (1953) Apuntes sobre reptiles y anfibios de la region Baruta-El Hatillo. Memoria de la Sociedad de Ciencias naturales La Salle 12: 11–30.
  • Arévalo E, Davis SK, Sites JW (1994) Mitochondrial DNA-sequence divergence and phylogenetic relationships among eight chromosome races of the Sceloporus grammicus complex (Phrynosomatidae) in Central Mexico. Systematic Biology 43: 387–418. https://doi.org/10.1093/sysbio/43.3.387
  • Arteaga A, Bustamante L, Guayasamin JM (2013) The amphibians and reptiles of Mindo. Universidad Tecnológica Indoamérica, Quito, 257 pp.
  • Beaupre SJ, Jacobson ER, Lillywhite HB, Zamudio K (2004) Guidelines for Use of Live Amphibians and Reptiles in Field and Laboratory Research. American Society of Ichthyologists and Herpetologists, Lawrence, 43 pp.
  • Bocourt MF (1884) Note sur quelques ophidiens nouveaux, provenant de l’Amerique inter-tropicale. Bulletin de la Société Philomathique de Paris 8: 133–142.
  • Boettger O (1898) Katalog der Reptilien-Sammlung im Museum der Senckenbergischen Naturforschenden Gesellschaft in Frankfurt. Gebr. Knauer, Frankfurt, 140 pp.
  • Boulenger GA (1885) Second list of reptiles and batrachians from the province Rio Grande do Sul, sent to the Natural History Museum by Dr. H. van Ihering. Annals and Magazine of Natural History 16: 85–88.
  • Boulenger GA (1894) Catalogue of the snakes in the British Museum (Natural History), Volume II. Trustees of the British Museum, London, 382 pp.
  • Boulenger GA (1896) Catalogue of the snakes in the British Museum (Natural History). Volume III. Trustees of the British Museum, London, 727 pp.
  • Boulenger GA (1911) Descriptions of new reptiles from the Andes of South America, preserved in the British Museum. The Annals and Magazine of Natural History 7: 19–25. https://doi.org/10.1080/00222931108692903
  • Boulenger GA (1912) Descriptions of new reptiles from the Andes of South America, preserved in the British Museum. Annals and Magazine of Natural History 10: 420–424. https://doi.org/10.1080/00222931208693255
  • Cadle JE (2005) Systematics of snakes in the Dipsas oreas complex (Colubridae: Dipsadinae) in western Ecuador and Peru, with revalidation of D. elegans (Boulenger) and D. ellipsifera (Boulenger). Bulletin Museum of Comparative Zoology 158: 67–136. https://doi.org/10.3099/0027-4100(2005)158[67:SOSOTD]2.0.CO;2
  • Cadle JE, Myers CW (2003) Systematics of snakes referred to Dipsas variegata in Panama and Western South America, with revalidation of two species and notes on defensive behaviors in the Dipsadini (Colubridae). American Museum Novitates 3409: 1–47. https://doi.org/10.1206/0003-0082(2003)409<0001:SOSRTD>2.0.CO;2
  • Carillo de Espinoza N (1974) . Sibynomorphus williamsi nov. sp. (Serpentes: Colubridae). Publicaciones del Museo de Historia Natural Javier Prado 24: 1–16.
  • Catenazzi A, Lehr E, von May R (2013) The amphibians and reptiles of Manu National Park and its buffer zone, Amazon basin and eastern slopes of the Andes, Peru. Biota Neotropica 13: 269–283. https://doi.org/10.1590/S1676-06032013000400024
  • Cope ED (1863) Descriptions of new American Squamata in the Museum of the Smithsonian Institution. Proceedings of the Academy of Natural Sciences of Philadelphia 15: 100–106.
  • Cope ED (1866) Fourth contribution to the herpetology of tropical America. Proceedings of the Academy of Natural Sciences of Philadelphia 18: 123–132.
  • Cope ED (1868) An examination of the Reptilia and Batrachia obtained by the Orton Expedition to Equador and the Upper Amazon, with notes on other species. Proceedings of the Academy of Natural Sciences of Philadelphia 20: 96–140.
  • Cope ED (1875) On the Batrachia and Reptilia of Costa Rica with notes on the herpetology and ichthyology of Nicaragua and Peru. Journal of the Academy of Natural Sciences of Philadelphia 8: 93–183. https://doi.org/10.5962/bhl.title.5028
  • Dowling HG (1951) A proposed standard system of counting ventrals in snakes. British Journal of Herpetology 1: 97–99.
  • Drummond AJ, Ashton B, Buxton S, Cheung M, Cooper A, Heled J, Kearse M, Moir R, Stones-Havas S, Sturrock S, Thierer T, Wilson A (2010) Geneious v5.5. Biomatters. http://www.geneious.com
  • Duellman WE (1978) The biology of an equatorial herpetofauna in Amazonian Ecuador. Miscellaneous Publications of the Museum of Natural History University of Kansas 65: 1–352.
  • Duméril AMC, Bibron G, Duméril AHA (1854) . Erpétologie générale ou Histoire Naturelle complète des Reptiles. Librairie Encyclopédique de Roret, Paris, 780 pp.
  • Dunn ER (1923) Some snakes from North Western Peru. Proceedings of the Biological Society of Washington 36: 185–188.
  • Felsenstein J (2004) Inferring Phylogenies. Sinauer Associates, Sunderland, 664 pp.
  • Fernandes DS, Marques OAV, Argôlo AJS (2010) A new species of Dipsas Laurenti from the Atlantic Forest of Brazil. Zootaxa 2691: 57–66.
  • Fernandes R, Fernandes DS, Passos P (2002) Leptognathus latifasciatus Boulenger 1913, a junior synonym of Dipsas polylepis Boulenger 1912 (Serpentes, Colubridae). Boletim do Museu Nacional 493: 1–7.
  • Fernandes R, Porto M, Caramaschi U (1998) The taxonomic status of Heterorhachis poecilolepis Amaral, 1923. Journal of Herpetology 32: 139–141. https://doi.org/10.2307/1565497
  • Figueroa A, McKelvy AD, Grismer LL, Bell CD, Lailvaux SP (2016) A species-level phylogeny of extant snakes with description of a new colubrid subfamily and genus. PLoS ONE 11(9): e0161070. https://doi.org/10.1371/journal.pone.0161070
  • Fischer JG (1885) Ichthyologische und herpetologische Bemerkungen. V. Herpetologische Bemerkungen. Jahrbuch der Hamburgischen Wissenschaftlichen Anstalten 2: 82-121.
  • Fitzinger LJFJ (1843) Systema Reptilium. Braumüller et Seidel, Wien, 106 pp.
  • Funk WC, Caldwell JP, Peden CE, Padial JM, De la Riva I, Cannatella DC (2007) Tests of biogeographic hypotheses for diversification in the Amazonian forest frog, Physalaemus petersi. Molecular Phylogenetics and Evolution 44: 825–837. https://doi.org/10.1016/j.ympev.2007.01.012
  • Grazziotin FG, Zaher H, Murphy RW, Scrocchi G, Benavides MA, Zhang YP, Bonatto SL (2012) Molecular phylogeny of the New World Dipsadidae (Serpentes: Colubroidea): a reappraisal. Cladistics 28: 437–459. https://doi.org/10.1111/j.1096-0031.2012.00393.x
  • Günther A (1858) Catalogue of Colubrine snakes of the British Museum. Taylor and Francis, London, 281 pp.
  • Günther A (1872) Seventh account of new species of snakes in the collection of the British Museum. The Annals and Magazine of Natural History 9: 13-37.
  • Günther A (1895) Reptilia and Batrachia. Biologia Centrali-Américana. Taylor and Francis, London, 326 pp.
  • Hackett SJ (1993) Phylogenetic and biogeographic relationships in the Neotropical genus Gymnopithys (Formicariidae). Wilson Bulletin 105: 301–315.
  • Harvey MB, Barker DG, Ammerman LK, Chippindale PT (2000) Systematics of pythons of the Morelia amethistina complex (Serpentes: Boidae) with the description of three new species. Herpetological Monographs 14: 139–185. https://doi.org/10.2307/1467047
  • Harvey MB, Embert D (2008) Review of Bolivian Dipsas (Serpentes: Colubridae), with Comments on Other South American Species. Herpetological Monographs 22: 54–105. https://doi.org/10.1655/07-023.1
  • Harvey MB, Rivas G, Caicedo-Portilla JR, Rueda-Almonacid JV (2008) Systematics of the enigmatic Dipsadine snake Tropidodipsas perijanensis Alemán (Serpentes: Colubridae) and review of morphological characters of Dipsadini. Herpetological Monographs 22: 106–132. https://doi.org/10.1655/08-025.1
  • Hoge AR (1964) Sur la position systématique de quelques serpents du genre Siphlophis Fitzinger 1843 (Serpentes). Memórias do Instituto Butantan 30: 35–50.
  • Hoge AR, Romano SARWL (1975) A new subspecies of Dipsas indica from Brazil (Serpentes, Colubridae, Dipsadinae). Memórias do Instituto Butantan 39: 51-60.
  • Ihering R von (1911) As cobras do Brazil. Primeira parte. Revista do Museo Paulista 8: 273–379.
  • Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution 30: 772–780. https://doi.org/10.1093/molbev/mst010
  • Kofron CP (1982) The identities of some dipsadine snakes: Dipsas elegans, D. ellipsifera and Leptognathus andrei. Copeia 1982: 46–51. https://doi.org/10.2307/1444266
  • Kofron CP (1987) Systematics of Neotropical gastropod-eating snakes: the fasciata group of the genus Sibon. Journal of Herpetology 21: 210–225. https://doi.org/10.2307/1564485
  • Köhler G, Lotzkat S, Hertz A (2010) A new species of Sibon (Squamata: Colubridae) from western Panama. Herpetologica 66: 80-85. https://doi.org/10.1655/08-077.1
  • Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott B (2016) PartitionFinder 2: new methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Molecular Biology and Evolution 34: 772–773. https://doi.org/10.1093/molbev/msw260
  • Laurenti JN (1768) Specimen medicum, exhibens synopsin reptilium emendatum cum experimentis circa venena et antidota reptilium Austriacorum. Joan Thom, Vienna, 214 pp. https://doi.org/10.5962/bhl.title.5108
  • Lawson R, Slowinski JB, Crother BI, Burbrink FT (2005) Phylogeny of the Colubroidea (Serpentes): new evidence from mitochondrial and nuclear genes. Molecular Phylogenetics and Evolution 37: 581–601. https://doi.org/10.1016/j.ympev.2005.07.016
  • Liner EA, Wilson LD (1970) Changes in the name an generic status of the Mexican snake Chersodromus annulatus Zweifel (Colubridae). Copeia 1970: 786–788. https://doi.org/10.2307/1442335
  • Linnaeus C (1758) Systema Naturae. Editio Decima, Reformata. Impensis Laurentii Salvii, Stockholm, 824 pp.
  • Lotzkat S, Hertz A, Köhler G (2012) A new species of Sibon (Squamata: Colubroidea: Dipsadidae) from the Cordillera Central of western Panama, with comments on other species of the genus in the area. Zootaxa 3485: 26–40.
  • Lotzkat S, Natera-Mumaw M, Hertz A, Sunyer J, Mora D (2008) New state records of Dipsas variegata (Duméril, Bibron and Duméril 1854) (Serpentes: Colubridae) from northern Venezuela, with comments on natural history. Herpetotropicos 4: 25–29.
  • Lynch Alfaro JW, Boubli JP, Paim FP, Ribas CC, da Silva MNF, Messias MR, Röhe F, Mercês MP, Silva Júnior JS, Silva CR, Pinho GM, Koshkarian G, Nguyen MTT, Harada ML, Rabelo RM, Queiroz HL, Alfaro ME, Farias IP (2015) Biogeography of squirrel monkeys (genus Saimiri): South-central Amazon origin and rapid pan-Amazonian diversification of a lowland primate. Molecular Phylogenetics and Evolution 82: 436–454. https://doi.org/10.1016/j.ympev.2014.09.004
  • McCranie JR (2006) New species of Sibon (Squamata: Colubridae) from Northeastern Honduras. Journal of Herpetology 40: 16–21. https://doi.org/10.1670/76-05N.1
  • Natera-Mumaw M, Esqueda L, Castelain M (2015) Atlas de serpientes de Venezuela: una visión actual de su diversidad. Dimacofi Negocios Avanzados SA, Santiago, 441 pp.
  • Oliver JA (1937) Notes on a collection of amphibians and reptiles from the State of Colima, Mexico. Occasional Papers of the Museum of Zoology, University of Michigan 360: 1–28.
  • Orcés G, Almendáriz A (1987) Sistematica y distribución de las serpientes dipsadinae del grupo oreas. Revista Politécnica 12: 135–144.
  • Orcés G, Almendáriz A (1989) Presencia en el Ecuador de los colúbridos del género Sibynomorphus. Revista Politécnica 2: 57–67.
  • Palumbi SR, Martin A, Romano S, McMillan WO, Stice L, Grabowski G (1991) The simple fool’s guide to PCR, version 2.0. University of Hawaii, Honolulu, 94 pp.
  • Passos P, Fernandes DS, Caramaschi U (2004) The taxonomic status of Leptognathus incertus Jan, 1863, with revalidation of Dipsas alternans (Fischer, 1885) (Colubridae: Dipsadinae). Amphibia-Reptilia 25: 381–393. https://doi.org/10.1163/1568538042788951
  • Passos P, Fernandes R, Porto M (2005) Geographical variation and taxonomy of the snail-eating snake Dipsas albifrons (Sauvage, 1884), with comments on the systematic status of Dipsas albifrons cavalheiroi Hoge, 1950 (Serpentes: Colubridae: Dipsadinae). Zootaxa 1013: 19–34. https://doi.org/10.11646/zootaxa.1013.1.2
  • Pellegrino KCM, Rodrigues MT, Yonenaga-Yassuda Y, Sites JW (2001) A molecular perspective on the evolution of microteiid lizards (Squamata, Gymnophthalmidae), and a new classification for the family. Biological Journal of the Linnean Society 74: 315–338. https://doi.org/10.1111/j.1095-8312.2001.tb01395.x
  • Pérez-Higareda G, López-Luna MA, Smith HM (2002) A new snake related to Sibon sanniola (Serpentes: Dipsadidae) from Los Tuxtlas, Veracruz, Mexico. Bulletin of the Maryland Herpetological Society 38: 62–65.
  • Peters JA (1960) The snakes of the subfamily Dipsadinae. Miscellaneous Publications, Museum of Zoology, Univesity of Michigan 114: 1–224.
  • Peters JA, Orejas Miranda B (1970) Catalogue of the Neotropical Squamata. Part I. Snakes. Smithsonian Institution Press, Washington DC, 347 pp.
  • Porto M, Fernandes R (1996) Variation and natural history of the snail-eating snake Dipsas neivai (Colubridae: Xenodontinae). Journal of Herpetology 30: 269–271. https://doi.org/10.2307/1565522
  • Reynolds RP, Foster MS (1992) Four new species of frogs and one new species of snake from the Chapare region of Bolivia, with notes on other species. Herpetological Monographs 6: 83–104. https://doi.org/10.2307/1466963
  • Rivas GA, Molina CR, Ugueto GN, Barros TR, Barrio-Amorós CL, Kok PJR (2012) Reptiles of Venezuela: an updated and commented checklist. Zootaxa 3211: 1–64.
  • Rossman DA, Thomas R (1979) A new dipsadine snake of the genus Sibynomorphus from Peru. Occasional Papers of the Museum of Zoology of Louisiana State University 54: 1–6.
  • Rovito SM, Papenfuss TJ, Vásquez-Almazán CR (2012) A new species of Sibon (Squamata: Colubridae) from the mountains of eastern Guatemala. Zootaxa 3266: 62–68.
  • Sauvage HE (1884) Sur quelques Reptiles de la collection du Muséum d’Histoire Naturelle. Bulletin de la Société Philomathique de Paris 8: 142–146.
  • Savage JM (2002) The amphibians and reptiles of Costa Rica, a herpetofauna between two continents, between two seas. The University of Chicago Press, Chicago, 934 pp.
  • Schlegel H (1837) Essai sur la physionomie des serpens. Partie Descriptive. J. Kips, J. HZ. et W. P. van Stockum, La Haye, 606 pp.
  • Scrocchi G, Porto M, Rey L (1993) Descripcion de una especie nueva y situación del genero Sibynomorphus (Serpentes: Colubridae) en la Argentina. Revista Brasileira de Biología 53: 197–208.
  • Sentzen UJ (1796) Ophiologische Fragmente. Meyer’s Zoologische Stockholm Archiv 2: 59–66.
  • Shaw G (1802) General Zoology, or Systematic Natural History. Thomas Davison, London, 552 pp.
  • Sheehy C (2012) Phylogenetic relationships and feeding behavior of Neotropical snail-eating snakes (Dipsadinae, Dipsadini). PhD Thesis, UT Arlington.
  • Smith GR, Lemos-Espinal JA, Hartman D, Chiszar D (2005) A new species of Tropidodipsas (Serpentes: Colubridae) from Sonora, Mexico. Bulletin of the Maryland Herpetological Society 41: 39–41.
  • Solórzano A (2001) Una nueva especie de serpiente del genero Sibon (Serpentes: Colubridae) de la vertiente del Caribe de Costa Rica. Revista de Biologia Tropical 49: 1111–1120.
  • Swofford DL (2002) PAUP*: Phylogenetic analysis using parsimony (*and other methods). v.4.0b10. Sinauer & Associates, Sunderland, Massachusetts.
  • Taylor EH (1954) Further studies on the serpents of Costa Rica. The University of Kansas Science Bulletin 36: 673–800.
  • Torres-Carvajal O, Lobos SE, Venegas PJ (2015) Phylogeny of Neotropical Cercosaura (Squamata: Gymnophthalmidae) lizards. Molecular Phylogenetics and Evolution 93: 281–288. https://doi.org/10.1016/j.ympev.2015.07.025
  • Torres-Carvajal O, Pazmiño-Otamendi G, Salazar-Valenzuela D (2017) Reptiles del Ecuador. Version 2018.0. Available from: https://bioweb.bio
  • Uetz P, Freed P, Hošek J (2016) The Reptile Database. Available from: http:⁄⁄www.reptile-database.org [accessed 12 Oct 2017]
  • Wallach V (1995) Revalidation of the genus Tropidodipsas Günther, with notes on the Dipsadini and Nothopsini (Serpentes: Colubridae). Journal of Herpetology 29: 476–481. https://doi.org/10.2307/1565006
  • Werner F (1901) Reptilien und Batrachier aus Peru und Bolivia. Abhandlungen Berichte Königlichen Zoologischen und Anthropolisch-Ethnographischen Museums zu Dresden 9: 1–14.
  • Werner F (1909) Über neue oder seltene Reptilien des Naturhistorischen Museums in Hamburg. Jahrbuch der Hamburgischen Wissenschaftlichen Anstalten 26: 205–247.
  • Werner F (1910) Neue oder seltenere Reptilien des Musée Royal d’Histoire Naturelle de Belgique in Brüssel. Zoologische Jahrbücher. Abteilung für allgemeine Zoologie und Physiologie der Tiere 28: 263–288.
  • Whiting AS, Bauer AM, Sites JW (2003) Phylogenetic relationships and limb loss in sub-Saharan African scincine lizards (Squamata: Scincidae). Molecular Phylogenetics and Evolution 29: 582–598. https://doi.org/10.1016/S1055-7903(03)00142-8
  • Zaher H (1999) Hemipenial morphology of the South American xenodontine snakes, with a proposal for a monophyletic Xenodontinae and a reappraisal of colubroid hemipenes. Bulletin of the American Museum of Natural History 240: 1–168.
  • Zaher H, Grazziotin FG, Cadle JE, Murphy RW, Moura-Leite JC, Bonatto SL (2009) Molecular phylogeny of advanced snakes (Serpentes, Caenophidia) with an emphasis on South American xenodontines: a revised classification and descriptions of new taxa. Papéis Avulsos de Zoologia 49: 115–153. https://doi.org/10.1590/S0031-10492009001100001

Appendix 1

GenBank accession numbers for loci and terminals of taxa and outgroups sampled in this study. Novel sequence data produced in this study are marked with an asterisk (*).

Species Voucher Country 12S 16S CYTB ND4 c-mos
A. iridescens MZUTI 4178 Ecuador - KT944040 KY610080 - KT944066
D. albifrons MZUSP 13993 Brazil JQ598803 JQ598866 JQ598925 - -
D. andiana MZUTI 3501 Ecuador - MH341009* MH375032* - -
D. andiana MZUTI 3505 Ecuador - MH341010* MH374974* - -
D. andiana MZUTI 5413 Ecuador - MH341011* MH374978* - -
D. andiana QCAZ 10756 Ecuador - MH341014* MH375012* - -
D. andiana QCAZ 13538 Ecuador - MH341015* MH375018* - -
D. andiana QCAZ 5731 Ecuador - MH341012* MH375005* - -
D. andiana QCAZ 8452 Ecuador - MH341013* MH375011* - -
D. articulata USNM 348490 Panama JQ598804 JQ598867 - - -
D. bobridgelyi MZUTI 5414 Ecuador - MH341016* MH374984* - -
D. bobridgelyi MZUTI 5417 Ecuador - MH341017* MH374985* - -
D. bucephala GRCOLLI 25659 Brazil MH341087* MH341018* MH375026* MH375052* MH374932*
D. bucephala IBSP72899 Brazil GQ457789 GQ457730 - - GQ457850
D. catesbyi KU 214851 Peru - - EF078537 EF078585 -
D. catesbyi LSUMNS 13989 Brazil - KX660267 KX660536 - -
D. catesbyi MZUSP 14664 Brazil JQ598805 KX694637 KX694856 - JQ598977
D. catesbyi QCAZ 13558 Ecuador MH341088* MH341019* MH374975* MH375042* MH374933*
D. elegans DHMECN 10311 Ecuador - MH341020* MH374979* - -
D. elegans MZUTI 3317 Ecuador - MH341021* MH375033* - -
D. elegans MZUTI 3695 Ecuador - MH341022* MH375031* - -
D. elegans ZSFQ 10 Ecuador - - MH374994* - -
D. elegans ZSFQ 151 Ecuador - MH341023* MH374992* - -
D. ellipsifera MZUTI 4931 Ecuador - MH341024* MH375030* - MH374934*
D. ellipsifera TH Ecuador - - MH374966* - MH374935*
D. georgejetti MZUA.RE.121 Ecuador - MH341025* MH375024* - MH374936*
D. georgejetti MZUA.RE.122 Ecuador - MH341026* MH375025* - MH374937*
D. georgejetti QCAZ 10589 Ecuador - MH341027* - - -
D. gracilis JMG 070 Ecuador - MH341028* MH374980* - MH374938*
D. gracilis MZUTI 1386 Ecuador - MH341029* MH374970* - -
D. gracilis MZUTI 3331 Ecuador - MH341030* MH374995* - -
D. gracilis MZUTI 3503 Ecuador - MH341031* MH375023* - -
D. gracilis QCAZ 10196 Ecuador - MH341033* MH375000* - -
D. gracilis QCAZ 11238 Ecuador - MH341034* MH375001* - -
D. gracilis QCAZ 12478 Ecuador - MH341035* MH375002* - -
D. gracilis QCAZ 15717 Ecuador - MH341036* MH375013* - -
D. gracilis QCAZ 5265 Ecuador - - MH374998* - -
D. gracilis QCAZ 5886 Ecuador - MH341032* MH374999* - -
D. indica - French Guiana NN AF158488 - - -
D. indica ecuadoriensis QCAZ 13305 Ecuador MH341089* MH341037* MH375006* MH375043* MH374939*
D. indica ecuadoriensis QCAZ 13306 Ecuador MH341090* MH341038* MH375007* MH375044* MH374940*
D. indica ecuadoriensis QCAZ 13561 Ecuador MH341091* MH341039* MH375008* MH375045* MH374941*
D. jamespetersi AMARU 1123 Ecuador - MH341040* - - MH374943*
D. jamespetersi AMARU 383 Ecuador - - - - MH374942*
D. jamespetersi CAMPO 488 Ecuador - MH341041* MH375028* - MH374944*
D. jamespetersi QCAZ 9190 Ecuador - MH341042* MH375014* - -
D. klebbai JMG 050 Ecuador - MH341043* MH375022* - MH374945*
D. klebbai MZUTI 5412 Ecuador - MH341045* MH374977* - -
D. klebbai MZUTI 63 Ecuador - MH341044* MH374986* - -
D. klebbai QCAZ 12717 Ecuador - MH341046* MH375019* - -
D. klebbai QCAZ 12799 Ecuador - MH341047* MH374996* - -
D. klebbai QCAZ 14280 Ecuador - MH341048* - - -
D. klebbai QCAZ 14281 Ecuador - MH341049* - - -
D. mikanii MZUSP 14658 Brazil GQ457832 GQ457771 KX694855 - GQ457892
D. neuwiedi MCP13291 Brazil GQ457831 GQ457770 - - GQ457891
D. neuwiedi MZUSP 13972 Brazil JQ598838 JQ598898 - - -
D. oligozonata MZUA.RE.081 Ecuador - MH341050* MH375029* - -
D. oreas DHMECN 7647 Ecuador - MH341051* MH374971* - -
D. oreas DHMECN 7648 Ecuador - MH341052* MH374967* - -
D. oreas MZUA.RE.239 Ecuador - MH341053* MH374987* - -
D. oreas MZUTI 3351 Ecuador - MH341054* - MH375038* -
D. oreas MZUTI 5415 Ecuador - MH341055* - - -
D. oreas MZUTI 5418 Ecuador - MH341056* MH374981* - -
D. oreas QCAZ 10068 Ecuador - MH341057* MH375015* - -
D. oreas QCAZ 11290 Ecuador - MH341058* MH375016* - -
D. oreas QCAZ 13875 Ecuador - MH341059* MH375017* - -
D. oswaldobaezi QCAZ 10369 Ecuador - MH341060* MH374997* - -
D. palmeri JMG 069 Ecuador - MH341061* MH374976* - MH374946*
D. palmeri MZUTI 4804 Ecuador - MH341062* MH374982* - MH374947*
D. palmeri MZUTI 4975 Ecuador - MH341063* - - -
D. palmeri MZUTI 5419 Ecuador - MH341064* MH374988* - MH374948*
D. palmeri QCAZ 13304 Ecuador MH341092* MH341065* MH375009* MH375046* MH374949*
D. palmeri QCAZ 13307 Ecuador MH341093* MH341066* MH375004* MH375047* MH374950*
D. palmeri QCAZ 13562 Ecuador MH341094* MH341067* MH375010* MH375048* MH374951*
D. pavonina LSUMNS 14372 Brazil - KX660268 KX660537 - -
D. pavonina MZUTI 4972 Ecuador - MH341068* MH374983* - MH374952*
D. peruana LSUMNS 1532 Peru - - KX660538 - KX660406
D. pratti MHUA 14278 Colombia - - GQ334482 GQ334583 -
D. temporalis QCAZ 5050 Ecuador - MH341069* MH375003* - -
D. turgida FML 14969 Argentina JQ598839 JQ598899 KX660547 - -
D. turgida LSUMNS 6459 - - KX660279 - KX660659 KX660418
D. vaga KU 219121 Peru - KX660252 - - KX660393
D. variegata MZUSP 14665 Brazil - GQ457731 - - GQ457851
D. variegata - - AF158406 AF158476 - - -
D. ventrimaculata MCP4870 Brazil JQ598840 JQ598900 - - JQ598997
D. vermiculata MZUTI 3663 Ecuador - MH341070* MH374989* - -
D. vermiculata QCAZ 13563 Ecuador MH341095* MH341071* MH374972* MH375049* MH374953*
D. vermiculata QCAZ 13582 Ecuador MH341096* MH341072* - MH375040* MH374954*
D. vermiculata QCAZ 13825 Ecuador - MH341073* MH374973* MH375050* MH374955*
D. vermiculata SBI 171139 Peru Z46459 Z46496 - - -
D. williamsi CORBIDI 12695 Peru - - MH374968* MH375041* -
D. williamsi CORBIDI 12919 Peru - - MH374969* MH375039* -
G. godmani - - JQ598814 JQ598877 JQ598932 - -
S. annulatus ADM 0007 Costa Rica - KX660170 KX660444 KX660573 KX660309
S. annulatus ADM 242 Costa Rica - KX660169 KX660443 KX660572 KX660308
S. annulatus MVZ 269290 Nicaragua MH341097* MH341074* MH375034* MH375053* MH374956*
S. annulatus MZUTI 3034 Ecuador - MH341075* MH375021* - -
S. anthracops MVZ 215680 Costa Rica MH341098* MH341076* MH375035* MH375054* MH374957*
S. bevridgelyi MZUA.RE.424 Ecuador - - MH374990* - -
S. bevridgelyi MZUTI 3269 Ecuador - MH341077* MH374962* - -
S. bevridgelyi MZUTI 5416 Ecuador - MH341078* MH374963* - -
S. dimidiatus LSUMNS 6689 - - KX660278 - - KX660417
S. dunni CAMPO 533 Ecuador - MH341079* MH374991* - -
S. longifrenis MVZ 215681 Costa Rica MH341099* MH341080* MH375036* MH375055* MH374958*
S. merendonensis MVZ 263880 Guatemala MH341100* MH341081* MH375037* MH375056* MH374959*
S. nebulatus hartwegi MHUA14511 Colombia - - GQ334556 GQ334662 -
S. nebulatus leucomelas DHMECN 9585 Ecuador - MH341082* - - -
S. nebulatus leucomelas MZUTI 3911 Ecuador - MH341083* MH374964* - -
S. nebulatus leucomelas MZUTI 4810 Ecuador - MH341084* MH374965* - MH374960*
S. nebulatus nebulatus Belize Belize AF544777 AF544806 - - AF544736
S. nebulatus nebulatus MVZ 233298 Costa Rica EU728583 EU728583 EU728583 EU728583 -
T. fasciata TJC 666 Mexico MH341101* MH341085* MH375027* MH375057* MH374961*
T. fischeri MVZ 143527 Guatemala MH341102* MH341086* MH374993* MH375051* -
T. sartorii KU 289806 El Salvador - - EF078540 EF078588 -

Appendix 2

List of PCR and sequencing primers and their respective PCR conditions (denaturation, annealing, extension and number of corresponding cycles) used in this study. All PCR protocols included an initial 3-min step at 94 °C and a final extension of 10 min at 72 °C.

Locus Primer name Sequence (5’-3’) Reference PCR profile:
16S 16Sar-L CGCCTGTTTATCAAAAACAT Palumbi et al. (1991) 30 cycles of 94 °C (45 sec), 53 °C (45 sec), 72 °C (1 min)
16Sbr-H-R CCGGTCTGAACTCAGATCACGT
Cytb GLUDG-L TGACTTGAARAACCAYCGTTG Palumbi et al. (1991) 35–42 cycles of 95°C (30 sec) , 50 or 56 °C (45 sec), 72 °C (45 sec)
ATRCB3 TGAGAAGTTTTCYGGGTCRTT Harvey et al. (2000)
ND4 ND4 CACCTATGACTACCAAAAGCTCATGTAGAAGC Arévalo et al. (1994) 94 °C (25 sec), 56 or 60 °C (1 min), 72 °C (2 min) [x25–30]
Leu CATTACTTTTACTTGGATTTGCACCA
c-mos S77 CATGGACTGGGATCAGTTATG Lawson et al. (2005) 1 cycle of 94 °C (3 min), 56 °C (45 sec), 72 °C (1 min), followed by 34 cycles of 94 °C (45 sec), 56 °C (45 sec), 72 °C (1 min)
S78 CCTTGGGTGTGATTTTCTCACCT

Appendix 3

Morphological data and sex for specimens of Dipsadini species examined. Codes: V = ventrals; SC = subcaudals; D1–3 = dorsal scale rows at neck, midbody, and vent; PO = postoculars; SL = supralabials; IL = infralabials; SVL = snout-vent length (mm); TL = tail length (mm); M = Male, F = Female.

Species Voucher V SC D1 D2 D3 PO SL IL SVL TL Sex
D. andiana MZUA.RE.0230 187 96 15 15 15 3 9 11 744 196 M
D. andiana MHNG 2250.053 194 85 15 15 15 2 9 12 292 71 F
D. andiana MZUTI 5413 190 101 14 15 15 2 10 11 471 165 M
D. andiana MZUTI 3501 187 98 15 15 15 2 9 12 398 137 M
D. andiana MZUTI 3505 192 15 15 15 2 8 10 674 167 F
D. andiana ZSFQ D115 189 84 15 15 15 2 10 10 680 150 F
D. andiana ZSFQ D116 186 90 15 15 15 2 10 10 453 149 M
D. andiana ZSFQ D117 189 101 15 15 15 2 9 9 405 139 M
D. bobridgelyi QCAZ 1706 201 117 15 15 15 2 9 12 445 212 M
D. bobridgelyi DHMECN 11527 178 98 15 15 15 2 9 12 404 158 F
D. bobridgelyi MZUTI 3266 184 96 15 15 15 2 9 11 286 117 F
D. bobridgelyi MZUTI 5414 180 95 15 15 15 2 9 13 478 195 M
D. bobridgelyi MZUTI 5417 182 101 15 15 15 2 9 13 372 158 M
D. catesbyi MHNG 2220.054 180 98 13 13 13 1 8 9 366 147 F
D. catesbyi MHNG 2238.005 176 94 13 13 13 2 9 10 420 155 F
D. catesbyi USNM 283949 168 81 13 13 13 1 7 8 276 98 F
D. catesbyi DHMECN 11555 164 97 2 7 222 80
D. catesbyi QCAZ 181 172 93 13 13 13 2 9 10 470 169 F
D. catesbyi MHNG 2220.052 175 83 13 13 13 1 8 10 505 180 F
D. catesbyi QCAZ 210 199 97 13 13 13 2 8 9 441 165 F
D. catesbyi MHNG 2206.086 183 108 13 13 13 1 8 9 480 202 M
D. catesbyi MHNG 2435.097 184 98 13 13 13 1 8 10 308 117 F
D. catesbyi QCAZ 5108 197 105 13 13 13 2 7 8 583 223 M
D. catesbyi MHNG 2249.001 178 93 13 13 13 2 8 9 311 112 F
D. catesbyi QCAZ 28 181 101 13 14 13 2 8 10 591 232 F
D. catesbyi MHNG 2238.014 175 93 13 13 13 2 8 9 429 158 F
D. catesbyi MHNG 2307.091 181 92 13 13 13 2 7 9 431 155 F
D. catesbyi MZUTI 4736 187 103 13 13 13 2 8 10 454 186 M
D. catesbyi MZUTI 4999 177 93 13 13 13 2 9 9 397 160 M
D. elegans MHNG 2435.084 178 102 15 15 15 2 6 10 305 111 M
D. elegans MHNG 2440.098 180 98 15 15 15 2 7 11 178 65 F
D. elegans DHMECN 1693 181 97 15 15 15 2 7 9 119 71 M
D. elegans MHNG 2457.078 182 94 15 15 15 1 7 10 183 65 F
D. elegans MHNG 2249.019 179 95 15 15 15 2 6 11 505 195 M
D. elegans MHNG 2413.074 178 93 15 15 15 1 7 11 607 211 F
D. elegans USNM 285957 183 100 15 15 13 2 7 11 152 60
D. elegans MHNG 2399.072 180 82 15 15 15 1 7 9 555 161 F
D. elegans MZUTI 3695 182 102 15 15 15 2 7 11 296 102 M
D. elegans MZUTI 3317 186 108 15 15 15 2 7 11 409 175 M
D. elegans MHNG 2457.079 177 90 15 15 15 2 7 9 687 246 F
D. elegans MHNG 2308.002 180 90 15 15 13 2 7 10 605 212 F
D. elegans MHNG 2220.093 181 109 15 15 15 1 8 10 591 251 M
D. elegans MZUTI 3316 182 86 15 15 15 1 8 11 657 220 F
D. ellipsifera MZUTI 4931 164 86 15 15 15 2 7 10 229 79 M
D. ellipsifera QCAZ 14855 175 93 15 15 15 2 8 7 580 230 M
D. ellipsifera QCAZ 15225 183 101 15 15 15 2 6 8 488 234 M
D. ellipsifera MHNG 2220.048 163 62 15 15 15 2 7 8 406 114 F
D. gracilis QCAZ 4137 185 94 15 15 15 2 8 9 289 128 M
D. gracilis QCAZ 14495 179 99 15 15 15 2 10 11 530 235 F
D. gracilis QCAZ 7321 189 98 15 15 15 2 11 10 361 150 M
D. gracilis MZUA.RE.0280 189 101 13 13 13 3 10 12 590 172 F
D. gracilis MZUA.RE.0281 184 110 15 15 15 2 10 12 343 100
D. gracilis QCAZ 12478 193 102 15 15 15 2 11 10 425 161 M
D. gracilis MHNG 2309.038 190 15 15 15 2 8 11 291 92 M
D. gracilis QCAZ 10196 180 89 15 15 15 2 10 12 283 110 M
D. gracilis USNM 285477 203 118 15 15 15 3 9 13 356 166 M
D. gracilis USNM 285478 197 118 15 15 15 3 9 12 416 189
D. gracilis USNM 285479 203 131 15 15 15 3 9 12 418 199 M
D. gracilis USNM 285480 193 107 15 15 15 2 10 11 181 74
D. gracilis DHMECN 2902 205 121 15 15 15 2 7 11 554 265 M
D. gracilis QCAZ 11427 196 15 15 15 2 9 11 365 150 M
D. gracilis MHNG 1363.023 206 120 15 15 15 3 11 11 395 187 M
D. gracilis MHNG 1363.024 210 122 15 15 14 3 10 12 458 210 M
D. gracilis MHNG 1363.026 201 113 15 15 15 2 9 12 464 203 F
D. gracilis MHNG 1363.027 209 118 15 15 15 2 10 11 426 193 M
D. gracilis MHNG 2453.019 203 113 15 15 15 2 9 11 332 142 F
D. gracilis QCAZ 14494 203 109 15 15 15 2 7 8 473 220 M
D. gracilis MZUTI 1386 194 110 15 15 15 2 9 12 451 187 F
D. gracilis MZUTI 3503 197 113 15 15 15 2 9 10 468 199 F
D. gracilis DHMECN 129 192 101 15 15 15 2 9 11 425 191 M
D. gracilis MZUTI 4199 205 109 15 15 15 2 10 11 402 166 F
D. indica MZUA.RE.0059 180 97 13 13 13 2 9 15 1153 293 F
D. indica MHNG 2435.093 196 95 13 13 11 2 9 14 537 172 F
D. indica MHNG 2413.076 197 109 13 13 11 2 9 14 327 121 M
D. indica MZUTI 4735 199 112 13 13 13 2 9 14 672 230 M
D. jamespetersi MZUA.RE.0147 178 71 15 15 15 2 8 13 663 156 M
D. jamespetersi MZUTI 5307 178 75 15 15 15 2 7 11 560 156 H
D. jamespetersi USNM 237040 183 84 15 15 15 2 8 11 150 61
D. jamespetersi MHNG 2512.047 171 81 15 15 15 2 8 9 424 152 M
D. jamespetersi MHNG 2512.048 186 76 15 15 15 2 8 12 511 157 F
D. jamespetersi MHNG 2399.071 178 73 15 15 15 2 8 10 469 136 F
D. jamespetersi MHNG 2457.09 179 69 15 15 15 2 8 11 F
D. jamespetersi MHNG 2512.049 169 83 15 15 15 3 8 10 421 154 M
D. jamespetersi MHNG 2512.05 190 15 15 15 2 8 9 466 125 F
D. jamespetersi MHNG 2521.087 178 81 15 15 15 3 8 9 378 133 M
D. jamespetersi QCAZ 15100 185 98 15 15 15 2 8 7 412 133 M
D. jamespetersi MHNG 2413.082 185 73 15 15 15 2 8 11 505 143 F
D. klebbai QCAZ 1605 181 97 15 15 15 2 9 10 569 251 M
D. klebbai DHMECN 568 104 15 15 15 2 10 13 630 240 F
D. klebbai MHNG 2220.035 194 115 15 15 15 2 11 14 286 118 F
D. klebbai MHNG 2220.056 185 106 13 13 13 2 8 8 505 209 M
D. klebbai MHNG 2250.063 197 104 15 15 15 2 9 12 489 199 M
D. klebbai MHNG 2250.064 196 109 15 15 15 2 10 12 401 169 M
D. klebbai MZUTI 5412 188 116 15 15 15 2 10 14 608 262 M
D. klebbai USNM 286323 198 117 15 15 15 2 8 11 263 105 F
D. klebbai MHNG 2220.038 193 106 15 15 15 2 9 11 570 219 F
D. klebbai MHNG 2220.039 190 109 15 15 15 2 11 12 500 204 M
D. klebbai MZUTI 63 199 112 15 15 15 2 10 12 701 297 M
D. klebbai MHNG 2220.04 191 102 15 15 15 2 9 13 525 210 F
D. klebbai MHNG 2220.041 187 101 15 15 15 2 9 13 604 229 F
D. klebbai QCAZ 250 184 99 15 15 15 2 9 12 495 205 M
D. klebbai QCAZ 14281 201 123 15 15 15 2 9 11 749 330 M
D. klebbai MHNG 2529.029 188 98 15 15 15 2 9 12 534 209 F
D. klebbai ZSFQ D304 189 101 15 15 15 2 9 11 303 121 F
D. georgejetti USNM 142595 182 59 15 15 15 2 7 11 131 30 M
D. georgejetti MZUTI 5411 178 69 15 16 15 2 7 9 315 87 M
D. georgejetti DHMECN 11639 172 86 15 15 15 2 7 10 270 90 M
D. georgejetti MZUA.RE.0121 177 58 15 15 15 2 7 10 856 150 F
D. georgejetti MZUA.RE.0122 175 79 15 15 15 2 7 9 711 170 M
D. georgejetti DHMECN 11646 180 72 15 15 15 2 7 9 382 140 M
D. georgejetti ZSFQ D606 182 63 15 15 15 2 7 10 163 51 M
D. oligozonata MZUA.RE.0081 144 62 15 15 15 2 8 10 446 127 M
D. oligozonata MZUA.RE.0240 150 53 15 15 15 2 7 12 772 154 F
D. oligozonata MZUA.RE.0020 149 60 15 15 15 2 8 10 632 134 M
D. oligozonata MZUA.RE.0357 138 63 15 15 15 2 8 11 538 139 M
D. oreas DHMECN 7647 168 77 15 15 15 2 7 11 270 106 M
D. oreas DHMECN 7666 170 79 15 15 15 2 8 12 532 107 M
D. oreas MZUA.RE.0239 171 84 15 15 15 2 7 11 785 214 M
D. oreas MZUA.RE.0290 182 95 15 15 15 2 7 13 561 138
D. oreas QCAZ 9190 181 93 15 15 15 2 7 10 495 191 F
D. oreas USNM 62797 180 77 15 15 15 2 8 11 377 124 F
D. oreas USNM 62798 178 75 15 15 11 367 120 M
D. oreas USNM 62800 180 84 15 15 15 2 8 12 144 46 M
D. oreas DHMECN 10785 198 97 15 15 15 2 7 11 222 76 M
D. oreas DHMECN 2572 178 89 15 15 15 2 7 11 417 141 M
D. oreas MZUTI 3351 177 87 14 15 15 2 7 10 473 181 M
D. oreas MZUTI 5415 178 75 15 15 15 2 7 11 487 156 M
D. oreas MZUTI 5418 183 86 15 15 15 2 7 10 252 81 M
D. oreas MHNG 2514.028 176 15 15 15 2 7 11 384 128 M
D. oreas MHNG 2521.084 171 79 15 15 15 2 9 12 571 184 F
D. oreas QCAZ 10068 157 84 15 15 15 2 8 11 181 60 M
D. oreas QCAZ 13875 175 63 15 15 15 2 7 10 499 151 M
D. oreas QCAZ 11290 176 102 14 14 14 2 9 12 334 131 M
D. oreas QCAZ 6020 167 59 15 15 15 2 7 586 149 M
D. palmeri QCAZ 11411 192 107 15 15 15 2 9 12 470 193 M
D. palmeri QCAZ 5609 193 15 15 15 2 9 13 753 271 M
D. palmeri QCAZ 13307 186 118 15 15 15 2 8 11 660 278 M
D. palmeri QCAZ 13562 189 91 15 15 15 2 9 11 215 78 M
D. palmeri QCAZ 4710 182 97 15 15 15 2 9 12 472 200 M
D. palmeri AMNH 24126 196 116 15 15 15 2 9 13 234 91 M
D. palmeri MZUTI 4804 190 101 15 15 15 3 8 10 602 269 M
D. palmeri MZUA.RE.0044 181 86 15 15 15 2 9 10 893 225 F
D. palmeri QCAZ 14071 187 101 15 15 15 2 9 11 642 246 F
D. palmeri QCAZ 3288 185 103 15 15 15 2 9 11 615 274 M
D. palmeri MZUTI 3956 202 116 15 15 15 2 10 12 656 239 M
D. palmeri AMNH 37939 190 15 15 15 2 9 13 694 188 M
D. palmeri QCAZ 13992 192 97 15 15 15 2 9 11 M
D. palmeri QCAZ 4564 185 109 15 15 15 2 9 11 248 93 M
D. palmeri QCAZ 6021 196 103 15 15 15 2 9 12 791 290 M
D. palmeri QCAZ 14338 172 110 15 15 15 2 9 12 907 390 M
D. palmeri QCAZ 12771 197 104 15 15 15 2 9 12 273 98 M
D. palmeri MZUTI 4971 196 106 15 15 15 2 8 12 332 121 M
D. palmeri MZUTI 4975 191 114 15 15 15 2 8 11 631 299 M
D. palmeri QCAZ 12772 182 101 15 15 15 2 9 12 403 146 M
D. palmeri MZUTI 5419 189 117 15 15 15 2 9 13 658 286 M
D. palmeri QCAZ 12510 182 93 15 15 15 2 9 12 740 252 F
D. palmeri MZUA.RE.0119 200 102 15 15 15 2 9 12 1187 298 F
D. pavonina MZUA.RE.0198 211 119 13 13 13 3 11 13 745 241 M
D. pavonina QCAZ 5554 187 95 13 13 13 2 10 12 493 256 M
D. pavonina MHNG 2309.039 204 13 13 13 2 9 11 341 90 M
D. pavonina MHNG 2521.088 198 117 13 13 13 2 10 12 413 196 M
D. pavonina MZUTI 4972 196 115 13 13 13 2 9 10 441 207 M
D. peruana AMNH 147037 187 111 15 15 15 2 9 13 199 85 M
D. peruana USNM 60718 177 75 15 15 15 3 9 12 258 79 M
D. peruana USNM 299232 188 92 15 15 15 2 9 13 467 198 M
D. peruana USNM 299233 200 127 15 15 15 2 9 12 235 99 M
D. oswaldobaezi MZUA.RE.0286 185 61 15 15 15 2 6 9 395 70
D. oswaldobaezi QCAZ 10369 179 70 15 15 15 2 6 9 277 85 M
D. oswaldobaezi QCAZ 14051 175 66 15 15 15 2 6 7 287 86
D. oswaldobaezi QCAZ 14060 180 64 15 15 15 2 6 8 500 132
D. oswaldobaezi QCAZ 15108 179 65 15 15 15 2 6 9 407 110 F
D. temporalis MZUTI 3331 202 113 15 15 15 2 9 11 226 92 F
D. temporalis MHNG 2521.083 175 116 15 15 15 1 7 9 234 111 F
D. vagrans AMNH 63373 153 82 15 15 15 2 9 11 302 129 M
D. vermiculata MHNG 2521.085 181 93 15 15 15 215 81 F
D. vermiculata DHMECN 11197 181 116 13 13 13 2 8 9 109