A new species of the family Planorbidae is described from the land thermal spring Khakusy, on the north-eastern shore of Lake Baikal. The description of Gyraulus takhteevi sp. n. includes morphological characters and gene sequences (COI of mtDNA) for the species separation from sister taxon Gyraulus acronicus (A. Férussac, 1807) collected from the small Krestovka River in-flowing into the south-western part of the Lake. The new species differs from G. acronicus in small shell size of adults, having smaller number of prostate folds (maximal up to 26 in G. takhteevi n. sp. vs. 40 in G. acronicus), a short preputium (approximately twice shorter than the phallotheca), and an elongated bursa copulatrix. The population of Gyraulus takhteevi sp. n. consists of two co-existent morphs: one of them has a narrow shell spire and the second is characterized by wide spire similar to the shell of G. acronicus. One of the two revealed haplotypes of the new species includes both morphs, while the second consists of snails with wide spired shells.

COI mtDNA, morphology, planorbid gastropods

The thermal spring Khakusy is located one kilometer from the shore in the north-eastern part of Lake Baikal and flows into it. The chemical composition of the water is hydrocarbonate-sulphate-sodium with a salinity of 0.3 g/l; the water temperature of the mainstream is + 47 °C (Volkov 2010). Bottom ground of this warm stream is sand and pebbles, covered with mats of blue-green algae. Gastropods (limnaeids and planorbids) live far from the main stream, where the water temperature varies from + 31 °C to 10 °C. Among limnaeids two species, Radix khakusyensis Kruglov & Starobogatov, 1989 and Radix thermobaicalica Kruglov & Starobogatov, 1989, were described, which are now proposed to be considered as ecotypes of Radix auricularia (Linnaeus, 1758) (Aksenova et al. 2017). Together with Radix, small specimens of Gyraulus (Planorbidae) were found, which differed from all other species of Gyraulus inhabiting the Baikal region including the thermal springs (Sitnikova and Takhteev 2006). Unique morphological characters of these snails support to their status as a new species.

Two hundred fourteen specimens of a new species were collected in the thermal spring Khakusy (north-eastern shore of Lake Baikal (55°21'42"N, 109°49'41"E), from pebbles covered by vegetation, mainly filamentous cyanobacterial mats. The samples were collected on 30 March 1990 (13 specimens) from spring with a water temperature of +31 °C, and 39 specimens from slightly downstream with water temperature at +22 °C by V. Takhteev; 3 July 2003 (6 spec.) by T. Sitnikova; 7 October 2004 (23 specimens) by V. Takhteev; 9 August 2009 (14 specimens, 6 dissected) by T. Sitnikova, 20 March 2003 (61 specimens) by V. Takhteev; 8 June 2015 (53 spec., 8 dissected) by T. Peretolchina, and July 2017 (5 specimens, 1 dissected) by T. Sitnikova.

The 60 adult specimens of the new species were compared with seven individuals of the Gyraulus acronicus (A. Férussac, 1807) collected in a small inflow of the Krestovka River (51°51'44"N, 104°51'11"E) on 13 October 2015 and 2 October 2017 by T. Sitnikova; 4 of these specimens were dissected. The holotype and paratypes of the newly described species were deposited in the collection of the Zoological Institute RAS (St. Petersburg), registration numbers are 522-2015 (1) for the holotype and 522-2015 (2) for three paratypes . An additional 28 paratypes were deposited in the gastropod collection of the Limnological Institute SB RAS (Irkutsk, Russia) under Nos: 901, 902, 1101, and 1102.

Anatomical study and molecular analyses were performed on snails fixed in 80% ethanol that was changed for 70% ethanol after one day. Eight snails were photographed and the shells of 12 individuals were dissected. DNA was extracted from the feet; the teeth of radula were SEM-photographed and the soft tissues were dissected under a light stereomicroscope. Morphological study and descriptive terminology are based on the review of morphological characters of planorbid gastropods (Meier-Brook 1964, 1983; Brown 2001; Glöer 2002). Measurements of the shells were performed using the Image-Pro-Plus program for Windows XP.

Genomic DNA was extracted from muscle tissue using a modified method from Sokolov (2000). Gene fragments of mitochondrial cytochrome c oxidase subunit 1 (CO1) were amplified using primers L1490 (5’ – GGTCAACAAATCATAAAGATATTGG – 3’) and H2198 (TAAACTTCAGGGTGACCAAAAAATCA - 3’) (Folmer et al., 1994) and mitochondrial large ribosome subunit (16S) were amplified using primers ARL (5’ – CGCCTGTTTATCAAAAACAT – 3’) and BRH (5’ – CCGGTCTGAACTCAGATCACGT – 3’) (Palumbi et al. 1996). An average of 1-3 μL of extracted DNA was amplified in a 25 μL of PCR-mix using BioMaster HS-Taq PCR Kit (Biolabmix, Russia) following the manufacturer’s recommendations. Conditions of 30 cycles of amplification for both gene fragments were pre-denaturation at 94 °C for 5 min, followed by denaturation at 94 °C for 40 s, annealing of primers at 50 °C for 40 s, elongation at 72 °C for 60 s, and a final elongation step at 72 °C for 8 min. The reaction products were analyzed in 1% agarose gel. After electrophoresis, visible bands of the expected size were excised and then amplicons were cleaned up according to Maniatis et al. (1982). Sequencing was carried out in an ABI 3130 automated sequencer. The DNA sequences obtained were aligned using default settings by ClustalW (Thompson et al. 2002) and edited using the BioEdit software package (Hall 1999). All sequences were deposited in GenBank under accession numbers (Table 1). Additional sequences of other representatives of Gyraulus retrieved from GenBank are also listed in Table 1.

Mean pairwise, inter-specific p-distances between COI and 16S sequences were calculated using MEGA 6 (Tamura et al. 2013) (Table 3).

Phylogenetic reconstructions for COI mtDNA was inferred following a Bayesian method of phylogenetic inference as implemented by MrBayes v. 3.2.2 (Ronquist and Huelsenbeck 2003). Posterior probabilities of phylogenetic trees were estimated by a 15,000,000 generation Metropolis-coupled Markov chain Monte Carlo simulation (two runs with four chains) under the GTR+I+G model of substitution, determined as a best fit model using jModelTest v.2.1 (Darriba et al. 2012). A 50 % majority-rule consensus tree was constructed following a 25% burn-in of all sampled trees to allow likelihood values to reach stationary equilibrium.

Despite the small genetic distances between G. takhteevi sp. n. and G. acronicus, morphological differences between them (shell size of mature individuals, maximal number of prostate folds, length of the phalloteka relative to length of the prepuceum, length of a stylet, shape of the bursa copulatrix) allow one to consider them as separate species. Moreover, the new species demonstrates significant adaptation to a specific habitat of the thermal spring Khakusy. The water in the spring does not freeze in winter, the temperature of the water changes very little, and the food items like microorganisms, bacterial mats, and vegetable detritus are present during all seasons of a year. However, the two co-existent morphs of G. takhteevi sp. n. are likely to correspond to two interbreeding generations, hatching from eggs, growth and reproduction of which are confined to different seasons. The co-existence of both morphs appears to be constantly maintained, since they have been found over several years of the investigation.

The low level of genetic distances between G. takhteevi sp. n. and G. acronicus from the Krestovka River indicates that a recent divergence of the species happened after the glaciers covering large areas of the northeast coast of Baikal during last glacial period started to melt about 18 kyr BP (Osipov and Khlystov 2010). The adaptation to the thermal conditions of ‘a closed habitat’ formed by island isolation under selective pressures led to an interruption of gene exchange between G. takhteevi sp. n. and G. acronicus, resulting in differences in their morphological and physiological characteristics, and ecological preferences.

We are grateful to Mr. V.I. Egorov for assistance with the scanning electron microscope equipment (Electron Microscope Centre of Collective Instrumental Centre “Ultra microanalysis” at Limnological Institute SB RAS). We are grateful to the reviewer and Dr E. Soldatenko for comments and advices that have improved the content of the article. The study was partly supported by the governmentally funded projects Nos. 0345-2016-0009 (AAAA-A16-116122110067-8) (morphological investigations), 0345-2016-0004 (AAAA-A16-116122110060-9) (molecular analysis), and Russian Foundation for Basic Research, project No 15-29-02515.