Research Article |
|
Corresponding author: Jian-Hua Ding ( 59823039@qq.com ) Academic editor: Rodolphe Rougerie
© 2018 Jun Li, Rui-Rui Lin, Yao-Yao Zhang, Kun-Jie Hu, Ya-Qi Zhao, Yan Li, Zhuo-Ran Huang, Xu Zhang, Xue-Xia Geng, Jian-Hua Ding.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Li J, Lin R-R, Zhang Y-Y, Hu K-J, Zhao Y-Q, Li Y, Huang Z-R, Zhang X, Geng X-X, Ding J-H (2018) Characterization of the complete mitochondrial DNA of Theretra japonica and its phylogenetic position within the Sphingidae (Lepidoptera, Sphingidae). ZooKeys 754: 127-139. https://doi.org/10.3897/zookeys.754.23404
|
In the present study, the complete mitogenome of Theretra japonica was sequenced and compared with other sequenced mitogenomes of Sphingidae species. The mitogenome of T. japonica, containing 37 genes (13 protein-coding genes, 22 tRNA genes, and two rRNA genes) and a region rich in adenine and thymine (AT-rich region), is a circular molecule with 15,399 base pairs (bp) in length. The order and orientation of the genes in the mitogenome are similar to those of other sequenced mitogenomes of Sphingidae species. All 13 protein-coding genes (PCGs) are initiated by ATN codons except for the cytochrome C oxidase subunit 1 gene (cox1) which is initiated by the codon CGA as observed in other lepidopteran insects. Cytochrome C oxidase subunit 2 gene (cox2) has the incomplete termination codon T and NADH dehydrogenase subunit 1 gene (nad1) terminates with TAG while the remainder terminates with TAA. Additionally, the codon distributions of the 13 PCGs revealed that Ile and Leu2 are the most frequently used codon families and codons CGG, CGC, CCG, CAG, and AGG are absent. The 431 bp AT-rich region includes the motif ATAGA followed by a 23 bp poly-T stretch, short tandem repeats (STRs) of TC and TA, two copies of a 28 bp repeat ‘ATTAAATTAATAAATTAA TATATTAATA’ and a poly-A element. Phylogenetic analyses within Sphingidae confirmed that T. japonica belongs to the Macroglossinae and showed that the phylogenetic relationship of T. japonica is closer to Ampelophaga rubiginosa than Daphnis nerii. Phylogenetic analyses within Theretra demonstrate that T. japonica, T. jugurtha, T. suffusa, and T. capensis are clustered into one clade.
Lepidoptera , mitogenome, Sphingidae , Theretra japonica
The Sphingidae (Lepidoptera) moths are commonly known as hawk moths, sphinx moths, or hornworms and include 1,463 species (
Mitochondrial DNA sequences have been widely used to study the molecular evolution of insects due to protein-coding genes (PCGs) sequence conservatism, maternal inheritance, and rapid evolution (
In this study polymerase chain reaction (PCR) amplification, DNA sequencing, and overlapped fragments assembling methods were used to determine the complete mitogenome of T. japonica. The characteristics of the mitogenome were also analyzed and a phylogeny was constructed. These will be helpful to understand the evolutionary position of T. japonica within Sphingidae.
The specimen was collected from Xiangshan mountain, Huaibei city, Anhui province, China (33°59.02'N, 116°48.57'E), and then was preserved in -20 °C refrigerator. Total genomic DNA was extracted from the abdomen of the moth (voucher number TJ20171011) using Ezup Column Animal Genomic DNA Purification Kit (Sangon Biotech, China) following the manufacturer’s instructions. The extracted DNA samples were stored at -20°C. The specimen and the template DNA are respectively deposited in Specimens Room within the Human and Animal Genetics Laboratory, School of Life Sciences, Huaibei Normal University.
The mitochondrial DNA fragments were amplified by PCR method and the total genomic DNAs were used as template. PCR primers were designed according to the conservative sequences of mitochondrial DNA of Lepidoptera insects and showed in Table
Details of the primers used to amplify the mitochondrial DNA of T. japonica.
| Primer name | Orientation | Annealing position (bp) | Nucleotide sequence (5'-3') | PCR length |
|---|---|---|---|---|
| Q1F | F | 1314-1336 | AAACTAATAATCTTCAAAATTAT | |
| Q1R | R | 6236-6213 | AATATTAATGGAATTTAACCACTA | 4923 |
| Q2F | F | 6193-6216 | TAAGCTGCTAACTTAATTTTTAGT | |
| Q2R | R | 9637-9617 | GTTTCAATAATCCGAACTCAT | 3445 |
| Q3F | F | 8601-8618 | CGTCTATGCAATCGCTCA | |
| Q3R | R | 12319-12302 | GCATTACTTGGAGGGTTG | 3719 |
| Q4F | F | 11600-11620 | TCCCTATGTTATTACAGGACA | |
| Q4R | R | 14809-14791 | CCAGCAGTTGCGGTTATAC | 3210 |
| Q5F | F | 14637-14659 | TAATAGGGTATCTAATCCTAGTT | |
| Q5R | R | 1400-1378 | ATATAAAATTGCAAATTTTAAGG | 2163 |
The overlapping fragments were assembled into a complete linear mitochondria DNA sequence using the DNAStar package (DNAStar Inc. Madison, WI, USA), and the mitogenome was annotated using MITOS2 (
To clarify the phylogenetic position of T. japonica within the Sphingidae, all published complete mitogenomes of members of the Sphingidae were collected and their 13-protein amino acid (AA) sequences were incorporated together for alignment and phylogenetic tree construction. Sequences were aligned using ClustalX 2.1 (
The cox1 barcodes (481 barcodes) were gathered for the genus Theretra in BOLD system v4 to construct phylogeny. Those barcodes without gaps or missing nucleotides (total 658 bp in size) were selected to construct ML phylogenetic tree, and finally 285 barcodes (41 species) were utilized. The cox1 sequence of B. mori (AF149768) was used as outgroup. The best model was GTR + G + I. To infer nodal support, bootstrapping was conducted 1000 times.
The complete mitogenome sequence of T. japonica (MG655620) is 15,399 base pairs (bp) in length, shorter than M. sexta but longer than the other 5 species of Sphingidae. It contains 13 PCGs, 22 tRNAs genes, two rRNAs genes, and an AT-rich region with a length of 431 bp (Fig.
The schematic illustration for mitogenome of T. japonica. Gene order and positions are shown. cox1, cox2, and cox3 refer to the cytochrome c oxidase subunits; cob refers to cytochrome b; nad1-nad6 refers to NADH dehydrogenase components; rrnL and rrnS refer to ribosomal RNAs. The bold lines on outer or inner ring represent that the genes lie in the majority-coding strand (J-strand) or the minority-coding strand (N-strand).
The nucleotide composition in J-strand of T. japonica mitogenome is as follows: 6,331 bp (41.11%) A, 6,043 bp (39.24%) T, 1,883 (12.23%) C, and 1,142 bp (7.42%) for G. A+T accounts for 80.36%, which is slightly higher than D. nerii (80.29%) but lower than M. sexta (81.79%), S. morio (81.17%), N. analis (81.79%), A. convolvuli (81.49%), and A. rubiginosa (81.5%) (
In the mitogenome of T. japonica, there are 13 gene overlaps and 15 intergenic spacers (Suppl. material
Base composition of protein-coding, tRNA and rRNA genes, and A+T rich region of T. japonica mitogenome.
| Genes or regions | Size (bp) | Base composition (%) | A+T (%) | AT skewness | GC skewness | |||
| A | T | C | G | |||||
| nad2 | 1014 | 37.87 | 47.14 | 9.66 | 5.33 | 85.01 | -0.109 | -0.289 |
| cox1 | 1536 | 32.42 | 38.61 | 15.63 | 13.35 | 71.03 | -0.087 | -0.079 |
| cox2 | 685 | 37.96 | 39.27 | 13.14 | 9.64 | 77.23 | -0.017 | -0.154 |
| atp8 | 165 | 44.85 | 44.24 | 9.09 | 1.82 | 89.09 | 0.007 | -0.667 |
| atp6 | 678 | 36.28 | 41.89 | 14.16 | 7.67 | 78.17 | -0.072 | -0.297 |
| cox3 | 792 | 34.22 | 39.52 | 14.52 | 11.74 | 73.74 | -0.072 | -0.106 |
| nad3 | 354 | 36.44 | 43.79 | 12.99 | 6.78 | 80.23 | -0.092 | -0.314 |
| nad5 | 1758 | 32.82 | 48.81 | 5.92 | 12.46 | 81.63 | -0.196 | 0.356 |
| nad4 | 1332 | 33.63 | 48.42 | 6.38 | 11.56 | 82.06 | -0.180 | 0.289 |
| nad4L | 291 | 30.93 | 52.58 | 3.78 | 12.71 | 83.06 | -0.259 | 0.542 |
| nad6 | 531 | 40.49 | 45.20 | 8.66 | 5.65 | 85.69 | -0.056 | -0.210 |
| cob | 1149 | 34.64 | 40.82 | 14.45 | 10.10 | 75.46 | -0.082 | -0.177 |
| nad1 | 936 | 30.02 | 48.08 | 7.48 | 14.42 | 78.10 | -0.231 | 0.317 |
| Total | 11221 | 34.50 | 44.38 | 10.53 | 10.59 | 78.88 | -0.125 | 0.003 |
| tRNA | 1465 | 41.77 | 39.32 | 8.05 | 10.85 | 81.09 | 0.030 | 0.148 |
| rRNA | 2048 | 41.50 | 42.24 | 5.08 | 11.18 | 83.74 | -0.009 | 0.375 |
| AT-rich region | 431 | 41.50 | 42.24 | 5.08 | 11.18 | 93.04 | -0.007 | -0.400 |
| Complete mitogenome | 15399 | 41.11 | 39.24 | 12.23 | 7.42 | 80.36 | 0.023 | -0.245 |
The T. japonica mitogenome contains 13 PCGs as expected with a total of 11,221 bp in size. All the PCGs are initiated with ATN codons, except for cox1, which uses CGA as the initiation codon. Most PCGs are terminated with TAA codon while nad1 uses TGA as termination codon. And yet, cox2 has an incomplete termination codon ‘T’. The incomplete termination codon ‘T’ or ‘TA’ could become TAA by posttranscriptional polyadenylation (
The amino acids (AAs) components and their codon usage in the PCGs of T. japonica mitogenome were also analyzed. The results reveal that two codon families (Ile and Leu2) are more than 100 codons per thousand codons (CDpT), six codon families (Asn, Gly, Met, Phe, Ser2, and Tyr) are between 50 CDpT and 100 CDpT, and the other fourteen codon families are less than 50 CDpT (Fig.
The 22 rRNA genes of T. japonica range from 64 bp to 71 bp in size and totally comprise 1,465 bp of the whole mitogenome. Of these genes, 14 are encoded in J-strand and 8 in N-strand just as other Sphingidae moths. The predicted secondary structures of the tRNAs are shown in Figure
Just as the other Sphingidae species there are two rRNA genes in T. japonica with a total length of 2,048 bp. The large ribosomal gene (rrnL) locates between trnL1 and trnV, with a length of 1,284 bp whereas the small ribosomal gene (rrnS) locates between trnV and the A+T-rich region with a length of 764 bp. The AT skew is slightly negative (−0.009), but the GC skew is strongly positive (0.375). The total A+T content of the rRNA genes (83.74%) is higher than that of total tRNA genes (81.09%) and total PCG genes (79.10%).
The A+T rich region locates between rrnS and trnM in T. japonica with 431 bp in length and serves as the initiation of mitochondrial replication in both vertebrates and invertebrates (
Features of the A+T-rich region of T. japonica. The ATATG motif is shaded. The polyT stretch is underlined while the poly-A stretch is double underlined. The TA and GC repeats sequence are indicated by dotted underlining. The 28 bp repeats ‘ATTAAATTAATAAATTAATATATTAATA’ are labeled with wave underlining.
By using the identified cox1 barcode and aligning it with the three barcodes of T. japonica deposited in Bold system v4 we found that the similarities are 100% with GBMIN88089-17 (KX440686, 541 bp) and SOWD617-06 (JN678612, 658 bp), and 99.85% with GBMIN88088-17 (KT988392, 658 bp) respectively. The only mutation of GBMIN88088-17 takes place at the third position nucleotide of a codon for Leucine which mutates from TTA to TTG, but the mutation is synonymous because it does not change its AA code (Fig.
Phylogenetic analyses were firstly based on the sequences of 13 PCGs of seven mitogenomes using NJ and ML Methods. The phylogenetic trees constructed by NJ and ML are consistent with high intermediate bootstrap values (Fig.
Phylogenetic analysis. Phylogenetic tree constructed using NJ and ML methods based on the amino acid sequences of 13 PCGs of 7 species with Bombyx mori (Lepidoptera: Bombycidae) and Antheraea pernyi (Lepidoptera: Saturniidae) as outgroups. The support values at the nodes represent bootstrap values for NJ and ML respectively.
Phylogenetic analysis
List of annotated mitochondrial genes of T. japonica