Research Article |
|
Corresponding author: Hui Wang ( kikihui860425@163.com ) Corresponding author: Baowei Zhang ( zhangbw@ahu.edu.cn ) Academic editor: Angelica Crottini
© 2017 Chencheng Wang, Lifu Qian, Chenling Zhang, Weibo Guo, Tao Pan, Jun Wu, Hui Wang, Baowei Zhang.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Wang C, Qian L, Zhang C, Guo W, Pan T, Wu J, Wang H, Zhang B (2017) A new species of Rana from the Dabie Mountains in eastern China (Anura, Ranidae). ZooKeys 724: 135-153. https://doi.org/10.3897/zookeys.724.19383
|
A new species Rana dabieshanensis sp. n. is described from the Dabie Mountains in Anhui Province, China, based on morphological character differences and molecular analyses. The new species can be distinguished from its congeners by a combination of diagnostic characters. The results of phylogenetic analyses (based on 12s rRNA, 16s rRNA, ND2, Cyt b, RAG1, BDNF and Tyr) and genetic distances (based on Cyt b) indicate that the new species belongs to the Rana longicrus group, and is placed as the sister taxon to R. hanluica.
Amphibians, morphology, molecular phylogeny, taxonomy
The true frogs of the genus Rana Linnaeus are broadly distributed across Eurasia and the Americas (
From 2015 to 2016, we collected 17 specimens of Rana sp. in montane forests of the Dabie Mountains. The specimens exhibited comparatively large body size and a straight dorsolateral fold from posterior corner of eye to groin. Initially, they were identified as R. omeimontis (according to the identification key by
Generally, the brown frogs are difficult to identify in the field because of their close morphological similarities especially when closely related species have overlapping distributions (
Sampling: In total, 17 specimens of Rana sp. were collected from Yaoluoping National Nature Reserve in Dabie Mountains, Yuexi County, Anhui Province, China (30°58'16.92"N, 116°04'11.88"E, elevation 1150 m a.s.l.) (Fig.
DNA extraction, PCR amplification and sequencing: Genomic DNA was extracted from liver tissues of seven Rana sp. specimens using the standard proteinase K/phenol-chloroform protocol (
| Locus | Primer Name | Sequences (5’ end 3’ end) | Temperature (°C) | Source |
|---|---|---|---|---|
| 12S | L2519 | AAACTGGGATTAGATACCCCACTAT | 50 | Kocher et al. (1989) |
| H3296 | GCTAGACCATKATGCAAAAGGTA | 50 | Kocher et al. (1989) | |
| 16S | 16SAR | AACGCTAAGATGAACCCTAAAAAGTTCT | 50 | Kocher et al. (1989) |
| R16 | ATAGTGGGGTATCTAATCCCAGTTTGTTTT | 50 | Sumida et al. (2000) | |
| ND2 | HERP322 | TYCGARGACAGAGGTTTRAG | 42 |
|
| HERP323 | CAYCCACGRGCYATYGAA | 42 |
|
|
| Cyt b | HERP328 | GAAAARCTRTCGTTGTWATTCAACTA | 50 |
|
| HERP329 | CTACKGGTTGTCCYCCRATTCATGT | 50 |
|
|
| Tyr | Tyr1G | TGCTGGGCRTCTCTCCARTCCCA | 50 | Bossuyt and Milinkovitch (2000) |
| Tyr1B | AGGTCCTCYTRAGGAAGGAATG | 50 | Bossuyt and Milinkovitch (2000) | |
| RAG1 | AmpF2 | ACNGGNMGICARATCTTYCARCC | 52 | Hoegg et al. (2004) |
| AmpR2 | GGTGYTTYAACACATCTTCCATYTCRTA | 52 | Hoegg et al. (2004) | |
| BDNF | BDNF 2F | GAGTGGGTCAAGAGGAGG | 41 |
|
| BDNF_2R | ACTGGGTAGTTCGGCATT | 41 |
|
Phylogenetic analyses: 147 sequences were used for genetic analysis, which include 135 sequences within the Chinese Rana were downloaded from NCBI and 12 sequences in this study. The data are summarized in Table
Species, sample localities, voucher museum numbers and GenBank accession numbers for DNA sequences of Rana species used in the phylogenetic analyses.
| Species | Locality | Voucher | GenBank No. | Reference | |||||
|---|---|---|---|---|---|---|---|---|---|
| 12S-16S | Cyt b | ND2 | RAG1 | BDNF | Tyr | ||||
| R. dabieshanensis sp. n. (1) | China: Anhui Province: Dabie Mountains area | AHU2016R001 | MF172963 | MF172964 | MF172974 | MF172971 | MF172972 | MF172973 | This Study |
| R. dabieshanensis sp. n. (2) | China: Anhui Province: Dabie Mountains area | AHU2016R002 | N/A | MF172965 | N/A | N/A | N/A | N/A | This Study |
| R. dabieshanensis sp. n. (3) | China: Anhui Province: Dabie Mountains area | AHU2016R003 | N/A | MF172966 | N/A | N/A | N/A | N/A | This Study |
| R. dabieshanensis sp. n. (4) | China: Anhui Province: Dabie Mountains area | AHU2016R004 | N/A | MF172967 | N/A | N/A | N/A | N/A | This Study |
| R. dabieshanensis sp. n. (5) | China: Anhui Province: Dabie Mountains area | AHU2016R005 | N/A | MF172968 | N/A | N/A | N/A | N/A | This Study |
| R. dabieshanensis sp. n. (6) | China: Anhui Province: Dabie Mountains area | AHU2016R006 | N/A | MF172969 | N/A | N/A | N/A | N/A | This Study |
| R. dabieshanensis sp. n. (7) | China: Anhui Province: Dabie Mountains area | AHU2016R007 | N/A | MF172970 | N/A | N/A | N/A | N/A | This Study |
| R. amurensis | Russia: Tomskaya: Teguldetskii district | MSUZP-SLK-RUS49 | KX269203 | KX269349 | KX269418 | KX269568 | KX269278 | KX269795 |
|
| R. arvalis | Russia: Mordovia: Chamzinskii district | MSUZP-SLK-MKR21 | KX269197 | KX269344 | KX269413 | KX269562 | KX269272 | KX269789 |
|
| R. asiatica | China: Xinjiang: 47tuan | KIZ-XJ0251 | KX021945 | KX021945 | KX021945 | KX269565 | KX269275 | KX269792 |
|
| R. chaochiaoensis | China: Sichuan: Zhaojue | SCUM0405170CJ | KX269192 | KX269339 | KX269408 | KX269557 | KX269267 | KX269800 |
|
| R. chensinensis | China: Shaanxi: Huxian | KIZ-RD05SHX01 | KX269186 | KX269333 | KX269402 | KX269551 | KX269261 | KX269779 |
|
| R. culaiensis | China: Shandong: Culaishan shan | KIZ-SD080501 | KX021986 | KX021986 | KX021986 | KX269555 | KX269265 | KX269783 |
|
| R. dybowskii | Russia: Primorye region: Khasanskii District | MSUZP-IVM-1d | KX021949 | KX021949 | KX021949 | KX269553 | KX269263 | KX269781 |
|
| R. hanluica | China: Guangxi: Maoershan shan | KIZGX07112915 | KX269191 | KX269338 | KX269407 | KX269556 | KX269266 | KX269784 |
|
| R. huanrenensis | South Korea | MMS 231 | KX021944 | KX021944 | KX021944 | KX269548 | N/A | KX269776 |
|
| R. japonica | Japan: Isumi-shi: Chiba Prefecture | KIZ-YPX11775 | KX269220 | KX269364 | KX269434 | KX269585 | KX269295 | KX269811 |
|
| R. jiemuxiensis | China: Hunan: Jiemuxi | KIZ-HUN0708013 | KX269221 | KX269365 | N/A | KX269586 | KX269296 | KX269812 |
|
| R. kukunoris | China: Qinghai: Qinghai Lake | KIZCJ06102001 | KX021947 | KX021947 | KX021947 | KX269550 | KX269260 | KX269778 |
|
| R. kunyuensis | China: Shandong: Kunyu shan | KIZ-HUI040001 | KX269201 | KX269347 | KX269416 | KX269566 | KX269276 | KX269793 |
|
| R. longicrus | China: Taiwan: Xiangtianhu: Miaosu | NMNS15022 | KX269189 | KX269336 | KX269405 | KX269554 | KX269264 | KX269782 |
|
| R. omeimontis | China: Sichuan: Zhangcun: Hongya | SCUM0405196CJ | KX021946 | KX021946 | KX021946 | KX269558 | KX269268 | KX269785 |
|
| R. zhenhaiensis | China: Zhejiang: Zhenhai | KIZ0803271 | KX269218 | N/A | KX269433 | KX269583 | KX269293 | KX269809 |
|
| R. coreana | South Korea | MMS 223 | KX269202 | KX269348 | KX269417 | KX269567 | KX269277 | KX269794 |
|
| R. sauteri | China: Taiwan: Kaohsiung | SCUM0405175CJ | KX269204 | KX269350 | KX269419 | KX269569 | KX269796 | KX269279 |
|
| R. zhengi | China: Sichuan: Hongya: Zhangcun | SCUM0405190CJ | KX269206 | KX269352 | KX269421 | KX269571 | KX269798 | KX269495 |
|
| R. johnsi | Vietnam: Lam Dong: Loc Bao | ABV 00203 | KX269182 | KX269328 | KX269398 | KX269546 | KX269774 | KX269471 |
|
| R. shuchinae | China: Sichuan: Zhaojue | CIB-HUI040009 | KX269210 | KX269356 | KX269425 | KX269575 | DQ360057 | KX269499 |
|
| R. weiningensis | China: Sichuan: Weining | SCUM0405171 | KX269217 | KX269362 | KX269432 | KX269582 | KX269808 | KX269506 |
|
| Pelophylax nigromaculatus | China: Sichuan: Hongya | SCUM-045199CJ | KX269216 | KX269361 | KX269431 | KX269581 | KX269807 | KX269505 |
|
Sequence information (a) and results of model selection by PartitionFinder (b). “V” and “PI” indicated the variable sites and parsimony-informative sites of each locus, respectively.
| (a) | |||
| Sequence name | Sequence length (bp) | V | PI |
| 12-16s rRNA | 1743 | 555 | 336 |
| Cyt b | 834 | 306 | 262 |
| ND2 | 726 | 392 | 323 |
| RAG1 | 1191 | 158 | 86 |
| Tyr | 456 | 73 | 31 |
| BDNF | 454 | 31 | 10 |
| (b) | |||
| Best fit model | Partitions | ||
| GTR+I+G | 12S-16S, ND2-2nd | ||
| HKY+I | RAG-3rd, Tyr-1st, Tyr-3rd, BDNF-1st, BDNF-2nd | ||
| SYM+I+G | Cyt b-1st | ||
| HKY+I+G | ND2-3rd, RAG1-1st, RAG1-2nd, Cyt b-2nd, Tyr-2nd | ||
| GTR+I | ND2-1st, Cyt b-3rd | ||
| K80+I | BDNF-3rd | ||
Apart from phylogenetic tree-based methods, we also calculated pairwise sequence divergence based on uncorrected p-distance using MEGA 5.0 (
Morphological analyses: The morphometric data were examined for 10 individuals. Measurements were made by Yanan Zhang using a vernier caliper with a precision of 0.1 mm. 17 linear measurements (
SVL (snout-vent length, from tip of snout to vent);
HL (head length, from posterior corner of mandible to tip of snout);
HW (head width, the greatest cranial width);
SL (snout length, from tip of snout to the anterior corner of the eye);
IN (internarial distance);
ED (horizontal eye diameter);
IO (interorbital distance, the minimal distance between upper eyelids);
UE (upper eyelid width, the maximal width of upper eyelid);
TD (horizontal tympanic diameter);
LAHL (length of lower arm and hand, from the tip of finger III to the elbow joint);
HAL (hand length, from proximal end of outer palmar tubercle to tip of the third finger);
LAD (diameter of lower arm);
HLL (hind limb length, from the tip of the toe IV to groin);
TL (tibia length);
TW (tibia width, the greatest width of tibia);
FL (foot length, from the proximal end of the inner metatarsal tubercle to the tip of the toe IV) and
TFL (length of tarsus and foot, from the proximal end of tarsus to the tip of the fourth toe IV).
The description of toe webbing followed Savage (1975) (Table
Measurements [in mm; mean±SD (range)] of adult specimens of Rana dabieshanensis sp. n.
| Character | R. dabieshanensis sp. n | ||||
|---|---|---|---|---|---|
| Holotype | Males (8) | Mean±SD | Females (2) | Mean | |
| SVL | 62.8 | 50.9–62.8 | 57.1±4.1 | 53.0–68.3 | 60.7 |
| HL | 17.8 | 16.0–19.0 | 17.8±1.1 | 18.0–19.7 | 18.8 |
| HW | 17.6 | 15.3–18.9 | 17.4±1.1 | 16.7–18.8 | 17.8 |
| SL | 8.4 | 7.5–9.5 | 8.4±0.8 | 7.9–8.5 | 8.2 |
| IN | 5.5 | 3.9–5.5 | 4.5±0.6 | 4.3–4.6 | 4.5 |
| IO | 5.5 | 3.9–5.5 | 4.5±0.6 | 4.3–4.5 | 4.4 |
| UE | 3.6 | 2.9–3.8 | 3.4±0.4 | 3.6–3.7 | 3.6 |
| ED | 4.8 | 4.1–5.7 | 4.8±0.6 | 4.6–4.7 | 4.5 |
| TD | 4.0 | 3.5–5.2 | 4.4±0.6 | 4.2–4.3 | 4.3 |
| LAHL | 27.6 | 21.4–27.6 | 24.7±2.1 | 23.4–26.7 | 24.5 |
| LAD | 8.1 | 5.6–8.1 | 6.6±1.2 | 4.9–8.1 | 5.2 |
| HAL | 14.8 | 13.1–14.8 | 13.8±0.7 | 13.3–13.6 | 13.5 |
| HLL | 129.1 | 100.4–129.1 | 115.5±10.6 | 102.4–121.4 | 111.9 |
| TL | 40.6 | 31.4–40.6 | 35.1±3.3 | 30.4–37.6 | 34.0 |
| TW | 8.4 | 5.9–8.4 | 7.5±0.9 | 6.4–6.7 | 6.5 |
| TFL | 53.2 | 43.1–53.2 | 48.6±3.4 | 44.3–51.2 | 47.7 |
| FL | 35.5 | 27.6–35.1 | 32.8±2.8 | 27.8–35.6 | 31.7 |
Molecular phylogenetic analyses: The BI and ML phylogenetic tree were constructed based on concatenated DNA sequences of the mitochondrial genes and nuclear genes (12S rRNA, 16S rRNA, ND2, Cyt b, Tyr, BDNF, and RAG1) with a total length of the final alignment 5414 bp. Besides, the variable sites and potentially parsimony informative sites are listed in Table
The Bayesian consensus tree resulting from analysis of four mitochondrial genes (12S rRNA, 16S rRNA, ND2 and Cyt b genes) and three nuclear genes (Tyr, RAG1 and BDNF) dataset for Chinese Rana species. The new species is in bold. Number near the nodes are Bayesian posterior probabilities / Maximum Likelihood bootstrap values but only when values are ≥ 0.95 and ≥ 70, respectively.
Furthermore, the nucleotide sequence divergences based on uncorrected pairwise distances model among the 23 brown frog species examined are shown in Table
Based on phylogenetic analysis of both nuDNA and mtDNA genetic markers and genetic distances in Cyt b mtDNA gene, it is demonstrated that the population of Rana sp. from the Dabie Mountains represents a phylogenetically independent evolutionary lineage, and a member of R. longicrus group. It represents a previously undescribed species which is described herein.
The pairwise uncorrected p-distance (%) of the Cyt b partial sequence (834 bp) used in this study. 1: Rana dabieshanensis sp. n; 2: R. culaiensis; 3: Rana longicrus; 4:R. zhenhaiensis; 5:R. chaochiaoensis; 6: R. hanluica; 7: R. huanrenensis; 8: R. japonica; 9: R. jiemuxiensis; 10:R. omeimontis; 11:R. chensinensis; 12: R. dybowskii; 13: R. kukunoris; 14: R. amurensis; 15: R. arvalis; 16: R. asiatica; 17: R. coreana; 18: R. johnsi; 19: R. kunyuensis; 20 : R. sauteri; 21: R. shuchinae; 22: R. weiningensis; 23: R. zhengi. The number in bold present the distance between Rana dabieshanensis sp. n. and the species of Rana analyzed in this study.
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | 22 | 23 | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 0.002 | ||||||||||||||||||||||
| 2 | 0.086 | ||||||||||||||||||||||
| 3 | 0.101 | 0.042 | |||||||||||||||||||||
| 4 | 0.100 | 0.032 | 0.053 | ||||||||||||||||||||
| 5 | 0.160 | 0.148 | 0.159 | 0.141 | |||||||||||||||||||
| 6 | 0.088 | 0.086 | 0.086 | 0.091 | 0.133 | ||||||||||||||||||
| 7 | 0.172 | 0.197 | 0.208 | 0.190 | 0.171 | 0.186 | |||||||||||||||||
| 8 | 0.148 | 0.139 | 0.161 | 0.141 | 0.144 | 0.138 | 0.172 | ||||||||||||||||
| 9 | 0.104 | 0.109 | 0.112 | 0.116 | 0.156 | 0.093 | 0.193 | 0.145 | |||||||||||||||
| 10 | 0.093 | 0.090 | 0.102 | 0.106 | 0.167 | 0.085 | 0.193 | 0.150 | 0.111 | ||||||||||||||
| 11 | 0.178 | 0.178 | 0.190 | 0.176 | 0.156 | 0.180 | 0.063 | 0.160 | 0.186 | 0.191 | |||||||||||||
| 12 | 0.164 | 0.173 | 0.178 | 0.169 | 0.183 | 0.181 | 0.121 | 0.162 | 0.174 | 0.188 | 0.132 | ||||||||||||
| 13 | 0.172 | 0.173 | 0.181 | 0.171 | 0.156 | 0.175 | 0.059 | 0.151 | 0.178 | 0.182 | 0.066 | 0.112 | |||||||||||
| 14 | 0.184 | 0.207 | 0.219 | 0.213 | 0.194 | 0.186 | 0.198 | 0.196 | 0.193 | 0.172 | 0.182 | 0.191 | 0.187 | ||||||||||
| 15 | 0.206 | 0.206 | 0.226 | 0.213 | 0.201 | 0.204 | 0.174 | 0.166 | 0.214 | 0.211 | 0.186 | 0.177 | 0.168 | 0.188 | |||||||||
| 16 | 0.160 | 0.157 | 0.172 | 0.166 | 0.184 | 0.162 | 0.163 | 0.148 | 0.172 | 0.166 | 0.152 | 0.167 | 0.146 | 0.155 | 0.136 | ||||||||
| 17 | 0.199 | 0.197 | 0.206 | 0.195 | 0.194 | 0.190 | 0.209 | 0.204 | 0.191 | 0.196 | 0.191 | 0.189 | 0.189 | 0.144 | 0.199 | 0.180 | |||||||
| 18 | 0.185 | 0.183 | 0.187 | 0.177 | 0.196 | 0.194 | 0.208 | 0.181 | 0.184 | 0.192 | 0.189 | 0.186 | 0.187 | 0.210 | 0.192 | 0.191 | 0.219 | ||||||
| 19 | 0.201 | 0.199 | 0.208 | 0.200 | 0.199 | 0.197 | 0.212 | 0.199 | 0.202 | 0.193 | 0.197 | 0.196 | 0.190 | 0.152 | 0.200 | 0.185 | 0.022 | 0.220 | |||||
| 20 | 0.193 | 0.192 | 0.209 | 0.193 | 0.192 | 0.181 | 0.197 | 0.169 | 0.204 | 0.201 | 0.183 | 0.182 | 0.177 | 0.176 | 0.192 | 0.155 | 0.199 | 0.222 | 0.192 | ||||
| 21 | 0.191 | 0.207 | 0.235 | 0.210 | 0.220 | 0.210 | 0.193 | 0.205 | 0.211 | 0.197 | 0.198 | 0.189 | 0.182 | 0.202 | 0.194 | 0.182 | 0.206 | 0.197 | 0.194 | 0.204 | |||
| 22 | 0.277 | 0.279 | 0.262 | 0.266 | 0.255 | 0.267 | 0.271 | 0.252 | 0.283 | 0.267 | 0.259 | 0.267 | 0.254 | 0.261 | 0.277 | 0.237 | 0.273 | 0.292 | 0.270 | 0.273 | 0.259 | ||
| 23 | 0.203 | 0.195 | 0.202 | 0.185 | 0.192 | 0.201 | 0.198 | 0.194 | 0.193 | 0.211 | 0.191 | 0.203 | 0.185 | 0.217 | 0.192 | 0.194 | 0.226 | 0.046 | 0.222 | 0.229 | 0.204 | 0.282 |
Specimen AHU2016R001, an adult male (Figures
Seven males: AHU2016R002, AHU2016R003, AHU2016R004, AHU2016R005, AHU2016R006, AHU2016R007 and AHU2016R008, collected from the same locality as the holotype by Chencheng Wang between 15 and 20 August 2015. Two adult females, AHU2016R009 and AHU2016R010 collected by Lifu Qian at the same locality and time as the holotype.
The new species is assigned to the genus Rana based on the morphological characteristics typical for this genus, including the possession of a prominent dorsolateral folds, dark temporal mask, and a body that is counter-shaded in various shades of brown. The species can be distinguished from its congeners by the following combination of morphological characteristics: (1) comparatively large body size (SVL 50.9–62.8 mm in males, N = 8 and females 53.0–68.3 mm, N = 2); (2) snout obtusely pointed in lateral view; (3) temporal fold distinct; (4) canthus rostralis distinct; (5) dark mask covering tympanum; (6) tympanum diameter equal to eye diameter (7) head length almost equal with head width (8) distinct transverse grayish brown bars on dorsal surface of lower arms, tarsus, thighs, and tibia; (9) dorsal skin smooth, small granules on legs, large tubercles absent; (10) tips of fingers not expanded, relative finger lengths III > I > IV > II, fingers webbing absent, toes two third webbed, toes webbing formula I 2–1– II 2+– 1+ III 3–2 IV 2–2+ V; (11) gray-blackish nuptial pad prominent and forming two groups in males, with minute nuptial spines; (12) external vocal sac absent; (13) a straight dorsolateral fold from temporal area to groin. (14) dorsum coloration varies from golden to brown.
SVL 62.8 mm. Head length is approximately equal to the head width (HL/HW = 1.01); snout long and rounded in profile, projecting a little beyond the lower jaw; internarial space equal to the interorbital space (INS/IOS = 1); diameter of the eye larger than the width of upper eyelid (ED/UE=1.33); canthus rostralis distinct; tympanum rounded, with the obvious tympanic rim; tongue deeply notched behind; external vocal sacs not discernable; pupil horizontal.
Forelimbs: forearm robust, fingers slender, finger webbing absent; fingertips obtuse with no expansion and lacking circummarginal grooves; relative finger lengths III > I > IV > II; one prominent subarticular tubercle on fingers I and II, two small subarticular tubercles on fingers III and IV; the inner metatarsal tubercle oval-shaped and elongated; outer metatarsal tubercle small rounded; the nuptial pad appeared on the finger I, covered by small black spines and divided into two groups, one near tip lager than the other one.
Hindlimbs: hind limbs long (HLL 129.1 mm, 205.7% of SVL), about 4.7 times than length of forelimbs (LAHL 27.6 mm, 43.9% of SVL); heels overlapping when limbs are held at right angles to body; the tibio-tarsal joint reaches beyond the snout-tip when the hind limb is stretched forward; the relative toe lengths IV > III > V > II > I; toes two third webbed, toes webbing formula: I 2 – 1– II 2+– 1+ III 3 – 2 IV 2 – 2+ V and the webbing of the toe IV reaches as far as the penultimate distal joint; toe tips rounded, lacking circummarginal grooves; three tubercles on the IV toes, two tubercles on II III and V toes, one tubercle on I toe; the inner metatarsal tubercle ovoid, small but distinct; without outer metatarsal tubercles.
Skin: skin on dorsum is smooth while some small tubercles present on the body flanks and mouth angle; a mass of small tubercles on the dorsal surfaces of thighs and shanks while little warts on forelimb basis; a triangular gray patch behind the eye and anterior to the temporal fold; temporal fold distinct, extending from posterior margin of eye above and behind tympanum to above arm insertion; dorsolateral fold obvious and straight from the temporal area to groin; the throat, chest, belly and ventral surfaces of thighs being smooth with irregular black spots.
Coloration: in life and in preservative: in life, the iris is golden with a black pupil, two dark spots near pupil edges in the anterior and posterior edges of eye and a dark vertical bar in the lower half of iris; the color of the dorsal side changes according to environment, from golden to light brown; lip is golden brown with darker brown markings lasting from the area under the eye towards nostrils and snout tip; the mandible whitish with unclear gray spots; large triangular brown patch behind the eye and anterior to temporal fold; forelimbs dorsally the same color as the dorsal surface of body, with four faint ash black stripe in the forearm; the dorsum of the thigh and tibia is a grayish brown, with nine ash black stripes; the sides of the tarsus and foot are grayish brown with three ash black bars; throat, chest, and belly white with irregular black spots; nuptial pad grayish brown. In preservative, dorsal surface gray-brown; all ash black fade to black; throat, chest, and abdomens fade to creamy white, with gray spots.
A volar view of the left hand of the holotype in life (AHU2016R001, male) B volar view of the right hand of female paratype in preservative (AHU2016R010, famle) C thenar view of the right foot of the holotype in life (AHU2016R001, male) D thenar view of the right foot of the female paratype in preservative (AHU2016R010, famle).
Morphometric data were summarized in Table
SVL: 62.8; HW: 17.6; HL: 17.8; SL: 8.4; IN: 5.5; IO: 5.5; UE: 3.6; ED: 4.8; TD: 4.0; LAHL: 27.6; LAD: 8.1; HAL: 14.8; HLL: 129.1; TL: 40.6; TW: 8.4; TFL: 53.2; FL: 35.5.
The epithet of the new species “dabieshanensis” is a Latinized toponymic adjective derived from the Dabie Mountains in central China where the new species was discovered.
We recommend the “Dabie Mountain Brown Frog” as a common name of the new species in English; “Da Bie Shan Lin Wa” in Chinese.
Rana dabieshanensis sp. n. appears closely associated with high altitudes of the southeastern mountains environments. Specimens were found at night between 20:00 and 01:00 h around a water pool in Yaoluoping National Nature Reserve, Yuexi, Anhui province, China (Figure. 1). The surrounding habitat consists of small hardwoods, mixed with shrubs and vines. Most of the specimens were found in grass nearby the water, few frogs were in the water. Air temperature was about 13.6 to 17.1 °C and water temperature about 12.1 °C to 14.7 °C. The relative humidity in this area was from 62 to 81%. Other amphibian species include R. chensinensis, Rhacophorus anhuiensis, Pelophylax nigromaculata, Fejervarya multistriata, and Yerana yei was also recorded during field survey in Yaoluoping National Nature Reserve (
Currently, Rana dabieshanensis sp. n. is only found in the Yaoluoping National Nature Reserve (Anhui Province). This species might be found in other regions of the Dabie Mountains.
Rana dabieshanensis sp. n. differ from the Chinese species of the genus Rana by following morphological characters: (1) without black glandular ridge in scapular region (vs. an inverted V-shaped black glandular ridge in scapular region in R. chaochiaoensis, R. hanluica, R. longicrus, R. omeimontis, R. maoershanensis, R. huanrenensis, R. japonica, and R. jiemuxiensis); (2) smooth dorsum without tubercles (vs. many tubercles on the dorsolateral surface in R. arvalis, R. amurensis, R. asiatica, R. dybowskii, R. japonica and R. kukunoris) ; (3) tympanum diameter equal to eye diameter (TD 3.5–5.2 mm, ED 4.1–5.7 mm N=8) (vs. tympanum diameter being 2/3 times of eye diameter in R. chaochiaoensis (TD 3.0–5.5 mm, ED 4.3–6.3 mm N = 22), R. hanluica (TD 3.5–4.8 mm, ED 5.2–7.8 mm N = 16), R. omeimontis (TD 4.0–5.5 mm, ED 5.4–6.9 mm N = 20), R. zhenhaiensis (TD 2.5–4.0 mm, ED 5.0–6.4 mm N = 25) and R. culaiensis (TD 3.4–4.3 mm, ED 5.1–6.7 mm N = 5), R. japonica (described by Stejneger and Matsui in 1907); tympanum diameter being 1/2 times of eye diameter in R. maoershanensis (TD 3.4–3.8 mm, ED 6.1–6.7 mm N = 3), R. huanrenensis (TD 1.9–3.0 mm, ED 4.0–7.0 mm N = 15), R. kunyuensis and R. chensinensis (TD 2.5–3.0 mm, ED 5.3–6.0 mm N = 8); tympanum diameter being 3/4 times of the eye diameter in R. jiemuxiensis (TD 2.5–4.1 mm, ED 2.8–4.2 mm)); (4) internarial distances almost equal to interorbital distances (IOS 3.9–5.5 mm, INS 3.9–5.5 mm N = 8) (vs. interorbital distances larger than internarial distances of in R. chaochiaoensis (IOS 5.2–8.2 mm, INS 2.7–4.7 mm N=20), R. jiemuxiensis (IOS 4.3–7.5 mm, INS 2.5–3.8 mm); internarial distances larger than interorbital distances of in R. maoershanensis (IOS 3.1–3.3 mm, INS 4.5–5.5 mm, N = 3)); (5) interorbital distances larger than width of upper eyelid in R. dabieshanensis (IOS 3.1–5.5 mm, UE 2.9–3.8 mm N = 8) (vs. interorbital distances almost equal to upper eyelid in R. hanluensis (IOS 3.3–4.5 mm, UE 3.1–4.3 mm N = 16), R. huanrenensis (IOS 2.9–4.0 mm, UE 3.0–4.0 mm N = 15) and R. chensinensis (IOS 2.9–4.0 mm, UE 3.0–4.0 mm N = 8); upper eyelid interorbital larger to interorbital distances in R. zhenhaiensis (IOS 2.3–3.4 mm, UE 3.5–4.5 mm N = 25), R. kukunoris (IOS 2.4–3.1 mm, UE 3.8–4.9 mm N = 5), R. dybowskii (IOS 3.0–4.0 mm, UE 4.1–5.8 mm N = 25) and R. amurensis (IOS 2.6–3.5 mm, UE 3.5–5.2 mm N = 21)); (6) distinct canthus rostralis (vs. not distinct canthus rostralis in R. longicrus); (7) the relative finger lengths IV > I > III > II in Rana dabieshanensis sp. n (vs. finger lengths III > IV> I > II of R. hanluica, R. luanchuanensis, and R. longicrus); (8) thicker lower arm, LAD 4.9–8.1 mm in males (LAD/SVL radio 0.13) and 5.1–5.3 mm in females (LAD/SVL radio 0.10) (vs. LAD 3.6–4.5 mm (LAD/SVL 0.09) in males (N = 8) and 3.4–4.5 mm (LAD/SVL 0.08) in females (N = 7) of R. chensinensis). (9) long hind limb (HLL 100.4–129.1 mm N = 8) (vs. in R. chaochiaoensis (HLL 92.0–100.0 mm N = 20), R. longicrus (HLL 70.8–84.8 mm N = 20), R. zhenhaiensis (HLL 73.4–100.0 mm N = 25), R. chensinensis (HLL 80.0–97.0 mm N = 8), R. kukunoris (HLL 80.0–99.0 mm N = 5), R. arvalis (HLL 61.1–82.4 mm N = 16) and R. huanrenensis (HLL 61.4–84.5 mm N = 15); (10) toes being webbed on two thirds (vs. toes fully webbed in R. chaochiaoensis and R. huanrenensis); (11) larger body sizes, SVL: males 50.9–62.8 mm, N = 8 and females 53.0–68.3 mm, N = 2 (vs. SVL: males 35.6–49.9 mm and females 34.1–53.6 mm in R. jiemuxiensis, SVL: males 39.0–46.9 mm, N = 15 and females 42.4–49.0 mm, N = 8 in R. huanrenensis, SVL: males 27.2–33.0 mm, N = 12 and females 23.7–41.2 mm, N = 25 in R. luanchuanensis); (12) a straight distinct dorsolateral fold lasting from the temporal region to groin in Rana dabieshanensis sp. n (vs. dorsolateral fold curved above the tympanum of R. longicrus, R. zhenhaiensis, R. maoershanensis, R. jiemuxiensis, R. chensinensis, R. huanrenensis, R. arvalis, R. amurensis, R. asiatica, R. dybowskii, R. kukunoris, R. kunyuensisR. luanchuanensis, and R. culaiensis).
The Chinese species of the genus Rana were divided into three species groups based on external morphology (
In the last decades, different opinions have been proposed on the distribution of Rana species in the Dabie Mountains of central China. Initially, the brown frog species found in the Dabie Mountains was identified as R. japonica Boulenger, 1879 (
During recent research in the Dabie Mountains, many endemic species like Moschus anhuiensis (
For supporting our surveys, we would like to thank the Administration Office of the Yaoluoping National Nature Reserve of Anhui Province. We also want to thank Lifu Qian for his help with collecting specimens. We are especially appreciative for the guidance provided by Yanan Zhang on morphological measures. Editorial assistance provided by Stephen Maciejewski. And finally, we would like to thank the three reviewers (Xiaobing Wu, Nikolay Poyarkov, and an anonymous reviewer) for their constructive suggestions. This work was supported by the Graduate Student Academic Innovation Research Project of Anhui University (yqh100087) and National Key Research and Development Program (2016YFC1200705).