Predatory carp (Fig. 1A) were collected from the Lancang River (Nanjian River basin) in July 2024, while Kanglang fish (Fig. 1B) were collected from a fish farm in Kunming in November 2024. Hosts were first anesthetized and euthanized, after which the gill was excised and examined under a dissecting microscope. Individual diplozoids were removed by using a fine brush and an anatomical needle. Diplozoids were water-mounted, photographed under a compound microscope (Olympus CX-41), and their whole body, oral sucker, pharynx, central hooks and clamps were subsequently observed and measured as straight-line distances between the extreme ends using Capture 3.0 (Tucsen Photonics Co., Ltd). The illustrations are taken with a light microscope and with the aid of a drawing digital board (Wacom Intous Pro), then processed on a computer using Photoshop CS4.0 (Adobe, San Jose, CA, USA).

Figure 1. 

Host fish. a. Chanodichthys erythropterus Basilewsky, 1855; b. Anabarilius graham Regan, 1908.

Diplozoid specimens preserved in ethanol were retrieved using a fine brush and gradually rehydrated through an ethanol gradient. The specimens were sequentially transferred into Petri dishes containing 90%, 80%, 70%, and 50% ethanol, each for 3 h. Following this, the specimens were transferred to Petri dishes containing distilled water and left overnight. Once the diplozoids had regained sufficient flexibility, they were placed on water-filled glass slides. Coverslips were gently applied using forceps and fixed at the corners with nail polish. The slides were then placed in Petri dishes containing Bouin’s solution for fixation for 5–7 h. After fixation, the nail polish was carefully removed with a dissecting needle, and the coverslips were gently lifted to avoid tearing the specimens. The parasites were then transferred to clean water and washed for 1 h, with the water replaced frequently during the process.

The washed specimens were transferred into Petri dishes containing alum carmine staining solution and stained for 12 h. During the staining process, specimens were briefly removed using a fine brush, rinsed with water, and examined under a microscope to monitor staining progress. After staining, the specimens were rinsed several times with distilled water. Differentiation was carried out under a microscope using acid alcohol for 20–30 s until internal structures became clearly visible. If the specimens appeared under-stained after differentiation, restaining with alum carmine solution was performed. Following differentiation, the specimens were dehydrated through a graded ethanol series of 70%, 80%, 90%, 100% I, and 100% II, each for 2 h. They were then treated with a xylene: ethanol mixture (1:1, v/v) for 1 h and cleared in cedarwood oil for 12 h. The cedarwood oil was subsequently removed with xylene. Finally, the specimens were mounted on clean glass slides using neutral balsam and labeled accordingly (Bai et al. 2014; Bai 2015; Meng 2017).

Genomic DNA was extracted from the parasites using the TIANamp Micro DNA Kit (Beijing, China), following the manufacturer’s protocol. The ITS2 region of the genomic DNA was amplified using universal primers (Matejusová et al. 2001):

D (5′–GGCTYRYGGNGTCGATGAAGAACGCAG–3′)

B1 (5′–GCCGGATCCGAATCCTGGTTAGTTTCTTTTCC–3′)

Polymerase Chain Reaction (PCR) amplification was performed in a 50 μL reaction mixture containing 2 μL DNA template, 19 μL reaction buffer (including dNTPs, 10 × buffer, and Taq polymerase), 2 μL of each primer, and 25 μL of double-distilled water. The thermal cycling conditions were as follows: an initial denaturation step at 90 °C for 10 min, followed by 30 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 75 s, with a final extension step at 72 °C for 10 min.

PCR products were visualized on 1% agarose gels stained with GoodView (Tanon). DNA fragments were sequenced, and the resulting sequences were submitted to the National Center for Biotechnology Information (NCBI) database for BLAST searches. Eighteen diplozoid sequences were selected from NCBI, and a phylogenetic analysis was conducted incorporating these species along with those collected in the present study (Suppl. material 1: table S1). Base composition data, parsimony and nucleotide substitutions between pairwise distances (Kimura 2-parameter) were estimated using MEGA 6.0 and BLAST from NCBI. The robustness of topologies was assessed by 1000 bootstrap replicates. Neoheterobothrium hirame Ogawa, 1999 (Monogenoidea, Diclidophoridae) was used as the outgroup.

The statistical analysis of experimental data was conducted using the SPSS 21.0 software package. To examine the relationship between structural size and different life cycle stages, a one-way repeated measures ANOVA (Analysis of variance) was employed. The LSD (Least Significant Difference) multiple comparison was performed to further investigate which groups exhibit significant differences. Results are presented as mean ± SE (standard error of the mean), with p < 0.05 (Probability value) indicating a significant difference and p < 0.01 indicating a highly significant difference. In the statistical analysis, stage 1 through 7 represent the following developmental stages: Oncomiracidium (Stage 1), diporpa with one pair of clamps (Stage 2), diporpa with two pairs of clamps (Stage 3), diporpa with three pairs of clamps (Stage 4), juvenile with three pairs of clamps (Stage 5), juvenile with four pairs of clamps (Stage 6), and adult (Stage 7).

LSD: Least significant difference; ANOVA: Analysis of variance; SE: Standard error of the mean; ME: Minimum evolution; F: F-ratio (F statistic); p: P-value (Probability value); μm: micrometer.

In this study, 8 adult diplozoid specimens were collected from a single host fish of the predatory carp from the Nanjian River basin of the Lancang River. Additionally, 91 specimens representing various developmental stages, including two eggs, were collected from 6 Kanglang fish from a fish farm in Kunming (Suppl. material 1: table S2).

The diplozoid specimens collected from the predatory carp and Kanglang fish exhibited highly similar morphological characteristics. The body surfaces are smooth, lacking folds; the testes are composed of five lobules; the eggs are oval in shape and equipped with polar filaments. Additionally, a disc-shaped muscular thickening is present posterior to the copulatory union region.

Both of them lack round glands in the anterior region of the buccal suckers, display a widened area with a disciform structure between the posterior and reproductive fusion areas, and have no special lobed enlargement as observed in Eudiplozoon nipponicum (Goto, 1891) Khotenovsky, 1985 (Fig. 2A). Owing to our specimens having these unique morphological features, they were identified as a species of Sindiplozoon (see Wu et al. 2000).

Figure 2. 

Stained specimen and hand-drawn ink drawing of Sindiplozoon coreius Cao, 2022. a. Stained specimen; b. Adult; c. Clamp; d. Central hooks; e. Egg. Scale bars: 1 mm (a, b), 50 μm (c), 20 μm (d), 100 μm (e).

The adult specimens measured an average length of 5226 ± 304 μm (N = 7) (Suppl. material 1: table S3). The intestine was centrally located, extending to the body fusion area (Fig. 2A). The intestine lacks branches in the body fusion area, and long branches extend from the widened area to the first clamp. The vitelline follicles of specimens are numerous and located at the anterior part of the body. Ovary single, ovoid in outline, located in the anterior part of the fusion area. Testis single, composed of 5 ovoid subcomponents, posterior to the ovary. The gonads are distributed in the anterior part of the body fusion area and around the genital organs. Eggs elliptical with long, curly filament attached to operculum, 333 ± 35 μm (N = 2) ×108 ± 8 μm (N = 2) (Fig. 2D).

Four pairs of clamps and one pair of central hooks are present on the haptors. Clamp I, smallest, 67 ± 1 μm (N = 3) × 94 ± 3 μm (N = 3). Clamp II 64 ± 1 μm (N = 3) × 105 ± 2 μm (N = 3). Clamp III, largest, 64 ± 1 μm (N = 3) × 108 ± 2 μm (N = 3). Clamp IV 61 ± 1 μm (N = 3) × 94 ± 3 μm (N = 3) (Suppl. material 1: table S3). The clamps were composed of sclerotized structures. The median sclerite was U-shaped, with a thickened anterior end forming a trapezoid outgrowth (Fig. 2B). The anterior clamp jaw consists of two curved sclerites, while the posterior clamp jaw comprised medial and lateral parts. Both the anterior arch of the anterior clamp jaw and the medial part of the posterior jaw lacked cross-striation. The central hooks, located between the terminal protrusion of the haptor and the first pair of clamps are formed by a handle and a sickle through a connection. The sickle was curved toward the handle and had a winged end that bent toward the connection. Central hook crochet en fléau 24 ± 1 μm (N = 3), handle 50 ± 1 μm (N = 3) (Suppl. material 1: table S3) (Fig. 2C).

BLASTN analysis of the ITS2 sequences amplified from the diplozoid specimens collected from predatory carp (829 bp) and Kanglang fish (811 bp) both revealed 99.58% similarity to a sequence ascribed to Sindiplozoon coreius (GenBank No. MW992745, 721bp). The ITS2 sequences were deposited in GenBank under the following accession numbers: PQ684283 and PQ684284.

According to the rooted condensed tree (with 72% cut-off value) based on the ME (Minimum Evolution) analysis method, our sequences were positioned in a clade comprising other Sindiplozoon spp. (Fig. 3). All S. coreius sequences reovered in a clade sister to S. ctenopharyngodoni Ling, 1973 (GenBank No. DQ098898) from this study clustered in a single branch representing S. coreius, forming a sister group with Paradiplozoon and Diplozoon species (Fig. 3). Comparison with 20 previously submitted diplozoid sequences (Suppl. material 1: table S4) further validated the homogeneity and genetic similarity of the ITS2 sequences obtained in this study. The closest related sequences were those of S. coreius reported from Coreius guichenoti in China.

Figure 3. 

The rooted condensed tree (with 72% cut-off value) based on the ME analysis method. The monogenean Neoheterobothrium hirame Ogawa, 1999 was used as the outgroup. *New sequence obtained in the present study.

The identification of the parasites from the two host species as S. coreius was supported by both morphological characteristics and molecular phylogenetic analyses based on nucleotide sequences.

The egg is located in the anterior part of the reproductive fusion area of the adult S. coreius. It is ovoid in shape, smooth, without any protruding surface. A long, coiled filament is attached to the operculum located at one pole of the egg. In this study, two eggs were observed. One egg was located in utero (Fig. 4B), with its filaments neatly coiled. While the other had already been deposited and its filaments are disordered (Fig. 4A).

Figure 4. 

The egg of Sindiplozoon coreius Cao, 2022. a. Egg; b. Egg in utero; operculum (arrow). Scale bars: 200 μm (a, b).

The oncomiracidium hatches from the egg and has cilia on the tegument. The anterior part of the oncomiracidium contains an open mouth, paired buccal suckers, and a pharynx situated posterior to the buccal suckers. A circular sucker is positioned centrally on the ventral side of the body. The posterior portion of the worm is equipped with a pair of small central hooks and a pair of bilateral clamps (the first clamp) (Fig. 5).

Figure 5. 

The oncomiracidium of Sindiplozoon coreius Cao, 2022. bs: buccal suckers; c: cilia; ph: pharynx; vs: ventral sucker; cl: clamps; ch: central hooks. Scale bar: 100 μm.

Once the oncomiracidium attaches to the gill of the host, the cilia are shed, the central hooks stop growing (Fig. 14), and additional clamps begin to develop (Fig. 6). The second and third clamp pairs form alongside the ventral sucker in the haptor, and a protuberance forms on the dorsal surface. Worms that do not pair with another individual at this stage can still develop a fourth clamp pair (Fig. 7A).

Figure 6. 

The diporpa of Sindiplozoon coreius Cao, 2022 with 1–3 pairs of clamps. a, b. Diporpa of one pair of clamps; c. Diporpa of two pairs of clamps; d. Ventral sucker, pharynx and buccal suckers; e, f. Diporpa of three pairs of clamps. bs: buccal suckers; ph: pharynx; vs: ventral sucker. Scale bars: 200 μm (a–c, e, f); 100 μm (d).

Figure 7. 

The diporpa of Sindiplozoon coreius Cao, 2022 with 4 pairs of clamps. a. Whole body; b. Buccal suckers and pharynx; c. Ventral sucker; d. Haptor. Scale bars: 500 μm (a); 100 μm (b–d).

During the juvenile stage, pairing is usually initiated after the third clamp pair develops. Two individuals join at the dorsomedian protuberance formed in the diporpa stage and suck onto one another with their ventral suckers (Fig. 8A), with both individuals forming a permanent X-shaped structure (Fig. 9A, B). At this stage, the first and second pairs of clamps are fully developed, while the third pair of clamps remains incomplete (Fig. 9), and the fourth pair begins forming. In this early period, it is common for three pairs of clamps to form an X-shaped permanent pair; however, three pairs of clamps with four pairs of clamps have also been observed (Fig. 10). The juvenile worm is relatively small, with immature internal reproductive genitalia. The fusion area is not yet fully developed, and the ventral sucker remains visible. Our observations show that the fusion areas of two paired worms twist together, but the edges are distinct, indicating incomplete fusion (Fig. 11).

Figure 8. 

The juvenile of Sindiplozoon coreius Cao, 2022 with 3 pairs of clamps. a. Whole body; b. Haptor. ms: median scleritc; acj: anterior clamp jaw; pcj: posterior clamp jaw. Scale bars: 500 μm (a); 100 μm (b).

Figure 9. 

The juvenile of Sindiplozoon coreius Cao, 2022 with 4 pairs of clamps. a–c. Whole body of S. coreius with 4 pairs of clamps; d. Pharynx and buccal suckers; e. Posterior; f. Central hooks. Scale bars: 500 μm (a–c); 200 μm (d, e); 50 μm (f).

Figure 10. 

The juvenile of Sindiplozoon coreius Cao, 2022. bs: buccal suckers; m: mouth; ph: pharynx; vs: ventral sucker; cl: clamps; ch: central hooks; apb: anterior part of body; ppb: posterior part of body. Scale bar: 500 μm.

Figure 11. 

The juvenile of Sindiplozoon coreius Cao, 2022. a. Whole body; b. Fusion area. Scale bars: 500 μm (a); 200 μm (b).

Unpaired worms observed with four clamps suggest that delayed pairing allows for continued clamp development.

The adult stage of S. coreius is characterized by the permanent fusion of two individuals into a distinct X-shape (Fig. 12). The mouth is located on the anterior ventral side, accompanied by a pair of round buccal suckers with horizontal striations on the dorsal side. The pharynx lies posterior to the buccal suckers, and the intestine extends into the fusion area. Between the fusion area and the posterior end, a muscular, nearly circular “Cup-like” (Cao et al. 2022) widened area is present on both the dorsal and ventral surfaces (Fig. 12B).

Figure 12. 

The adult of water-sealed microslides of Sindiplozoon coreius Cao, 2022. a. Extended state of the whole body; b. Hindbody of adult; c. Contraction state of the whole body. wa: widened area. Scale bars: 2 mm (a, c); 500 μm (b).

The posterior end of the worm features four pairs of clamps and a single pair of central hooks (Fig. 12B). An oval ovary is located in the fusion area anteriorly, and a single testis comprising five subcomponents that are ovoid in outline and located posterior to the ovary (Fig. 13D). The gonads are distributed in the anterior part of the fusion area. The egg, found in the uterus, is oval with a thin, curly filament attached to the operculum. A suture between the operculum and the egg was clearly observed. (Fig. 13B).

Figure 13. 

The adult of Sindiplozoon coreius Cao, 2022 with egg. a. Whole body; b. Buccal suckers and pharynx; c. Egg; d. Fusion area; e. Egg; ut: uterus; o: ovary; t: testis; i: intestine. Scale bars: 2 mm (a); 200 μm (b); 200 μm (c); 500 μm (d).

Figure 14. 

Growth of different structures at different stages life cycle of Sindiplozoon coreius Cao, 2022. a. Growth of total body at different stages of the life cycle; b. Growth of buccal sucker at different stages of the life cycle; c. Growth of pharynx at different stages of the life cycle; d. Growth of central hook at different stages of the life cycle; e. Growth of clamp I at different stages of the life cycle; f. Growth of clamp II at different stages of the life cycle; g. Growth of clamp III at different stages of the life cycle; h. Growth of clamp IV at different stages of the life cycle (data of diporpa, which have 4 pairs of clamps, were not used in the figure; buccal suckers and clamps are plotted by means of the average value of the left and right structures. 1. Oncomiracidium, 2. Diporpa with 1 pair of clamps, 3. Diporpa with 2 pairs of clamps, 4. Diporpa with 3 pairs of clamps, 5. Juvenile with 3 pairs of clamps, 6. Juvenile with 4 pairs of clamps, 7. adult).

The life cycle of S. coreius involves several distinct stages:

• Egg:

• The egg is oval, approximately 333 μm in length and 108 μm in width, with an operculum and a long filament attached to it.

• Oncomiracidium:

• After hatching, the oncomiracidium is ciliated, allowing it to swim freely and locate a host. It has a pair of small central hooks, a single pair of clamps, buccal suckers, a pharynx, and a ventral sucker.

• Diporpa:

• Upon attaching to the gill of the host, cilia are shed, central hooks and ventral sucker develop fully. Additional pairs of clamps (second and third) form sequentially. Unpaired worms can develop a fourth pair of clamps independently.

• Juvenile:

• Worms pair permanently, forming an X-shaped structure. The first and second pairs of clamps are fully developed, while the third pair is incomplete, and the fourth pair is beginning to form. The ventral sucker remains visible, and internal organs are still underdeveloped.

• Adult:

• The fusion of two worms is complete, resulting in a mature X-shaped structure. The fourth pair of clamps is fully developed, and the reproductive system is mature. The adult body length is approximately 21 times that of the oncomiracidium stage.

In the LSD multiple comparison test, significant increases in both body length and width were observed over time. The ANOVA results show that F (F statistic) = 37.959 (p = 0.000) for body length and F = 23.722 (p = 0.000) for body width, indicating significant differences among the groups for both body length and body width. Furthermore, the results of the LSD test provide additional support for this conclusion. The body length difference between stages 6 and 7 was highly significant (p < 0.001), with stage 7 being larger than stage 6 (p < 0.001). Similarly, body width differences between stage 7 and earlier stages (2–6) were also highly significant (p < 0.001) (Suppl. material 1: table S5).

As the life cycle progressed, the mean difference between buccal sucker length and width increased. The ANOVA results show that F = 60.837 (p = 0.000) for the length of the buccal sucker and F = 46.522 (p = 0.000) for the width of the buccal sucker, indicating significant differences among the groups for the buccal sucker. The results of the LSD test provide additional support for this conclusion. In stage 7, both measurements were significantly greater than in earlier stages (p < 0.001). The buccal sucker dimensions in stage 6 were higher than in stages 1–4 (length, p < 0.001; width, p = 0.001), but still lower than in stage 7 (p < 0.001) (Suppl. material 1: table S5).

The ANOVA results show that F = 37.761 (p = 0.000) for the length of pharynx and F = 10.949 (p = 0.000) for the width of pharynx, indicating significant differences among the groups for pharynx. The results of the LSD test provide additional support for this conclusion. Pharyngeal length and width increased gradually, with no significant differences in stages 2–5 (p > 0.05). Stage 6 showed significant increases in pharyngeal length compared to stages 2 and 3 (between Stage 2 and Stage 6, p = 0.009, between Stage 3 and Stage 6, p = 0.029), and both dimensions were significantly greater in stage 7 (p < 0.001) (Suppl. material 1: table S6).

The ANOVA results show that F = 8.676 (p = 0.000) for the central hook handle and F = 14.090 (p = 0.000) for the central hook crochet en fléau, indicating significant differences among the groups for the central hook. The results of the LSD test provide additional support for this conclusion. The length of the central hook handle and crochet en fléau showed significant growth from stage 1 to 2 (p < 0.001), but subsequent growth was slower, indicating the most substantial changes occurred early in development (Suppl. material 1: table S6).

The ANOVA results for the length of clamp I analysis showed F = 21.550 (p = 0.000), and for the width analysis, F = 19.209 (p = 0.000). For clamp II, the length analysis was F = 36.965 (p = 0.000), and for the width analysis, F = 58.493 (p = 0.000). In clamp III, the length analysis was F = 69.849 (p = 0.000), and the width analysis, F = 112.772 (p = 0.000). The results of the LSD test provide additional support for this conclusion. Clamp I dimensions showed a gradual increase from stage 1 to 7, with significant differences between most stages. Stage 7 had significantly greater length and width than stages 1–4 (stage 1 to 3, p < 0.001; stage 4, p = 0.010), but no significant differences from stages 5 and 6 (stage 5, p = 0.055; stage 6, p = 0.357). For Clamp II, stage 3 had significantly smaller dimensions than stages 4–7 (the length of stage 4, p < 0.001, the width of stage 4, p = 0.001, stage 5 to 7, p < 0.001). No significant differences in Clamp II length were found between stages 4 and 5 (p = 0.112), and no significant differences were found between stages 6 and 7 (p = 0.267). Clamp III showed significant growth from stage 4 to 6 (length of stage 4 to stage 5, p = 0.003, other stages, p < 0.010), but growth slowed from stage 6 to 7, with width showing a significant difference (p = 0.010), while length did not (p = 0.420) (Suppl. material 1: table S7).

In summary, body length and width, oral sucker dimensions, and pharyngeal dimensions all exhibit a gradual increase over time, with significant growth observed between stages 6 and 7. The development of the central hook handle and crochet en fléau shows rapid growth during the transition from the oncomiracidium to the diporpa stage, followed by a slower growth phase. In contrast, the clamps show more continuous growth, reaching a key developmental peak during the adult stage.

The authors have declared that no competing interests exist.

All procedures contributing to this work comply with the ethical standards of the relevant national and institutional guides on the care and use of laboratory animals, and the study was approved by the Animal Care and Use Committee of Yunnan Normal University.

No use of AI was reported.

The National Natural Science Foundation of China (32060115, 31260507, 31560589), Yunnan Province Basic Research Program Project (202301AT070087). This article is also supported by the Open Fund of the College of Life Sciences, and the Doctoral Start-up Fund of Yunnan Normal University.

LS participated in the sample collection, molecular lab work, data analysis, manuscript preparation. ZYZ, TJ, JDX, HJT, YYH, TJ, WJX both participated in the sample collection and data analysis. FYM, LXF participated in the revisions and additions to the article. All authors revised the manuscript, and read and approved the final version for publication.

Lu Shen https://orcid.org/0009-0002-5081-4670

Zhuo-Yu Zhao https://orcid.org/0009-0003-7343-3149

Ting Jiang https://orcid.org/0009-0007-8550-7095

Jun-Dong Xu https://orcid.org/0009-0008-4554-0218

Han-Ji Tian https://orcid.org/0009-0004-7697-5426

Ting Jia https://orcid.org/0000-0001-8417-0709

Fei-Yan Meng https://orcid.org/0009-0007-7917-8563

Li-Xian Fan https://orcid.org/0000-0001-9646-0869

The sequence data analyzed in this study consist of ITS2 sequences, including publicly available sequences retrieved from GenBank (accession numbers: DQ098893, DQ098894, DQ098897, KP340974, MT028131, KP340973, OP588755, AJ563372, AF369759, MF460994, AF369761, AF369758, LC517172, DQ098898, MW992745, OL961699, OL961698, OL961697) and newly submitted sequences by the authors (accession numbers: PQ684283, PQ684284). The processed data and the results of statistical analysis are included in the text.