Research Article
Print
Research Article
Four new species of genus Acmella W.T. Blanford, 1869 (Gastropoda, Assimineidae) from Southern Thailand
expand article infoKunya Seedee‡, Pongrat Dumrongrojwattana§, Supattra Poeaim‡
‡ School of Science, King Mongkut’s Institute of Technology Ladkrabang, Bangkok, Thailand
§ Burapha University, Chonburi, Thailand

Corresponding author: Supattra Poeaim ( supattra.poe@kmitl.ac.th )

Academic editor: Eike Neubert
© 2025 Kunya Seedee, Pongrat Dumrongrojwattana, Supattra Poeaim.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Seedee K, Dumrongrojwattana P, Poeaim S (2025) Four new species of genus Acmella W.T. Blanford, 1869 (Gastropoda, Assimineidae) from Southern Thailand. ZooKeys 1256: 275-292. https://doi.org/10.3897/zookeys.1256.157322
ZooBank: urn:lsid:zoobank.org:pub:6EC3645F-0B7B-44D3-B7A1-1C302F364CFE
Open Access

Abstract

This study explores the diversity of microsnails inhabiting limestone caves in Southern Thailand. It describes four new species of the genus Acmella W.T. Blanford, 1869 (Gastropoda, Assimineidae): Acmella krueangensis sp. nov. from Ranong Province, A. thamsingensis sp. nov. and A. changphueakensis sp. nov. from Chumphon Province, and A. kanchanaditensis sp. nov. from Surat Thani Province. These species are distinguished by shell morphology, particularly the number of striae on the last whorl and the protoconch sculpture. Phylogenetic analyses based on mitochondrial cytochrome c oxidase subunit I (COI) gene sequences further support their distinctiveness and clarify their taxonomic placement. The results enhance the understanding of Acmella diversity in Thailand and shed light on biogeographical patterns found in this genus and the adaptations needed to survive under the conditions of cave systems.

Key words:

Cave-dwelling gastropods, limestone habitat, microsnails

Introduction

Microsnails of the family Assimineidae are predominantly distributed in mangrove habitats throughout Southeast Asia. However, the genus Acmella W.T. Blanford, 1879, is an exception, exhibiting a unique adaptation to limestone hills and karst formations with a broad distribution range across Asia. Members of Acmella are characterized by their minute, narrowly conical, white shells, typically measuring 1–2 mm in height. The shell comprises 4.5–5.0 whorls with a distinctly deep suture. The aperture is thin and subovate, and the umbilicus is open and narrow. The shell surface is marked by radial and axial striations, producing a distinctive sculptural pattern (Vermeulen et al. 2015; Das et al. 2021).

Morphological studies have documented a total of 34 species of Acmella across Asia, including 12 species from Malaysia (von Möllendorff 1887; Vermeulen and Junau 2007; Vermeulen et al. 2015; Phung et al. 2017, 2018; bin Marzuki et al. 2021; Foon and bin Marzuki 2022; Vermeulen and Liew 2022), 11 from Indonesia (Tapparone Canefri 1883; Boettger 1891; Van Benthem Jutting 1958, 1963; Maassen 2000; Vermeulen et al. 2015), eight from the Philippines (von Möllendorff 1893; Quadras and von Möllendorff 1895; Vermeulen et al. 2015; Auffenberg and Páll-Gergely 2020), four from India (Benson 1853; Nevill 1878; Godwin-Austen 1895; Das et al. 2021; Chen and Páll-Gergely 2023), one from Myanmar (Theobald and Stoliczka 1872), and one from Vietnam (Vermeulen et al. 2019). In Thailand, four undescribed species of Acmella have been recorded (Wangkhiri et al. 2018; Suksai and Dumrongrojwattana 2022). This diversity highlights the genus’s ecological specialization and biogeographic importance in the region.

Notably, three microsnail species from the Philippines, Georissa regularis Quadras & Möllendorff, 1895, G. subglabrata Möllendorff, 1887, and G. turritella Möllendorff, 1893, have been reclassified under Acmella based on distinctive differences in shell morphology, including overall shell shape, number of whorls, and aperture characteristics (Auffenberg and Páll-Gergely 2020). Cyclostoma tersum W.H. Benson, 1853, was designated as type species (by monotypy) when the genus was established by Blanford in 1869. Key shell features include transverse sculpture elements on the teleoconch, a non-circular aperture, and an unexpanded peristome. Acmella differs from the closely related Anaglyphula B. Rensch, 1932 by lacking an internal constriction near the aperture (Chen and Páll-Gergely 2023).

Currently, two species of Acmella from Sabah, Malaysian Borneo, A. cyrtoglyphe Vermeulen, Liew & Schilthuizen, 2015 and A. polita Möllendorff, 1887, are represented in the National Center for Biotechnology Information (NCBI) database. These species were identified using DNA barcoding based on several genetic markers, including 16S ribosomal RNA (16S rRNA), 18S ribosomal RNA (18S rRNA), 28S ribosomal RNA (28S rRNA), cytochrome c oxidase subunit I (COI), and histone H3 (H3) (Hendriks 2020). In Thailand, four species of Acmella have been recorded solely based on morphological characteristics, with shell sculpture, particularly on the last whorl, serving as the principal diagnostic trait.

So, the present study aims to investigate the diversity of microsnails in the limestone caves of Southern Thailand, a region recognized for its high biodiversity. It further seeks to provide the first molecular identification of Acmella species from Thailand using DNA barcoding, focusing primarily on the mitochondrial COI gene.

Materials and methods

Specimen sampling

Field surveys were conducted at four limestone cave sites in Southern Thailand: Phra Krueang Cave, Ranong Province (10.3265, 98.7646); Wat Tham Sing, Chumphon Province (10.4256, 99.0600); Samnaksong Tham Chang Phueak, Chumphon Province (10.4463, 99.0349); and Wat Pa Kanchanadit, Surat Thani Province (9.1426, 99.4708) (Fig. 1). Specimens were collected manually from within the caves, including individuals found attached to rock crevices and shells embedded in soil containing shell debris. All specimens were found exclusively in aphotic cave environments, particularly in moist microhabitats where water seeped through cave walls, stalactites, and stalagmites. Specimens were collected at depths or distances ranging from 15 to 30 m from the cave entrances, with a mean of 21.25 ± 6.29 m. In addition to live specimens, fossilized shells were occasionally observed in areas that were likely water-saturated in the past. Their coloration and small size make them difficult to detect even when alive, as their shells blend into the surrounding substrate like grains of sand. None of these species were found outside of the cave environments. All collected specimens were preserved in 50% ethanol to ensure tissue integrity for subsequent morphological and molecular analyses. Sample processing and preservation were performed at the Department of Biology, School of Science, King Mongkut’s Institute of Technology Ladkrabang (KMITL), and Burapha University (BUU).

Figure 1. 

Type localities of the four new Acmella species described from Southern Thailand: A. krueangensis sp. nov. (purple), Ranong Province; A. thamsingensis sp. nov. (yellow), Chumphon Province; A. changphueakensis sp. nov. (red), Chumphon Province; and A. kanchanaditensis sp. nov. (blue), Surat Thani Province.

Morphological examination

Morphological examinations were conducted using a stereomicroscope. Soft tissues were carefully separated from the shells and preserved in 50% ethanol for subsequent molecular analysis. Shells were cleaned using hydrogen peroxide and rinsed with distilled water to remove debris and organic residues. Specimens were photographed using a digital camera to document shell morphology. Shell measurements, including shell height (SH), shell width (SW), aperture height (AH), and aperture width (AW), were taken using ImageJ software (Schneider et al. 2012) to assess and compare shell shape among specimens. Scanning electron microscopy (SEM) was employed to examine protoconch sculpture, sculpture on the last whorl, and operculum morphology, following the protocols of Panha and Burch (2005). The sculpture on the last whorl was categorized into two major types following Vermeulen et al. (2015): (1) radial sculpture predominant, and (2) spiral sculpture predominant, radial and spiral sculpture approximately equally developed, or sculpture virtually absent. Operculum morphology was examined and described based on the diagnostic framework provided by Vermeulen et al. (2015), focusing on characteristics such as thinness, transparency, paucispiral coiling, and chitinous composition, which were used as taxonomic criteria for species identification within Acmella.

Molecular analysis

Genomic DNA was extracted from tissues of four morphologically distinct Acmella species (two individuals per species) using the GF-1 Tissue DNA Extraction Kit (Vivantis Technologies, Malaysia), following the manufacturer’s protocol. For each specimen, tissue was obtained by drilling a small hole (approximately 0.4 × 0.4 mm) on the dorsal side of the last whorl. An acupuncture needle (0.12 × 0.13 mm) was used to carefully extract the tissue for DNA analysis. The shell was preserved intact for subsequent morphological examination. A fragment of the mitochondrial cytochrome c oxidase subunit I (COI) gene was amplified using the universal primers LCO1490 (5′–GGTCAACAAATCATAAAGATATTG–3′) and HCO2198 (5′–TAAACT TCAGGGTGACCAAAAAATCA–3′) (Folmer et al. 1994). Polymerase chain reaction (PCR) was performed in a 25 µL reaction volume consisting of 2.5 µL of 10 × PCR buffer, 1 µL of 25 mM MgCl2, 1 µL of 1.25 mM dNTPs, 1 µL of each primer (10 pmol), 0.25 µL of Taq DNA polymerase (New England Biolabs), 1 µL of genomic DNA template, and 17.25 µL of nuclease-free water. The PCR cycling protocol included an initial denaturation at 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 15 s, annealing at 50 °C for 30 s, and extension at 72 °C for 1 min, with a final extension at 72 °C for 5 min (Khalik et al. 2018). Amplification success was confirmed by electrophoresis on 1.5% agarose gels stained with ethidium bromide. PCR products were purified and sequenced using Barcode Indexed Tag Sequencing (BITseq). The resulting COI gene sequences were edited and aligned using MEGA 11 (Tamura et al. 2021). Sequence identities were assessed using BLAST searches against the NCBI GenBank database, focusing on available Acmella and Georissa species sequences. The best-fitting nucleotide substitution model, the General Time Reversible model (GTR), was selected using jModelTest v. 1.4.4 (Darriba et al. 2012), based on the Bayesian Information Criterion (BIC). Phylogenetic relationships were reconstructed using Bayesian Inference (BI) in MrBayes v. 3.2.7 (Ronquist et al. 2012), with 1,000,000 generations and four Markov chains. Trees are sampled every 100 generations, and the first 25% are discarded as burn-in.

Results

Morphological studies

Four new species of Acmella were discovered during faunal surveys of limestone cave systems in Southern Thailand, specifically in Phra Krueang Cave (Ranong Province), Wat Tham Sing and Samnaksong Tham Chang Phueak (Chumphon Province), and Wat Pa Kanchanadit (Surat Thani Province) (Fig. 1).

The morphological analysis of the holotypes of Acmella species revealed that SH ranged from 1.01 to 1.51 mm (mean 1.33 ± 0.22 mm), SW ranged from 0.81 to 1.10 mm (mean 0.99 ± 0.14 mm), AH ranged from 0.41 to 0.58 mm (mean 0.52 ± 0.08 mm), and AW ranged from 0.42 to 0.53 mm (mean 0.50 ± 0.05 mm). A relatively narrow range of shell dimensions was observed among species. The analysis of additional specimens (paratypes) revealed significant variation in shell measurements. Acmella krueangensis sp. nov. exhibited the greatest size variation, with SH ranging from 0.97 to 1.55 mm (mean 1.37 ± 0.23 mm) and SW from 0.68 to 1.14 mm (mean 1.01 ± 0.18 mm), representing both the smallest and largest individuals observed. Acmella thamsingensis sp. nov. had SH ranging from 1.37 to 1.43 mm (mean 1.40 ± 0.03 mm) and SW from 0.93 to 1.03 mm (mean 0.98 ± 0.05 mm). Acmella changphueakensis sp. nov. exhibited SH between 1.33 and 1.49 mm (mean 1.38 ± 0.08 mm) and SW between 0.95 and 1.09 mm (mean 1.01 ± 0.07 mm). Acmella kanchanaditensis sp. nov. showed the largest average shell height, with SH ranging from 1.39 to 1.52 mm (mean 1.47 ± 0.08 mm), and the most consistent shell width, from 1.07 to 1.10 mm (mean 1.08 ± 0.01 mm). Digital microscope images of paratypes illustrating intraspecific shell shape variation are shown. Four paratype specimens for each species are presented in Fig. 2A–D.

Figure 2. 

Shell morphology of the four new Acmella species described from Southern Thailand, based on paratype specimens (4 samples per species): A. A. krueangensis sp. nov., ZRCBUU 0988, PV1579890; B. A. thamsingensis sp. nov., ZRCBUU 0990, PV157992; C. A. changphueakensis sp. nov., ZRCBUU 0992, PV157994; D. A. kanchanaditensis sp. nov., ZRCBUU 0994, PV157996. Digital microscope images of paratypes illustrating shell shape variation are shown. Scale bars: 0.5 mm (A–D).

Morphological analysis of the four species of Acmella revealed distinct shell sculptures that can be used as diagnostic features for species identification. Acmella krueangensis sp. nov. exhibits a reticulate pattern with clearly defined radial and spiral ridges, creating a mesh-like appearance (Fig. 4). Acmella thamsingensis sp. nov. shows pronounced spiral ridges with radial sculptures that are most prominent on the upper whorls and gradually fade toward the lower whorls (Fig. 5). Acmella changphueakensis sp. nov. is characterized by dominant spiral ridges with faint radial lines, which are nearly invisible in some areas (Fig. 6). Acmella kanchanaditensis sp. nov. shares a similar sculpture to A. changphueakensis sp. nov., but it has a higher density of fine spiral ridges and narrower spacing between them (Fig. 7). While these species share similar overall shell morphology, including shape, coloration, and operculum structure, the shell sculpture provides the most reliable distinguishing feature among them.

Phylogenetic analysis

The phylogenetic analysis was based on eight newly generated COI sequences from four newly described Acmella species: A. krueangensis sp. nov., A. thamsingensis sp. nov., A. changphueakensis sp. nov., and A. kanchanaditensis sp. nov. (two individuals per species). The sequences were approximately 700 bp in length, as estimated by agarose gel electrophoresis, and were subsequently trimmed to 537 bp for analysis. All sequences were deposited in GenBank (Table 1). Additional COI sequences of two previously described species, A. polita and A. cyrtoglyphe from Borneo, were included, along with four species of Georissa W.T. Blanford, 1864 (G. quinquelirata Klongkaew, Poeaim & Dumrongrojwattana, 2024, G. digitinota Klongkaew, Poeaim & Dumrongrojwattana, 2024, G. sagitta Klongkaew, Poeaim & Dumrongrojwattana, 2024, and G. kohsichangensis Klongkaew, Poeaim & Dumrongrojwattana, 2024) as outgroups. Sequences were aligned using ClustalW with default parameters and manually adjusted in MEGA11. Phylogenetic reconstruction was conducted using MrBayes v. 3.2.7 under the General Time Reversible model with a gamma distribution and a proportion of invariable sites.

Table 1.
Download as
CSV
XLSX

List of Acmella and Georissa species, specimen catalog numbers, GenBank accession numbers, and references included in the phylogenetic analysis.

Species Specimen Catalog Numbers Accession Numbers References
A. polita RMNH.5005040.01 MK851191 Hendriks 2020
A. cyrtoglyphe BOR/MOL7316.01 MK851202
G. quinquelirata ZRCBUU 0900 PP844569 Klongklaew et al. 2024
G. digitinota ZRCBUU 0906 PP844575
G. sagitta ZRCBUU 0904 PP844573
G. kohsichangensis ZRCBUU 0902 PP844571
A. krueangensis sp. nov. ZRCBUU 0987 PV157989 This study
A. krueangensis sp. nov. ZRCBUU 0988 PV157990
A. thamsingensis sp. nov. ZRCBUU 0989 PV157991
A. thamsingensis sp. nov. ZRCBUU 0990 PV157992
A. changphueakensis sp. nov. ZRCBUU 0991 PV157993
A. changphueakensis sp. nov. ZRCBUU 0992 PV157994
A. kanchanaditensis sp. nov. ZRCBUU 0993 PV157995
A. kanchanaditensis sp. nov. ZRCBUU 0994 PV157996

The Bayesian tree recovered the four new Thai Acmella species as a well-supported monophyletic clade, with all major nodes receiving strong support (posterior probabilities > 0.95). Within this clade, A. thamsingensis sp. nov. and A. changphueakensis sp. nov. formed a strongly supported sister group, whereas A. krueangensis sp. nov. and A. kanchanaditensis sp. nov. diverged independently, reflecting their distinct shell morphologies. The COI gene analysis grouped Thai specimens and A. polita and A. cyrtoglyphe from Borneo into a single unresolved clade (Fig. 3), lacking sufficient resolution to clarify their evolutionary relationships.

Figure 3. 

Phylogenetic tree of Acmella species based on the COI gene. The tree was constructed using the Bayesian-inference method with the General Time Reversible (GTR) + G + I model. The posterior probability is displayed at each node in the nucleotide sequence.

Figure 4. 

Scanning electron micrographs (SEM) of Acmella krueangensis sp. nov. (A–E) various shell views. A. Overall shell view; B, C. Protoconch and sculpture details; D. Last whorl sculpture; E. Operculum. Scale bars: 0.5 mm (A, B); 0.1 mm (C–E).

Figure 5. 

Scanning electron micrographs (SEM) of Acmella thamsingensis sp. nov. (A–E) various shell views. A. Overall shell view; B, C. Protoconch and sculpture details; D. Last whorl sculpture; E. Operculum. Scale bars: 0.5 mm (A, B); 0.1 mm (C–E).

Figure 6. 

Scanning electron micrographs (SEM) of Acmella changphueakensis sp. nov. (A–E) various shell views. A. Overall shell view; B, C. Protoconch and sculpture details; D. Last whorl sculpture; E. Operculum. Scale bars: 0.5 mm (A, B); 0.1 mm (C–E).

Figure 7. 

Scanning electron micrographs (SEM) of Acmella kanchanaditensis sp. nov. (A–E) various shell views. A. Overall shell view; B, C. Protoconch and sculpture details; D. Last whorl sculpture; E. Operculum. Scale bars: 0.5 mm (A, B); 0.1 mm (C–E).

Systematics

Family Assimineidae H. Adams & A. Adams, 1856

Subfamily Ekadantinae Thiele, 1929

Acmella W.T. Blanford, 1869

Type species.

Cyclostoma tersum Benson, 1853.

Acmella krueangensis Seedee, Dumrongrojwattana & Poeaim, sp. nov.

https://zoobank.org/F6C58A3A-78C2-4A2A-8FAB-24323F5F49BB
Fig. 4

Type material.

Holotype : Thailand • Phra Krueang Cave, Bang Bon Subdistrict, Kra Buri District, Ranong Province; 10.3265, 98.7646; November 2023; Kunya Seedee; deposited in the Malacological Collection; catalog no. ZRCBUU 0987; GenBank accession number: PV157989, SH = 1.51 mm, SW = 1.09 mm, AH = 0.58 mm, AW = 0.53 mm (Fig. 4A–E, Table 2). Paratype: Thailand • 6 shells; same locality data as holotype; November 2023; deposited in the same institution as the holotype; catalog no. ZRCBUU 0988; GenBank accession number: PV157990, SH = 0.97–1.55 mm (1.37 ± 0.23 mm), SW = 0.68–1.14 mm (1.01 ± 0.18 mm), AH = 0.39–0.58 mm (0.57 ± 0.07 mm), AW = 0.45–0.56 mm (0.52 ± 0.08 mm).

Table 2.
Download as
CSV
XLSX

Holotype size measurements of Acmella in this study (in mm).

Species Numbers SH SW AH AW
A. krueangensis sp. nov. ZRCBUU 0987 1.51 1.09 0.58 0.53
A. thamsingensis sp. nov. ZRCBUU 0989 1.01 0.81 0.41 0.42
A. changphueakensis sp. nov. ZRCBUU 0991 1.37 0.96 0.52 0.53
A. kanchanaditensis sp. nov. ZRCBUU 0993 1.41 1.10 0.58 0.51

Diagnosis.

Shell conical, white, translucent; 4½–5 convex whorls with a deep suture. Aperture obliquely oval. The last whorl sculpture is characterized by a distinct reticulated (mesh-like) pattern. Umbilicus narrow and open.

Description.

Shell conical, white, and translucent, with a rounded apex. Whorls convex, with a deep suture, totaling 4½–5 whorls. The aperture is obliquely oval, with a thin peristome and a concavity adjoining the upper body. Umbilicus open, narrow, and shallow (Fig. 4A). Protoconch with scattered malleated sculptures extending to the second whorl (Fig. 4B, C). The last whorl has a well-defined reticulated sculpture, formed by conspicuous radial and spiral elements, with unevenly tapered spiral lines (Fig. 4D). Operculum is thin, transparent, paucispiral, and chitinous (Fig. 4E).

Differential diagnosis.

Acmella krueangensis sp. nov. closely resembles A. cyrtoglyphe in general shell sculpture, particularly the presence of both radial and spiral elements. However, A. krueangensis sp. nov. differs by exhibiting more pronounced and evenly spaced radial ribs and a clearer reticulate (net-like) pattern formed by the intersection of radial and spiral elements. In contrast, the other three species possess sculpture dominated by spiral elements with less prominent or absent radial components, resulting in a predominantly spiral pattern rather than a net-like appearance.

Etymology.

The specific epithet krueangensis refers to Phra Krueang Cave, the type locality where the new species was discovered.

Habitat and distribution.

Currently known only from the type locality, Phra Krueang Cave, Ranong Province, Thailand.

Ecology.

This species inhabits dark, moist cave environments characterized by stalactites and stalagmites without evidence of surface water seepage.

Acmella thamsingensis Seedee, Dumrongrojwattana & Poeaim, sp. nov.

https://zoobank.org/E7DACE7F-DD7E-4BE2-8C56-432220B03FF5
Fig. 5

Type material.

Holotype : Thailand • WatTham Sing, Tham Sing Subdistrict, Mueang District, Chumphon Province; 10.4256, 99.0600; November 2023; Kunya Seedee; deposited in the Malacological Collection; catalog no. ZRCBUU 0989; GenBank accession number: PV157991, SH = 1.01 mm, SW = 0.81 mm, AH = 0.41 mm, AW = 0.42 mm (Fig. 5A–E, Table 2). Paratype: Thailand • 4 shells; same locality data as holotype; November 2023; deposited in the same institution as the holotype; catalog no. ZRCBUU 0990; GenBank accession number: PV157992, SH = 1.37–1.43 mm (1.40 ± 0.03 mm), SW = 0.93–1.03 mm (0.98 ± 0.05 mm), AH = 0.46–0.57 mm (0.49 ± 0.05 mm), AW = 0.37–0.49 mm (0.44 ± 0.06 mm).

Diagnosis.

Shell shape conical, white; suture visible; whorls 4–6. Aperture oblique oval. The last whorl sculpture consists of a lattice pattern on the upper part of the whorls. Umbilicus open and narrow.

Description.

Shell conical, white, translucent; rounded apex; whorls convex on the side up to a deep suture; 4¼–6 whorls. The aperture is oblique oval, with a wall next to the upper body, a concave part following the shell shape, and a thin peristome. The umbilicus is open, narrow, and superficial (Fig. 5A). Protoconch is a rough sculpture scattered throughout the area up to the second whorl (Fig. 5B, C). The last whorl sculpture is a spiral low convex sculpture with 23–26 rows, wide, conspicuous, and regularly spaced with a narrow groove in the wide rows. Radial sculpture tapered in the upper part of the whorl (Fig. 5D). Operculum paucispiral, thin, transparent, and composed of chitin (Fig. 5E).

Differential diagnosis.

The spiral sculpture of A. thamsingensis sp. nov. is more prominent than that of A. cyrtoglyphe, where it is almost absent. The radial sculpture of A. thamsingensis sp. nov. is limited to the upper part of the whorl, unlike A. cyrtoglyphe, which exhibits a more distinct and complete radial sculpture. Compared to A. krueangensis sp. nov., which has evenly distributed radial sculpture across the shell, A. thamsingensis sp. nov. bears radial elements only on the upper portion of the last whorl. In contrast, A. changphueakensis sp. nov. and A. kanchanaditensis sp. nov. lack radial sculpture.

Etymology.

The specific name thamsingensis refers to Wat Tham Sing, where the species was discovered.

Habitat and distribution.

This species is only found at the study site.

Ecology.

The new species was discovered in aphotic cave zones, inhabiting moist microhabitats where water percolates through the cave walls, approximately 20 m from the entrance.

Acmella changphueakensis Seedee, Dumrongrojwattana & Poeaim, sp. nov.

https://zoobank.org/334BE3B4-63B6-429F-A1F4-343BD9A03E73
Fig. 6

Type material.

Holotype : Thailand • Samnaksong Tham Chang Phueak, Ban Na Subdistrict, Mueang District, Chumphon Province; 10.4463, 99.0349; November 2023; Kunya Seedee; Deposited in the Malacological Collection; catalog no. ZRCBUU 0991; GenBank accession number: PV157993, SH = 1.37 mm, SW = 0.96 mm, AH = 0.52 mm, AW = 0.53 mm (Fig. 6A–E, Table 2). Paratype: Thailand • 4 shells; same locality data as holotype; November 2023; Deposited in the same institution as the holotype; catalog no. ZRCBUU 0992; GenBank accession number: PV157994, SH = 1.33–1.49 mm (1.38 ± 0.08 mm), SW = 0.95–1.09 mm (1.01 ± 0.07 mm), AH = 0.51–0.57 mm (0.54 ± 0.03 mm), AW = 0.48–0.54 mm (0.50 ± 0.03 mm).

Diagnosis.

Shell conical, white; a visible suture; 5–5½ whorls. Aperture oblique and oval. The last whorl sculpture has a prominently spiraled, low convex pattern. Umbilicus open and narrow.

Description.

Shell conical, white, translucent; apex rounded; whorls convex up to deep suture; 5–5½ whorls. The aperture is oblique oval, with a wall adjacent to the upper body, a concave portion following the shell shape, and a thin peristome. Umbilicus open, narrow, and nearly closed (Fig. 6A). Protoconch sculpture consisting of malleation, scattered throughout the area up to the second whorl (Fig. 6B, C). The last whorl sculpture consists of a spiral low convex pattern with 30–32, conspicuous, regularly spaced rows, each with a narrow groove. The radial sculpture is almost absent and irregularly spaced (Fig. 6D). Operculum paucispiral, thin, transparent, and composed of chitin (Fig. 6E).

Differential diagnosis.

Acmella changphueakensis sp. nov. resembles A. minutissima Maassen, 2000 in having a similar sculpture pattern on the last whorl. However, it can be distinguished by its higher number of spiral rows and greater number of whorls (five), whereas A. minutissima has only four. Among the newly described species, A. changphueakensis sp. nov. differs from A. krueangensis sp. nov. and A. thamsingensis sp. nov. by its faint radial sculpture, which is well developed in the latter two species. It shares a similar spiral sculpture with A. kanchanaditensis sp. nov., but it differs in having more widely spaced spiral rows.

Etymology.

The name changphueakensis is derived from Samnaksong Tham Chang Phueak, where this species was discovered.

Habitat and distribution.

This species is known only from the study site.

Ecology.

The new species inhabits cave environments where no light penetrates, specifically in areas where water seeps through the cave walls.

Acmella kanchanaditensis Seedee, Dumrongrojwattana & Poeaim, sp. nov.

https://zoobank.org/4345A7C6-45F0-48DF-BFC8-5E0FE5B628F5
Fig. 7

Type material.

Holotype : Thailand • Wat Pa Kanchanadit, Kadae Subdistrict, Kanchanadit District, Surat Thani Province; 9.1426, 99.4708; November 2023; Kunya Seedee; deposited in the Malacological Collection; catalog no. ZRCBUU 0993; GenBank accession number: PV157995, SH = 1.41 mm, SW = 1.10 mm, AH = 0.58 mm, AW = 0.51 mm (Fig. 7A-E, Table 2). Paratype: Thailand • 4 shells; same locality data as holotype; November 2023; deposited in the same institution as the holotype; catalog no. ZRCBUU 0994; GenBank accession number: PV157996, SH = 1.39–1.52 mm (1.47 ± 0.08 mm), SW = 1.07–1.10 mm (1.08 ± 0.01 mm), AH = 0.51–0.60 mm (0.57 ± 0.04 mm), AW = 0.48–0.50 mm (0.49 ± 0.01 mm).

Diagnosis.

Shell conical, white; a visible suture; 4¾–5 whorls. Aperture oblique and oval. The last whorl sculpture has a relief spiral pattern, thin lines and is barely visible. Umbilicus open and narrow.

Description.

Shell conical, white, translucent; apex rounded; whorls convex up to deep suture; 4¾–5 whorls. Aperture oblique oval, with a wall adjacent to the upper body, a concave part following the shell shape, and a thin peristome. Umbilicus open, narrow, and superficial (Fig. 7A). Protoconch sculpture rough and spread across the area (Fig. 7B, C). Last whorl sculpture consists of 48 spiral rows with a shallow groove between them. Radial sculpture thin and barely visible (Fig. 7D). Operculum paucispiral, thin, transparent, composed of chitin (Fig. 7E).

Differential diagnosis.

Acmella kanchanaditensis sp. nov. can be distinguished from A. caelata Vermeulen & Junau, 2007 by its almost invisible radial sculpture. In contrast, in A. caelata, the radial sculpture remains faintly visible in certain areas. Additionally, A. kanchanaditensis sp. nov. has a higher number of whorls. This new species also closely resembles A. changphueakensis sp. nov. in having spiral sculpture, but the spiral rows in A. kanchanaditensis sp. nov. are thinner and more widely spaced. In contrast, A. krueangensis sp. nov. and A. thamsingensis sp. nov. exhibit well-developed radial sculpture, which is lacking in the present species.

Etymology.

The specific name kanchanaditensis is derived from Wat Pa Kanchanadit, where this species was discovered.

Habitat and distribution.

This species is known only from the study site.

Ecology.

The new species is found in caves where no light penetrates, specifically in areas where water seeps through stalactites and stalagmites.

Discussion

The discovery of four new species of Acmella (A. krueangensis sp. nov., A. thamsingensis sp. nov., A. changphueakensis sp. nov., and A. kanchanaditensis sp. nov.) from aphotic cave systems in Southern Thailand significantly advances our understanding of the genus biodiversity. This study represents only the second confirmed report of Acmella inhabiting subterranean habitats, following the record of A. tersa from Meghalaya, India (Das et al. 2021). In contrast, Acmella species from Malaysia and Vietnam have only been recorded from above-ground leaf litter in limestone karst forests (Vermeulen et al. 2019, Vermeulen and Liew 2022; Foon and bin Marzuki 2022). The occurrence of Acmella in aphotic cave systems of the Sundaland region highlights the possibility of cave adaptation in the genus, a topic that warrants further investigation. Comparable research on cave adaptation and evolution in Georissa spp. (Khalik et al. 2020; Prieto et al. 2022) offers useful frameworks for future evolutionary and ecological studies. These newly described species exhibit distinct shell morphologies, particularly in the sculpture patterns of the last whorl, which serve as important diagnostic characters. For instance, A. krueangensis sp. nov. is characterized by a mesh-like sculpture, a pattern previously reported in an Acmella from Thailand by Wangkhiri et al. (2018). Although specimens in that study were collected from the same locality, the investigation focused solely on morphological characteristics. The present study builds upon these earlier findings by integrating morphological and molecular data, thus providing a more robust framework for understanding the systematics and evolutionary relationships within Acmella. The resemblance in sculptural pattern between A. krueangensis sp. nov. and the previously reported Acmella species suggests morphological continuity; however, molecular evidence supports the recognition of A. krueangensis sp. nov. as the same species.

The other new species also show clear differences in shell sculpture. Acmella thamsingensis sp. nov. exhibits a well-defined spiral ridge accompanied by radial sculpture prominent on the upper part of the whorl but fades towards the base. In contrast, A. changphueakensis sp. nov. and A. kanchanaditensis sp. nov. display prominent spiral sculptures but differ in the inter-row grooves thickness, depth, and spacing. Similarly, A. changphueakensis sp. nov. closely resembles Acmella sp. 2 reported by Suksai and Dumrongrojwattana (2022), with both studies involving specimens collected from the same locality. However, the earlier work was based solely on morphological examination, whereas the present study incorporates DNA barcoding at the COI gene to validate species distinctiveness.

Overall, integrating morphological and molecular data reinforces the distinctiveness of the four newly described Acmella species and highlights the high level of cryptic diversity within cave ecosystems. These findings emphasize the value of combining traditional morphological approaches with molecular tools in the taxonomic study of microgastropods, particularly those inhabiting specialized and understudied environments such as tropical caves. In particular, molecular analyses based on COI DNA barcoding and phylogenetic reconstruction support the morphological differentiation among the new species. Despite sharing similar shell characteristics typical of the genus Acmella, each species exhibits distinct sculptural patterns. This pattern of congruence between morphological and molecular evidence is consistent with previous studies of Acmella species from Borneo, such as A. cyrtoglyphe and A. polita (Hendriks 2020). However, the COI gene analysis grouped Thai specimens with A. polita and A. cyrtoglyphe from Borneo in a single unresolved clade, indicating insufficient resolution to clarify their evolutionary relationships. Reliance on mitochondrial COI alone may limit the ability to distinguish closely related Acmella lineages in these regions. This unresolved topology suggests that additional markers, including nuclear genes, and multilocus phylogenetic analyses are needed to better resolve species boundaries and evolutionary history across Thailand and Borneo. Despite these limitations, our results support the validity of the new species and highlight the evolutionary diversification of Acmella within cave habitats.

While this study significantly enhances the understanding of Acmella diversity in Southern Thailand, several limitations should be acknowledged. Sampling was limited to a few cave systems, and ecological data on habitat preferences, behavior, and life history traits remain insufficient. Furthermore, genetic analyses were based solely on mitochondrial COI sequences from a small number of specimens, which do not adequately capture intraspecific variation. Future research should expand to include broader geographic sampling across Thailand and neighboring countries, employ multilocus genetic approaches, and incorporate ecological investigations to elucidate better the evolutionary history, population structure, and conservation needs of these specialized cave-dwelling microsnails.

Conclusion

This study describes the discovery of four new Acmella species from cave systems in Southern Thailand, expanding our knowledge of the genus and its diversity within the Assimineidae family. The species show unique morphological and ecological adaptations to aphotic cave environments. Morphological and COI DNA barcoding data provide important insights into their systematics and evolutionary relationships. However, further molecular and ecological research is needed to understand their genetic diversity, evolutionary history, and conservation status, with an emphasis on their biogeographic distribution.

Acknowledgements

This research was financially supported by KMITL Research and Innovation Services (KRIS). The Institutional Animal Care and Use Committee of King Mongkut’s Institute of Technology Ladkrabang approved animal use in this study. We thank the Department of Biology, Faculty of Science, Burapha University, for providing facilities and support for morphological studies. We sincerely thank the subject editor and the anonymous reviewers for their valuable comments and suggestions that greatly improved this manuscript on microsnails.

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

Approved by the Animal Care and Use Committee of King Mongkut’s Institute of Technology Ladkrabang (Approval no. ACUC-KMITL-RES/2023/019).

Use of AI

No use of AI was reported.

Funding

This research was funded by KMITL Research and Innovation Services (KRIS) (Grant No. KREF016619).

Author contributions

Conceptualization: KS, PD, SP. Data curatio: KS, SP. Specimen collection: KS, SP. Investigation: KS, SP. Resources: PD, SP. Supervision: SP. Funding acquisition: SP. Writing – original draft: KS. Writing – review and editing: KS, SP.

Author ORCIDs

Supattra Poeaim https://orcid.org/0000-0003-1293-3820

Data availability

The dataset supporting this study has been deposited in the Global Biodiversity Information Facility (GBIF) Pensoft Integrated Publishing Toolkit (IPT). It is available at: https://ipt.pensoft.net/manage/resource?r=acmella_new_species_thailand_2025.

References

  • Auffenberg K, Páll-Gergely B (2020) Reassignment of three species and one subspecies of Philippine land snails to the genus Acmella Blanford, 1869 (Gastropoda: Assimineidae). Tropical Natural History 20(3): 223–227. https://doi.org/10.58837/tnh.20.3.243510
  • Benson WH (1853) Additional character of the shell of the Cyclostomatous genus Alycæus of Gray, with descriptions of its animal inhabitant, of a fourth species, and of other new Indian Cyclostomata; also, remarks on an unrecorded character in Diplommatina. Annals & Magazine of Natural History 9(64): 283–287. https://doi.org/10.1080/03745485609495767
  • bin Marzuki ME, Liew TS, Mohd-Azlan J (2021) Land snails and slugs of Bau limestone hills, Sarawak (Malaysia, Borneo), with the descriptions of 13 new species. ZooKeys 1035: 1–113. https://doi.org/10.3897/zookeys.1035.60843
  • Boettger O (1891) Ad. Strubell’s Konchylien aus Java II und von den Molukken. Bericht über die Senckenbergische Naturforschende Gesellschaft in Frankfurt am Main 1891: 241–318.
  • Chen ZY, Páll-Gergely B (2023) A new species of Anaglyphula Rensch, 1932 from an island off the coast of West Indonesia, with redescription of the type species (Gastropoda: Caenogastropoda: Assimineidae). The Raffles Bulletin of Zoology 71: 597–605.
  • Darriba D, Taboada GL, Doallo R, Posada D (2012) jModelTest 2: More models, new heuristics and parallel computing. Nature Methods 9(8): 772–772. https://doi.org/10.1038/nmeth.2109
  • Das NK, Páll-Gergely B, Naggs F, Preece RP, White TS, Aravind A (2021) Redescription of Acmella tersa (Benson, 1853), the type species of Acmella W.T. Blanford, 1869 (Gastropoda: Assimineidae), from Meghalaya, Northeast India. Molluscan Research 41(4): 324–331. https://doi.org/10.1080/13235818.2021.1991255
  • Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3(5): 294–299.
  • Godwin-Austen HH (1895) List and distribution of the land-mollusca of the Andaman and Nicobar islands, with descriptions of some supposed new species. Proceedings of the Zoological Society of London 63(30): 438–457. https://www.biodiversitylibrary.org/page/30983429
  • Hendriks K (2020) On the origin of species assemblages of Bornean microsnails. PhD thesis, University of Groningen, Groningen, Netherlands.
  • Khalik MZ, Hendriks K, Vermeulen JJ, Schilthuizen M (2018) A molecular and conchological dissection of the “scaly” Georissa of Malaysian Borneo (Gastropoda, Neritimorpha, Hydrocenidae). ZooKeys 773: 1–55. https://doi.org/10.3897/zookeys.773.24878
  • Khalik MZ, Bozkurt E, Schilthuizen M (2020) Morphological parallelism of sympatric cave-dwelling microsnails of the genus Georissa at Mount Silabur, Borneo (Gastropoda, Neritimorpha, Hydrocenidae). Journal of Zoological Systematics and Evolutionary Research 58(3): 648–661. https://doi.org/10.1111/jzs.12352
  • Klongklaew K, Poeaim S, Dumrongrojwattana P (2024) Four new of Georissa W. Blanford, 1864 (Gastropoda, Hydrovcnidar) from Thailand. Zoosystematics and Evolution 100(4): 1347–1360. https://doi.org/10.3897/zse.100.128717
  • Maassen WJM (2000) Notes on terrestrial molluscs of Sumatra, Indonesia, with descriptions of ten new species (Gastropoda, Prosobranchia & Pulmonata). Basteria 64: 137–150.
  • Nevill G (1878) Hand List of Mollusca in the Indian Museum, Calcutta. Part I. Gastropoda. Pulmonata and Prosobranchia–Neurobranchia. Office of the Superintendent of a Printing, India, 338 pp. https://doi.org/10.5962/bhl.title.11957
  • Panha S, Burch JB (2005) An introduction to the microsnails of Thailand. Malacological Review 37/38: 155 pp.
  • Phung CC, Yong YZ, Said MAM, Liew TS (2018) Land snail fauna in Gunung Kuang Limestone Hill, Perak, Malaysia and its conservation implications (Mollusca, Gastropoda). ZooKeys 769: 1–11. https://doi.org/10.3897/zookeys.769.25571
  • Prieto CE, Quinonero-Salgado S, Ruiz-Cobo J, Alonso A (2022) The first cave-dwelling Hydrocenidae (Gastropoda: Cicloneritida) in Europe, Hydrocena cantabrica sp. nov., lives in the Cantabrian Region (Spain). Spira 8: 47–59.
  • Quadras JF, von Möllendorff OF (1895) Diagnoses specierum novarum ex insulis Philippinis. Nachrichtsblatt der Deutschen Malakozoologischen Gesellschaft, Germany, 164 pp.
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Hohna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029
  • Suksai N, Dumrongrojwattana P (2022) Cave-dwelling snail diversity from Southern Thailand. In: The 2nd Symposium of the Natural History Museum: Biodiversity and the Current State of the Changing World, Thailand, 111–116.
  • Tapparone Canefri C (1883) Fauna malacological della Nuova Guninea e delle isole adiacenti. Parte I. Molluschi estramarini. Annali del Museo Civico di Storia Naturale di Genova, Italy, 313 pp.
  • Theobald W, Stoliczka F (1872) Notes on Barmese and Arakanese land shells, with descriptions of a few species. Journal of the Asiatic Society of Bengal 41(2): 329–334. https://biostor.org/reference/281116
  • Van Benthem Jutting WSS (1958) Landmollusken von Sumba. Verhandlungen der Naturforschenden Gesellschaft in Basel 69(1): 90–117.
  • Van Benthem Jutting WSS (1963) Non-marine Mollusca of West New Guinea. Part 1, Mollusca from fresh and brackish waters. Nova Guinea. Zoology : Analysis of Complex Systems, ZACS 20: 409–521.
  • Vermeulen JJ, Liew TS (2022) Land snails and slugs of Sabah and Labuan (Malaysia). Institute for Tropical Biology and Conservation, Universiti Malaysia Sabah, Kota Kinabalu, Malaysia: 1–432.
  • Vermeulen JJ, Liew TS, Schilthuizen M (2015) Additions to the knowledge of the land snails of Sabah (Malaysia, Borneo), including 48 new species. ZooKeys 531: 1–139. https://doi.org/10.3897/zookeys.531.6097
  • Vermeulen JJ, Luu HT, Theary K, Anker K (2019) New species of land snails (Mollusca: Gastropoda: Caenogastropoda and Pulmonata) of the Mekong Delta Limestone Hills (Cambodia, Vietnam). Folia Malacologica 27(1): 7–41. https://doi.org/10.12657/folmal.027.001
  • von Möllendorff OF (1887) Von den Philippinen III. Umgegend von Manila, Majayjay an der Laguna de Bay. Jahrbucher der Deutschen Malakozoologischen Gesellschaft 1887: 292–305.
  • von Möllendorff OF (1893) Materialien zur Fauna der Philippinen. XI. Die Insel Leyte. Bericht der Senckenbergischen Naturforschenden Gesellschaft 1893: 51–134. https://doi.org/10.5962/bhl.title.13048
login to comment