Research Article
Print
Research Article
A new species of Diploderma Hallowell, 1861 (Squamata, Agamidae) discovered in the upper Dadu River valley of the Hengduan Mountains, Sichuan, China
expand article infoFengjing Liu‡§, Yayong Wu|, Jindong Zhang, Guang Yang‡, Shuo Liu#, Xue Chen¤, Jiang Chang«, Qiang Xie», Bo Cai§
‡ Nanjing Normal University, Nanjing, China
§ Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu, China
| Yibin University, Yibin, China
¶ China West Normal University, Nanchong, China
# Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, China
¤ Sichuan Forestry Survey, Design Research Institute Co., Chengdu, China
« Chinese Research Academy of Environmental Sciences, Beijing, China
» Sichuan Academy of Eco-Environmental Sciences, Chengdu, China

Corresponding author: Bo Cai ( caibo@cib.ac.cn )

Academic editor: Minh Duc Le
© 2025 Fengjing Liu, Yayong Wu, Jindong Zhang, Guang Yang, Shuo Liu, Xue Chen, Jiang Chang, Qiang Xie, Bo Cai.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Liu F, Wu Y, Zhang J, Yang G, Liu S, Chen X, Chang J, Xie Q, Cai B (2025) A new species of Diploderma Hallowell, 1861 (Squamata, Agamidae) discovered in the upper Dadu River valley of the Hengduan Mountains, Sichuan, China. ZooKeys 1251: 17-38. https://doi.org/10.3897/zookeys.1251.153705
ZooBank: urn:lsid:zoobank.org:pub:57B8D865-F451-40CB-AFD0-59BDB0316408
Open Access

Abstract

A new species of the genus Diploderma is described from the upper Dadu River Valley in the Hengduan mountains of Sichuan Province, China. Phylogenetic analyses based on the mitochondrial ND2 gene revealed that the new species, Diploderma bifluviale sp. nov., forms a distinct lineage within the Diploderma flaviceps group with an uncorrected genetic distance of ≥3.88%. Morphologically, the new species differs from its congeners by a combination of characters, including a shorter snout-vent length (SVL 62.51–72.55 mm), a shorter tail (TAL/SVL ratio 1.37–1.56), concealed tympanum, absence of a gular spot, and lemon-chiffon dorsolateral stripes with serrated edges in males. Additionally, Diploderma bifluviale sp. nov. exhibits unique coloration traits such as a wheat-colored tongue and the fourth toe with claw reaching either the tympanum or the area between shoulder and tympanum when hind limbs adpressed forward. The species inhabits semi-arid shrublands in warm-dry valleys at elevations of 2,187–2,525 m – a habitat that is distinct from those of its closest relatives. This discovery highlights the understudied biodiversity of the upper Dadu River. Diploderma bifluviale sp. nov. represents the 49th species of the genus and expands our understanding of morphological and ecological diversity within the D. flaviceps group.

Key words:

Agamidae, Barkam City, dry valley, Eastern Tibetan Plateau, Jinchuan County, lizard, ND2, taxonomy

Introduction

The genus Diploderma, belonging to the subfamily Draconinae (Squamata, Agamidae), is distributed across East Asia and the northern part of the Indochinese Peninsula (Wang et al. 2019a). To date, 46 species have been recognized within the genus Diploderma, making it one of the most species-rich genera among reptiles in China (Cai 2025). These lizards are characterized by their diverse morphology, color patterns, and ecological niches (Wang et al. 2024). Most species inhabit dry valley regions in the Hengduan mountains, exhibiting remarkable endemism and adaptability across a wide altitudinal range, particularly in the valleys of rivers such as the Jinsha, Yalong, Nu, and Lancang (Cai et al. 2024; Liu et al. 2024a).

The Dadu River, a significant tributary of the Yangtze River, flows through the Hengduan Mountains and extends more than 1,062 kilometers in length. It traverses diverse landscapes from its origins in the highlands of Qinghai Province to its confluence with the Min River in Sichuan Province (Feng 2019). The river valley is characterized by rugged terrain and complex ecological systems. This unique environment has fostered endemic species of Diploderma (Fig. 1): Diploderma daduense (Cai, Liu & Chang., 2024), Diploderma danbaense Liu, Hou, Wang, Ananjeva & Orlov, 2023, and Diploderma flaviceps (Barbour & Dunn, 1919) (Cai et al. 2024). Although extensive research has been conducted on the middle and lower reaches of the Dadu River, the upper reaches have received relatively less attention until recently.

Figure 1. 

Map showing the type localities of Diploderma bifluviale sp. nov. (blue dot), D. danbaense (red square), D. flaviceps (green triangle), and D. daduense (purple five-pointed star), (B) in the Dadu River Valley, south-western China (A).

Since 2018, our team has conducted numerous surveys in the upper reaches of the Dadu River. During these surveys, we encountered a lizard species that exhibited distinct characteristics not previously observed among known Diploderma species in the Dadu River valley (Fig. 1). Through molecular biological analyses and morphological studies, we confirmed that this newly discovered lizard represents a previously unrecognized species within the genus Diploderma.

Materials and methods

Sampling

Field surveys in Sichuan Province were conducted from August 2018 by BC, from May 2023 by BC and FL, and from July and August by YW. Specimens were collected from 10:00 to 17:00 hr from the upper reaches of the Dadu River near Shuangjiangkou in Barkam City and Jinchuan County, Sichuan Province (Fig. 1). Live animals were photographed to document their color patterns before anesthesia and euthanasia. Euthanasia was performed through the intracelomic injection of 250 mg/kg of 1% MS-222 (Chengdu, China) for anesthesia, followed by intracelomic injection of 75% alcohol (Chengdu, China). Genetic tissues from livers were stored in 99% ethanol, and specimens were preserved in 75% ethanol. All newly collected specimens were deposited at the Museum of Herpetology, Chengdu Institute of Biology, Chinese Academy of Sciences (CIB).

Morphological analysis

Museum abbreviations: The Museum of Herpetology, Chengdu Institute of Biology, Chinese Academy of Sciences (CIB); the Museum of Yibin Key Laboratory of Animal Diversity and Ecological Conservation, Yibin University (YBU); and Kunming Natural History Museum of Zoology, Kunming Institute of Zoology, Chinese Academy of Sciences (KIZ). Morphological data of recognized Diploderma species were obtained from the examination of museum specimens (Table 1), including the literature by Zhao et al. (1999), Liu et al. (2023), and Cai et al. (2024).

Table 1.
Download as
CSV
XLSX

GenBank accession numbers for the sequences used in this study.

Species Voucher Locality Accession no. References
1 Diploderma bifluviale sp. nov. 20180822 Barkam, Sichuan, China PV833282 This study
CIB-CB23JC02 Barkam, Sichuan, China PV833283 This study
CIB-CB23JC03 Barkam, Sichuan, China PV833284 This study
CIB-CB23JC04 Barkam, Sichuan, China PV833285 This study
CIB-CB23JC05 Barkam, Sichuan, China PV833286 This study
CIB-CB23JC06 Barkam, Sichuan, China PV833287 This study
CIB-CB23JC07 Barkam, Sichuan, China PV833288 This study
CIB-CB23JC08 Barkam, Sichuan, China PV833289 This study
CIB-CB23JC19 Barkam, Sichuan, China PV833292 This study
CIB-CB23JC20 Barkam, Sichuan, China PV833293 This study
YBU23081/GP10410 Jinchuan, Sichuan, China PV833294 This study
2 D. angustelinea Wang, Ren, Wu, Che & Siler, 2020 KIZ029704 Muli, Sichuan, China MT577930 Wang et al. 2020
KIZ029705 Muli, Sichuan, China MT577924 Wang et al. 2020
3 D. aorun Wang, Jiang, Zheng, Xie, Che & Siler, 2020 KIZ032733 Benzilan, Yunnan, China MT577938 Wang et al. 2020
KIZ032734 Benzilan, Yunnan, China MT577939 Wang et al. 2020
4 D. batangense (Li, Deng, Wu & Wang, 2001) KIZ09404 Zhubalong, Tibet, China MK001412 Wang et al. 2019a
KIZ019276 Batang, Sichuan, China MK001413 Wang et al. 2019a
KIZ019277 Batang, Sichuan, China MW133359 Che et al. 2021
5 D. brevicauda (Manthey, Denzer, Hou & Wang, 2012) KIZ044305 Lijiang, Yunnan, China MW506021 Wang et al. 2021
KIZ044306 Lijiang, Yunnan, China MW506022 Wang et al. 2021
6 D. bowoense Wang, Gao, Wu, Siler & Che, 2021 KIZ044757 Muli, Sichuan, China MW506020 Wang et al. 2021
KIZ044758 Muli, Sichuan, China MW506019 Wang et al. 2021
7 D. brevipes (Gressitt, 1936) NMNS19607 Taiwan, China MK001429 Wang et al. 2019a
NMNS19608 Taiwan, China MK001430 Wang et al. 2019a
8 D. chapaense (Bourret, 1937) KIZ034923 Lvchun, Yunnan, China MG214263 Wang et al. 2018
ZMMUNAP-01911 Chapa, Vietnam MG214262 Wang et al. 2018
9 D. danbaense Liu, Hou, Wang, Ananjeva & Orlov, 2023 KIZ2022048 Danba, Sichuan, China OQ378180 Liu et al. 2023
KIZ2022049 Danba, Sichuan, China OQ378181 Liu et al. 2023
KIZ2022050 Danba, Sichuan, China OQ378182 Liu et al. 2023
CIB-CB23JC17 Danba, Sichuan, China PV833290 This study
CIB-CB23JC18 Danba, Sichuan, China PV833291 This study
10 D. daduense (Cai, Liu & Chang., 2024) CIB-CB2021227 Hanyuan, Sichuan, China PP539949 Cai et al. 2024
CIB-CB2021228 Hanyuan, Sichuan, China PP539950 Cai et al. 2024
CIB-CB2021229 Hanyuan, Sichuan, China PP539951 Cai et al. 2024
CIB-CB2021239 Jinkouhe, Sichuan, China PP539955 Cai et al. 2024
CIB-CB2021246 Shimian, Sichuan, China PP539959 Cai et al. 2024
CIB-CB2021249 Shimian, Sichuan, China PP539962 Cai et al. 2024
CIB-CB2021252 Jinkouhe, Sichuan, China PP539963 Cai et al. 2024
11 D. daochengense Cai, Zhang, Li, Du, Xie, Hou, Zhou & Jiang, 2022 20210905 Muli, Sichuan, China OP595620 Cai et al. 2022
DC001 Daocheng, Sichuan, China OP595621 Cai et al. 2022
12 D. donglangense Liu, Hou, Ananjeva & Rao, 2023 KIZ2022057 Muli, Sichuan, China OQ378185 Liu et al. 2023
KIZ2022058 Muli, Sichuan, China OQ378186 Liu et al. 2023
13 D. drukdaypo (Wang, Ren, Jiang, Zou, Wu, Che & Siler, 2019) KIZ027627 Jinduo, Tibet, China MT577950 Wang et al. 2020
KIZ027628 Zhuka, Tibet, China MT577952 Wang et al. 2020
14 D. dymondi (Boulenger, 1906) KIZ040639 Dongchuan, Yunnan, China MK001422 Wang et al. 2019a
KIZ040640 Dongchuan, Yunnan, China MK001423 Wang et al. 2019a
15 D. fasciatum (Mertens, 1926) SYS r002175 Wuming, Guangxi, China OM055809 Wang et al. 2022
KIZ040192 Daweishan, Yunnan, China OM055800 Wang et al. 2022
16 D. flaviceps (Barbour & Dunn, 1919) KIZ01851 Luding, Sichuan, China MK001416 Wang et al. 2019a
KIZ01852 Luding, Sichuan, China MK001417 Wang et al. 2019a
17 D. flavilabre Wang, Che & Siler, 2020 KIZ032692 Baiyu,Sichuan, China MT577916 Wang et al. 2020
KIZ032694 Baiyu,Sichuan, China MT577917 Wang et al. 2020
KIZ032695 Baiyu,Sichuan, China MT577918 Wang et al. 2020
18 D. formosgulae Wang, Gao, Wu, Dong, Shi, Qi, Siler & Che, 2021 KIZ044420 Deqin, Yunnan, China MW506024 Wang et al. 2021
KIZ044421 Deqin, Yunnan, China MW506025 Wang et al. 2021
19 D. iadinum (Wang, Jiang, Siler & Che, 2016) KIZ027697 Yunling, Yunnan, China MT577956 Wang et al. 2020
KIZ027702 Yunling, Yunnan, China MT577957 Wang et al. 2020
20 D. jiulongense Liu, Hou, Ananjeva & Rao, 2023 KIZ2022086 Jiulong, Sichuan, China OQ378190 Liu et al. 2023
KIZ2022087 Jiulong, Sichuan, China OQ378191 Liu et al. 2023
21 D. kangdingense Cai, Zhang, Li, Du, Xie, Hou, Zhou & Jiang, 2022 20210916 Kangding, Sichuan, China OP595625 Cai et al. 2022
20210917 Kangding, Sichuan, China OP595626 Cai et al. 2022
22 D. laeviventre (Wang, Jiang, Siler & Che, 2016) KIZ014037 Basu, Tibet, China MK001407 Wang et al. 2019a
KIZ027691 Basu, Tibet, China MT577892 Wang et al. 2020
KIZ027692 Basu, Tibet, China MT577893 Wang et al. 2020
23 D. limingense Liu, Hou, Rao & Ananjeva, 2022 KIZ2022014 Yulong, Yunnan, China OP428782 Liu et al. 2022
KIZ2022015 Yulong, Yunnan, China OP428783 Liu et al. 2022
KIZ2022017 Yulong, Yunnan, China OP428784 Liu et al. 2022
24 D. luei (Ota, Chen & Shang, 1998) NMNS19604 Taiwan, China MK001433 Wang et al. 2019a
NMNS19605 Taiwan, China MK001434 Wang et al. 2019a
25 D. makii (Ota, 1989) NMNS19609 Taiwan, China MK001431 Wang et al. 2019a
NMNH19610 Taiwan, China MK001432 Wang et al. 2019a
26 D. menghaiense Liu, Hou, Wang, Ananjeva & Rao, 2020 KIZ L0030 Menghai, Yunnan, China MT598655 Liu et al. 2020
KIZ L0031 Menghai, Yunnan, China MT598656 Liu et al. 2020
27 D. micangshanense (Song, 1987) KIZ032801 Shiyan, Hubei, China MK578665 Wang et al. 2019b
KIZ023231 Xixia, Henan, China MK578664 Wang et al. 2019b
28 D. panchi Wang, Zheng, Xie, Che & Siler, 2020 KIZ032715 Yajiang, Sichuan, China MT577946 Wang et al. 2020
KIZ032716 Yajiang, Sichuan, China MT577944 Wang et al. 2020
29 D. panlong Wang, Che & Siler, 2020 KIZ040137 Miansha, Sichuan, China MT577906 Wang et al. 2020
KIZ040138 Miansha, Sichuan, China MT577907 Wang et al. 2020
30 D. polygonatum Hallowell, 1861 NMNS19598 Taiwan, China MK001427 Wang et al. 2019a
NMNS19599 Taiwan, China MK001428 Wang et al. 2019a
31 D. qilin Wang, Ren, Che & Siler, 2020 KIZ028332 Deqin, Yunnan, China MT577941 Wang et al. 2020
KIZ028333 Deqin, Yunnan, China MT577942 Wang et al. 2020
32 D. shuoquense Liu, Hou, Rao & Ananjeva, 2022 KIZ2022004 Xiangcheng, Sichuan, China OP428773 Liu et al. 2022
KIZ2022005 Xiangcheng, Sichuan, China OP428774 Liu et al. 2022
33 D. slowinskii (Rao, Vindum, Ma, Fu & Wilkinson, 2017) CAS214906 Gongshan, Yunnan, China MK001405 Wang et al. 2019a
CAS214954 Gongshan, Yunnan, China MK001406 Wang et al. 2019a
KIZ027543 Gongshan, Yunnan, China MT577910 Wang et al. 2020
34 D. splendidum (Barbour & Dunn, 1919) KIZ015973 Yichang, Hubei, China MK001418 Wang et al. 2019a
LSUMZ81212 Unknown AF288230 McGuire and Heang 2001
35 D. swild Wang, Wu, Jiang, Chen, Miao, Siler & Che, 2019 KIZ034914 Panzhihua, Sichuan, China MN266299 Wang et al. 2019c
KIZ034894 Panzhihua, Sichuan, China MN266300 Wang et al. 2019c
36 D. swinhonis (Günther, 1864) NMNS19592 Taiwan, China MK001419 Wang et al. 2019a
NMNS19593 Taiwan, China MK001420 Wang et al. 2019a
37 D. tachengense Liu, Hou, Ananjeva & Rao, 2023 KIZ2022028 Weixi, Yunnan, China OQ378195 Liu et al. 2023
KIZ2022027 Weixi, Yunnan, China OQ378196 Liu et al. 2023
38 D. varcoae (Boulenger, 1918) WK-JK 011 Yuxi, Yunnan, China MT577903 Wang et al. 2020
KIZ026132 Mengzi, Yunnan, China MK001421 Wang et al. 2019a
39 D. vela (Wang, Jiang, Siler & Che, 2023) KIZ019299 Quzika, Tibet, China MK001414 Wang et al. 2019a
KIZ034925 Quzika, Tibet, China MK001415 Wang et al. 2019a
40 D. xinlongense Cai, Zhang, Li, Du, Xie, Hou, Zhou & Jiang, 2022 20210907 Xinlong, Sichuan, China OP595613 Cai et al. 2022
20210908 Xinlong, Sichuan, China OP595614 Cai et al. 2022
41 D. yangi Wang, Zhang & Li, 2022 SWFU005410 Chayu, Tibet, China OL449603 Wang et al. 2022
SWFU005412 Chayu, Tibet, China OL449604 Wang et al. 2022
SWFU005414 Chayu, Tibet, China OL449605 Wang et al. 2022
42 D. yongshengense (Wang, Ren, Jiang, Siler & Che, 2023) KIZ2022009 Yongsheng, Yunnan, China OP428777 Liu et al. 2022
KIZ2022008 Yongsheng, Yunnan, China OP428778 Liu et al. 2022
43 D. yulongense (Manthey, Denzer, Hou & Wang, 2012) KIZ028291 Hutiaoxia, Yunnan, China MT577921 Wang et al. 2020
KIZ028292 Hutiaoxia, Yunnan, China MT577922 Wang et al. 2020
44 D. yunnanense (Anderson, 1878) CAS242271 Baoshan, Yunnan, China MK001408 Wang et al. 2019a
KIZ040193 Yingjiang, Yunnan, China MK578658 Wang et al. 2019b
45 D. zhaoermii (Gao & Hou, 2002) KIZ019564 Wenchuan, Sichuan, China MK001425 Wang et al. 2019a
KIZ019565 Wenchuan, Sichuan, China MK001426 Wang et al. 2019a
46 Pseudocalotes brevipes (Werner, 1904) MVZ224106 Vinh Phuc, Vietnam AF128502 Macey et al. 2000
47 Bronchocela cristatella (Kuhl, 1820) RMB8883 Unknown KR053114 Grismer et al. 2015
48 Laodracon carsticola Luu, Nguyen, Le, Bonkowski & Ziegler, 2020 NUOL.R.2022.01 Khammuone, Laos OR544068 Sitthivong et al. 2023

Measurements were conducted following the methods outlined by Zhao et al. (1999) and were taken to the nearest 1 mm using a steel ruler for snout-vent length and tail length, and to the nearest 0.1 mm using a digital caliper for other relatively short measurements. To minimize the influence of allometric effects, data from larvae and subadult individuals were excluded from morphological comparisons. A total of 11 specific measurements were recorded:

SVL Snout-vent length: from the tip of the snout to the anterior edge of the cloaca;

TAL Tail length: from the anterior edge of the cloaca to the tip of the tail;

HW Head width: measured between the widest points in the temporal region, anterior to the tympanum;

HL Head length: from the tip of the snout to the posterior angle of the jaw;

HD Head depth: at the temporal region of the head;

SEL Snout-eye length: from the tip of the snout to the anterior margin of the orbit;

TNC Length of the tallest nuchal crest: from the base to the apex of the tallest nuchal crest;

FLL Foreleg length: from the axilla to the tip of finger IV, excluding the claw, with the limb straightened;

HLL Hindleg length: from the groin to the tip of toe IV, excluding the claw, with the limb straightened;

TRL Trunk length: from the armpit to the groin;

T4L Toe IV length: from the tip of toe IV to the base between toes III and IV, excluding the claw.

The definitions of morphological characteristics and counting methods adhered primarily to Zhao et al. (1999) and Liu et al. (2023):

SL Supralabial scale count: labial scales from rostral to the corner of mouth;

NSL Nasal-supralabial scale rows: counted between the first supralabial and the nasal scale;

IL Infralabials: from the mental scale to the corner of the mouth;

VN Ventrals: counted in a straight line along the medial axis from the transverse gular fold to the anterior edge of the cloaca;

GU Gulars: counted in a straight line along the medial axis from and excluding the mental scale to the transverse gular fold;

MD Middorsal crest scales: counted longitudinally from the first nuchal crest scale to the scale above the cloaca;

F4S Finger IV subdigital lamellae: from the base between fingers III and IV to the tip of finger IV, excluding the claw;

T4S Toe IV subdigital lamellae: from the base between toes III and IV to the tip of toe IV, excluding the claw;

RSBE Radial stripes below the eyes: absent or present;

GF Gular fold state: absent or present;

GP Gular pouch state: absent or present;

TS Tympanum state: concealed by scales or exposed;

SFNC Skin fold under the nuchal crest: absent or present;

NC Nuchal crest state: strongly erected or not;

SFDC Skin fold under the dorsal crest: absent or present;

SDS Shape of dorsolateral stripes in males: smooth-edged or jagged;

VSS Ventral scale state: absent or present;

HAF Hindlimbs adpressed forward: measured as the area reached when hindlimbs are pressed forward;

ST Supratemporals: enlarged and modified temporal scales;

SOR Suborbital scale rows: longitudinal rows of scales between supralabials and inferior-most edge of orbit circle, excluding fine ciliary scales in the orbit.

Coloration descriptions utilized terminology and codes from the RGB (red, green, blue) color model (Cai et al. 2022). Data on coloration and ornamentation were gathered from live specimens both in unstressed and stressed states, including:

GSC Gular spot color;

ILC nner-lip coloration;

CO Coloration of the oral cavity: defined as the background coloration of the anterior roof and sides of the mouth, excluding the posterior palate and deep throat;

CTG Coloration of the tongue: defined as the coloration of the tongue;

CDS Coloration of the dorsolateral stripes: defined as the background coloration of the dorsolateral stripes;

VLBC Ventrolateral body coloration;

VBC Ventral body coloration.

The principal component analysis (PCA) was conducted using mensural data, including SVL, TAL, HL, HW, HD, SEL, FLL, HLL, T4L, and TRL, while morphological measurements for D. flaviceps and D. danbaense were sourced from Liu et al. (2023). Following size correction of the morphological measurements, PCA was performed to assess whether the newly collected specimens and species occupy distinct positions in morphospace, and to examine the congruence of these patterns with species boundaries inferred from molecular phylogenetic analyses. The PCA was performed using the prcomp command in R v. 4.3.2 (R Core Team 2025) and scatterplots were generated with the R package ggplot2 v. 3.4.4 (Wickham 2016). Considering that sexual dimorphism is acknowledged in morphometric measurements for species within the genus Diploderma (Wang et al. 2019a; Cai et al. 2022; Liu et al. 2023), mensural data for each sex were analyzed separately.

Molecular data and phylogenetic analysis

Total genomic DNA was extracted from the liver tissue of every specimen collected in this study using the QIAamp DNA Mini Kit (QIAGEN, Hilden, Germany) following the manufacturer’s recommended protocols. The mitochondrial gene NADH dehydrogenase subunit 2 (ND2) was amplified and sequenced. The primer sequences (Jap_70F: CCACCAAACAACTACACCTA, Jap_1559R: GGATTAATGCCCTCTGGATT) were retrieved from Wang et al. (2019a). The PCR and sequencing methods followed Liu et al. (2023).

The acquired nucleotide sequences were initially subjected to forward and reverse strand proofreading and editing using SeqMan 7.1.0.44 the DNAstar 7.1 software package (DNAStar Inc., Madison, WI, USA) (Skwor 2012). There were 13 novel sequences of ND2 obtained in this work, and a total of 103 ND2 sequences of 44 Diploderma species were downloaded from GenBank for phylogenetic analyses. In addition, corresponding sequences of Pseudocalotes brevipes (AF128502), Bronchocela cristatella (KR053114), and Laodracon carsticola (OR544068) were downloaded from GenBank and used as outgroups (Table 1).

Sequences were aligned in MEGA X (Kumar et al. 2018) using ClustalX (Thompson et al. 1997) with default settings. Phylogenetic analyses were conducted using Bayesian inference (BI) and maximum likelihood (ML) methods implemented in MrBayes v. 3.2.7a (Ronquist et al. 2012) and MEGA X (Kumar et al. 2018), respectively. Prior to the phylogenetic analyses, the best evolutionary model was selected based on the Bayesian Information Criterion (BIC) using ModelFinder (Kalyaanamoorthy et al. 2017). The GTR + I + G4 model was selected as the best model for the mitochondrial gene. In the BI analyses, two runs were performed simultaneously with four Markov chains. The chains were run for 10,000,000 generations and sampled every 1000 generations. The first 25% of the sampled trees were discarded as burn-in, and then the remaining trees were used to estimate Bayesian posterior probabilities (BPPs); nodes with BPP values of 0.95 and higher were considered well supported (Huelsenbeck et al. 2001; Wilcox et al. 2002). In the ML analyses, sequence substitution model was selected using the auto parameter with provision for Free-Rate heterogeneity. 1000 bootstrap pseudoreplicates via the ultrafast bootstrap (UFB) approximation algorithm were used to construct a final consensus tree; nodes with UFB values of 95% and above were considered significantly supported (Minh et al. 2013). Finally, uncorrected genetic pairwise distances (p-distances) for ND2 were calculated using default parameters in MEGA X (Kumar et al. 2018).

Results

Phylogeny

The ND2 sequence alignments were 984 bp in length, the BI and ML analyses produced two similar phylogenetic tree topologies, with all analyzed Diploderma species forming a strongly supported monophyletic group. We further identified the presence of six unique subclades within this group. The newly collected the upper Dadu River Valley population forms a distinct lineage within subclade II and constitutes a sister group with Diploderma danbaense, which is strongly supported by the analysis. The topological structures of the two phylogenetic trees are delineated with lines (Fig. 2), and the topological structure obtained from the Bayesian inference analysis is consistent with previous studies.

Figure 2. 

Maximum-likelihood and Bayesian inference phylogenies based on mitochondrial ND2 genes. ML bootstrap support and Bayesian posterior probability support is denoted above each node. The left panel of this figure depicts the Bayesian (BI) tree, while the right panel presents the maximum likelihood (ML) tree.

Uncorrected mean genetic distances ranged from approximately 1.36% to 27.50% across all samples, whereas the genetic distance between the population from the upper Dadu River Valley and other congeners is at least 3.88% (D. danbaense), which are all greater than the genetic distance (2.6%) between the two recognized species Diploderma drukdaypo and Diploderma vela (Suppl. material 1).

Morphology

Morphometric variation within subclade II species, including the upper Dadu River Valvey population, Diploderma flaviceps, and D. danbaense, was analyzed using PCA. Prior to analysis, we excluded two male D. flaviceps due to missing TAL data (Liu et al. 2023). and one female individual from the upper Dadu River valley population with pre-existing caudal damage upon collection. Prior to analysis, we excluded two male D. flaviceps and one female Diploderma bifluviale sp. nov. due to pre-existing caudal damage at the time of collection. For males, the first two principal components (PC1 and PC2) accounted for 71.41% and 16.69% of the variance, respectively, cumulatively explaining 88.09% of the total variance (Suppl. material 2). While PC1 showed marginal non-significance among species (p = 0.055), with only D. flaviceps-D. bifluviale approaching significance (p = 0.044), PC2 revealed extreme interspecific differentiation (p < 0.0001). This was driven by highly significant D. flaviceps contrasts with both D. bifluviale (p < 0.0001) and D. danbaense (p < 0.0001), while D. danbaense-D. bifluviale showed no differentiation (p = 0.437). Variables of FLL, SVL, SEL, and TAL presented high loadings on these components. For females, PC1 explained 62.9% of the variance, while PC2 added 21.37%, resulting in a cumulative variance of 84.28% (Suppl. material 3). ANOVA revealed no significant differences among species in PC1 scores (p = 0.222), supported by Tukey’s HSD tests (all pairwise p > 0.23). In contrast, PC2 scores differed significantly overall (p < 0.0001), with post-hoc tests indicating pronounced divergence between D. flaviceps and D. bifluviale (p < 0.0001), marginal significance between D. danbaense and D. bifluviale (p = 0.045), and a non-significant trend between D. flaviceps and D. danbaense (p = 0.065). The first two principal components showed higher loadings for variables of SVL, HL, TAL, and SEL. The PCA scatter plot based on morphological data reveals distinct intraspecific clustering and interspecific separation among individuals of the upper Dadu River Valley population and its two phylogenetically close congeners D. danbaense and D. flaviceps, with this pattern being consistently maintained in both male and female specimens (Fig. 3).

Figure 3. 

PCA based on ten morphometric characteristics (SVL, TAL, HL, HW, HD, SEL, FLL, HLL, T4L, and TRL) for Diploderma bifluviale sp. nov. (blue), D. danbaense (red), and D. flaviceps (green). Numbers inside the brackets indicate the percentages of the total variance explained by each axis.

Taxonomy

Diploderma bifluviale sp. nov.

https://zoobank.org/63E48A43-C4CC-4ABC-BDE7-B1CA02CCEBEC
Figs 4, 5

Japalura flaviceps authority, date: Zhao 2003: 84, partim in the Aba Tibetan and Qiang Autonomous Prefecture

Type material.

Holotype : • CIB119368 (field number CB23JC04), adult male, collected from Baiwan Town (31.809249°N, 101.88182°E, 2306 m a.s.l.), Barkam City, Aba Tibetan and Qiang Autonomous Prefecture, Sichuan Province, China (Fig. 4). Allotype: • CIB119369 (field number CB23JC08), adult female, also collected from Baiwan Town (31.803494°N, 101.91378°E, 2525 m a.s.l.) (Fig. 5B). Paratypes: • subadult CIB-CB23JC02 and female CIB-CB23JC03 are collected from Baiwan Town (31.807989°N, 101.886555°E, 2314 m); • juvenile CIB-CB23JC05, male CIB-CB23JC06 and female CIB-CB23JC07 are collected from the same location as holotype; male CIB-CB23JC19 and female CIB-CB23JC20 are collected from Baiwan Town (31.809273°N, 101.881811°E, 2304 m a.s.l.), and juvenile CIB-201808022 was collected from Baiwan Town (31.808662°N 101.883118°E, 2290 m a.s.l.), • female YBU23081 (GP10410) was collected from Lewu Town (31.466004°N, 102.091464°E, 2252 m a.s.l.), Jinchuan County Aba Tibetan and Qiang Autonomous Prefecture, Sichuan Province, China, and subadult YBU22294 was collected from Xinsha village (31.59322°N, 102.06453°E, 2187 m a.s.l.), Jichuan County.

Figure 4. 

Holotype (CB23JC04) of Diploderma bifluviale sp. nov. in life. A. Dorsal view; B. Close up-view of the dorsal side of the head; C. Lateral view; D. Close up-view of the lateral side of the head; E. Ventral view; F. Close up-view of the ventral side of the head; G. Close-up view of the oral cavity; H. Close-up views of the femoral and precloacal regions.

Figure 5. 

Diploderma bifluviale sp. nov. from near the type locality and habitats of the new species. A. Holotype CB23JC04 (male) lateral view; B. Allotype CB23JC08 (female) dorsal view; C. Distant view of the type locality of Diploderma bifluviale sp. nov.; D. Close view of the type locality of Diploderma bifluviale sp. nov.

Diagnosis.

Diploderma bifluviale sp. nov. can be diagnosed from other Diploderma species by a combination of the following morphological characteristics: (1) body size short, SVL 62.51~64.47 mm, mean 63.62 mm (sample standard deviation 1.01) in adult males, 63.13~72.55 mm, mean 68.41 mm (3.53) in adult females; (2) tail short, TAL/SVL 1.41~1.53, mean 1.48 (0.06) in adult males, 1.37~1.56, mean 1.46 (0.08) in adult female; (3) head relatively long, HW/HL 0.71~0.78, mean 0.75 (0.03) in adult males, 0.68~0.74, mean 0.72 (0.02) in adult females; (4) limbs moderately long, FLL/SVL 0.42~0.44, mean 0.43 (0.01) in adult males, 0.41~0.42, mean 0.41 (0.01) in adult females, HLL/SVL 0.64~0.69, mean 0.66 (0.03) in adult males, 0.64~0.69, mean 0.65 (0.02) in adult females; (5) MD 49~54; (6) F4S 15~17, T4S 20~23; (7) tympanum concealed; (8) nuchal and dorsal crests almost continuous, scales of nuchal and dorsal crests enlarged, moderately erected skin fold under nuchal in males in life, weakly erected skin fold under nuchal crest and no skin fold under dorsal crest in females in life; (9) distinct transverse gular fold present; (10) ventral scales of head almost uniform in size, posterior and side ones smaller, all strongly keeled; (11) ventral scales of body strongly keeled; (12) gular spot absent in both sexes; (13) dorsolateral stripes distinct in males, strongly jagged and the upper and lower edges are almost touching each other, pale yellow in life; (14) a series of dark spots or a dark stripe like large wavy between dorsolateral stripes on dorsum; (15) a distinct wide black stripe on shoulder fold region on each side; (16) stripes around eye absent or very indistinct; (17) tongue wheat color in life; (18) fourth toe with claw reaching either the tympanum or the area between shoulder and tympanum when hind limbs adpressed forward (Table 2).

Table 2.
Download as
CSV
XLSX

Morphological comparison between Diploderma bifluviale sp. nov., D. danbaense, and D. flaviceps (range value and average value). Morphometric measurements are in the unit of mm.

Diploderma bifluviale sp. nov. D. danbaense D. flaviceps
♂ (n = 3) ♀ (n = 5) ♂ (n = 6) ♀ (n = 2) ♂ (n = 18) ♀ (n = 9)
SVL 62.51~64.47 (63.62) 63.13~72.55 (68.41) 64.72~77 (70.05) 69.14~76.6 (72.87) 60.5~75.6 (68.42) 53.4~67.1 (61.78)
TAL 88.24~97.68 (93.91) 93.41~108.9 (100.43) 112.7~130 (121.10) 109.8~119.1 (114.45) 117.7~151 (135.20) 103.7~127 (116.76)
HL 19.63~20.51 (20.01) 19.48~21.48 (20.28) 21.38~26.6 (22.88) 19.52~23.5 (21.51) 18.9~24.9 (22.08) 16.3~127 (18.82)
HW 14.64~15.58 (14.96) 13.31~15.73 (14.57) 14.4~17.9 (15.81) 13.86~14.7 (14.28) 14.6~20.6 (17.38) 12.6~15.6 (13.97)
HD 11.63~12.94 (12.30) 9.68~13.36 (11.61) 10.87~15 (13.11) 11.5~12.8 (12.15) 10.7~14.8 (12.88) 9.6~12.5 (10.90)
SEL 7.85~9.28 (8.56) 8.39~9.02 (8.71) 7.5~9.9 (8.68) 8.4~8.78 (8.59) 5.9~8.9 (7.42) 5.2~6.8 (6.17)
FLL 26.24~28.16 (27.05) 25.69~29.83 (28.38) 28.7~33.1 (31.42) 28.44~33.6 (31.02) 28.8~36.1 (32.37) 24.3~31.6 (28.53)
HLL 40.37~44.2 (41.99) 40.2~47.24 (44.72) 45.73~53.5 (48.83) 43.9~50 (46.95) 46.3~56.4 (51.87) 37.2~50.1 (45.81)
T4L 10.52~10.67 (10.58) 9.39~11.39 (10.78) 10.01~12.4 (11.79) 11.17~12.1 (11.64) 11.4~14.9 (13.11) 9.6~11.7 (11.13)
TRL 28.88~29.66 (29.15) 30.67~35.35 (33.96) 28.78~33.2 (31.05) 32.55~34.5 (33.53) 26.7~34.6 (30.86) 24.3~33 (28.98)
TAL/SVL 1.41~1.53 (1.48) 1.37~1.56 (1.46) 1.61~1.89 (1.73) 1.55~1.59 (1.57) 1.88~2.09 (1.99) 1.72~2.17 (1.90)
SEL/HL 0.40~0.45 (0.43) 0.42~0.44 (0.43) 0.35~0.43 (0.38) 0.36~0.45 (0.40) 0.31~0.37 (0.34) 0.3~0.34 (0.33)
HW/HL 0.71~0.78 (0.75) 0.68~0.74 (0.72) 0.64~0.75 (0.69) 0.63~0.71 (0.67) 0.76~0.84 (0.79) 0.71~0.78 (0.74)
HD/HW 0.79~0.88 (0.82) 0.73~0.86 (0.80) 0.74~0.90 (0.83) 0.83~0.87 (0.85) 0.7~0.78 (0.74) 0.75~0.83 (0.78)
FLL/SVL 0.42~0.44 (0.43) 0.41~0.42 (0.41) 0.41~0.48 (0.45) 0.41~0.44 (0.42) 0.44~0.49 (0.47) 0.43~0.49 (0.46)
HLL/SVL 0.64~0.69 (0.66) 0.64~0.69 (0.65) 0.66~0.71 (0.70) 0.63~0.65 (0.64) 0.72~0.8 (0.76) 0.7~0.81 (0.74)
TRL/SVL 0.45~0.46 (0.46) 0.48~0.52 (0.50) 0.43~0.46 (0.44) 0.45~0.47 (0.46) 0.41~0.49 (0.45) 0.44~0.5 (0.47)
MD 50~54 (52.33) 49~50 (49.60) 47~53 (49.33) 49~58 (56.00) 40~55 (46.12) 46~54 (50.00)
VN 63~64 (63.33) 62~64 (62.80) 61~72 (65.83) 64~74 (69.00) − −
SL 9~11 8~11 9~10 9~11 9~11 9~11
IL 10~13 9~12 10~11 9~12 10–12 10~12
NSL 1~2 1~2 1~2 2 1~2 1~2
F4S 16~16 15~17 16~20 17~20 16~20 16~18
T4S 21~21 20~23 21~26 21~26 22~26 22~27
SOR 3~4 3~4 3~5 4~5 3~5 3~5

Description of holotype.

Adult male, body relatively small-sized, SVL 62.5 mm; tail short, TAL 88.2mm; head longer (19.9 mm) than wide (15.6 mm); head depth 12.3 mm; length of tallest nuchal crest 0.5 mm; snout–eye length 8.6 mm; foreleg length 26.2 mm; hindleg length 40.4 mm; toe IV length 10.5 mm; trunk length 28.5 mm; snout moderately long, SEL/HL 0.43. Rostral flat, bordered by six small postrostral scales; dorsal head scales heterogeneous in size, most of them keeled. Number of scales between supraoculars 16; nasal scale approximately oval; internasals 9; loreals 7/6, small, unkeeled; mental pentagonal; supralabials 10/10, infralabial scales 11/13, supratemporals 4/3, and middorsal crest scales 54, keeled; gular scales 30 and ventralscales 64; finger IV subdigital lamellae 16/17; toe IV subdigital lamellae 21/22; nasal supralabial scale rows 1/1; suborbital scale rows 3/4. Transverse gular fold present; gular pouch present in life; tympanum concealed, covered with small keeled scales; well-developed skin fold under nuchal crest present, vertebral crest continuous between nuchal and dorsal sections; axillary scales much smaller than remaining dorsals; dorsal and ventral scales distinctively keeled exclude scales around eyes and lips; dorsal scales of head, trunk, limbs, and tail heterogeneous in size, ventral scales of head almost ventral scales of head almost uniform in size with few larger scales, posterior and side ones smaller, all strongly keeled; fold present in front of shoulder; fourth toe with claw reaching at tympanum when hindlimbs adpressed forward. Upper and lower edges of dorsolateral stripes are strongly serrated and separated only by a lemon-chiffon dorsal scale at the serrated tip; tail scales all strongly keeled, ventral tail scales slightly larger than dorsal tail scales; fourth toe with claw reaching tympanum when hind limbs adpressed forward (Table 2).

Coloration in life.

The dorsal head is mainly dark khaki (189, 183, 107), with an olive (128, 128, 0) transverse stripe at the front and a blurred olive stripe at the back connecting the left and right supraoculars, and olive markings on the anterodorsal edge. Olive dots walking on the rest of dorsal head. Lateral surfaces of head grey (128, 128, 128) to dark khaki. There are seven stripes around the upper eye except the subocular regions on each side, with a thick black and dark khaki stripe extending from the posterior nasal through the lower palpebral to the temporal region. The subocular scale rows are white-smoke (245, 245, 245) with few dark grey (169, 169, 169) scales. The supralabials and infralabials are white smoke with dark grey, make the eye area appear inconspicuous radial lines. The inner-lip coloration is smoky white, and the coloration of the tongue wheat (245, 222, 179).

The dorsal surface is predominantly dark khaki. A lemon-chiffon (255, 250, 205) strongly jagged dorsolateral stripe from neck to pelvis on each side of body. At the serrated tip, the upper and lower edges of these stripes are separated only by a lemon-chiffon dorsal scale. Between the dorsolateral stripes there is an almost continuous black to olive almost wavy pattern. A distinct wide black stripe on shoulder fold region on each side. Some reticular markings below dorsolateral stripe on each side of body, with dark-khaki patches wrapped around a larger white (255, 255, 255) dorsal scale on each side of body. Dorsal surfaces of limbs dark khaki with black to olive trans verse bands. Dorsal surface of tail wheat with olive transverse bands.

Ventral surface of head white-smoke with dim grey (105, 105, 105) reticulated pattern. No gular spot. Ventral surfaces of body and limbs white-smoke with dim grey with smoke pattern, ventral surface of tail white-smoke with indistinct dark khaki transverse bands (Fig. 4).

Variations.

Diploderma bifluviale sp. nov. is sexually dimorphic: (1) males are smaller than females, SVL 62.51~64.47 (mean 63.62) mm vs 63.13~72.55 (mean 68.41) mm; (2) trunk relatively shorter, TRL/SVL 0.45~0.46 (mean 0.46) vs 0.48~0.52 (mean 0.50); (3) fore-limb relatively longer, FLL/SVL 0.42~0.44 (mean 0.43) vs 0.41~0.42 (mean 0.41); (4) skin folds under nuchal and dorsal crest obviously present in adult males only; (5) dorsolateral stripes prominent present in adult males, absent or not noticeable in females.

Comparisons.

Diploderma bifluviale sp. nov. differs from D. flaviceps by having the following combined characteristics: (1) relatively shorter body (SVL 62.51~64.47 [mean 63.62] mm vs 60.5~75.6 [mean 68.42] mm in males; (2) relatively shorter tail (TAL/SVL 1.41~1.53 vs 1.88~2.09 in males, 1.37~1.56 vs 1.72~2.17 in females); (3) relatively shorter fore-limbs (FLL/SVL 0.42~0.44 [mean 0.43] vs 0.44~0.49 [mean 0.47] in males; (4) relatively shorter hind limbs (HLL/SVL 0.64~0.69 [mean 0.66] vs 0.72–0.80 [mean 0.76] in males, 0.64~0.69 [mean 0.65] vs 0.7~0.81 [mean 0.74] in females; (5) relatively longer snout–eye length (SEL/HL 0.42~0.44 [mean 0.43] vs 0.30~0.34 [mean 0.33] in females (Table 2); (6) moderately erected skin fold under dorsal crest in males in life (vs strongly erected) and the absence of a skin fold under dorsal crest in females in life (vs presence); (7) upper and lower edges of dorsolateral stripes are separated only by a lemon-chiffon dorsal scale at the serrated tip in males (vs relatively smooth or wavy and separated by more than 3 dorsal scales), dorsolateral stripes absent or not noticeable in females (vs distinct); (8) tongue wheat color in life (vs ‘pale flesh’ [240, 208, 202]); (9) fourth toe with claw reaching either the tympanum or the area between shoulder and tympanum when hind limbs adpressed forward (vs reaching the posterior edge of the eye).

Diploderma bifluviale sp. nov. differs from D. danbaense by having the following combined characteristics: (1) relatively shorter body (SVL 62.51~64.47 [mean 63.62] mm vs 64.72~77 [mean 70.05] mm in males; (2) relatively shorter tail (TAL/SVL 1.41~1.53 vs 1.61~1.89 in males, 1.37~1.56 vs 1.55~1.59 in females); (3) relatively shorter head (HL 19.63~20.51 [mean 20.01] mm vs 21.38~26.6 [mean 22.88]) in males; (4) relatively shorter hind limbs (HLL/SVL 0.64~0.69 [mean 0.66] vs 0.66~0.71 [mean 0.70] in males; (5) relatively longer trunk length (TRL/SVL 0.48~0.52 [mean 0.50] vs 0.45~0.47 [mean 0.46]) in adult females (Table 2); (6) upper and lower edges of dorsolateral stripes are separated only by a lemon-chiffon dorsal scale at the serrated tip in males (vs relatively smooth or wavy and separated by 3 [fewer 1] dorsal scales); (7) tongue wheat color in life (vs ‘pale flesh’); (8) fourth toe with claw reaching either the tympanum or the area between shoulder and tympanum when hind limbs adpressed forward (vs the area between eyes and ears).

Diploderma bifluviale sp. nov. differs from D. daduense (Cai, Liu & Chang, 2024) by having the following combined characteristics: (1) relatively shorter body (SVL 62.51~64.47 [mean 63.62] mm vs 74.7–95.0 [mean 86.5] mm in males; (2) relatively shorter tail (TAL/SVL 1.41~1.53 vs 2.04~2.62 in males; (3) dorsolateral stripes are lemon-chiffon (vs green-yellow anteriorly, cyan in the center, and blurry off-white posteriorly); (4) tongue wheat color in life (vs ‘pale flesh’).

Diploderma bifluviale sp. nov. differs from D. brevipes (Gressitt, 1936), D. chapaense (Bourret, 1937), D. fasciatum (Mertens, 1926), D. hamptoni (Smith, 1935), D. luei (Ota, Chen & Shang, 1998), D. makii (Ota, 1989), D. menghaiense Liu, Hou, Wang, Ananjeva & Rao, 2020, D. micangshanense (Song, 1987), D. nangunhe Liu, Li, (Yang, Hou, Rao & Ananjeva, 2024), D. ngoclinense (Ananjeva, Orlov & Nguyen, 2017), D. polygonatum Hallowell, 1861, D. swinhonis (Günther, 1864), and D. yunnanense (Anderson, 1878) by the presence of a transverse gular fold (vs absence).

Diploderma bifluviale sp. nov. differs from D. dymondi (Boulenger, 1906), D. panlong Wang, Che & Siler, 2020, D. slowinskii (Rao, Vindum, Ma, Fu & Wilkinson, 2017), D. swild Wang, Wu, Jiang, Chen, Miao, Siler & Che, 2019, and D. varcoae (Boulenger, 1918) by having concealed tympana (vs exposed).

Diploderma bifluviale sp. nov. differs from D. angustelinea Wang, Ren, Wu, Che & Siler, 2020, D. aorun Wang, Jiang, Zheng, Xie, Che & Siler, 2020, D. batangense (Li, Deng, Wu & Wang, 2001), D. bowoense Wang, Gao, Wu, Siler & Che, 2021, D. brevicauda (Manthey, Denzer, Hou & Wang, 2012), D. chapaense (Bourret, 1937), D. daochengense Cai, Zhang, Li, Du, Xie, Hou, Zhou & Jiang, 2022, D. donglangense Liu, Hou, Ananjeva & Rao, 2023, D. flavilabre Wang, Che & Siler, 2020, D. formosgulae Wang, Gao, Wu, Dong, Shi, Qi, Siler & Che, 2021, D. iadinum (Wang, Jiang, Siler & Che, 2016), D. jiulongense Liu, Hou, Ananjeva & Rao, 2023, D. kangdingense Cai, Zhang, Li, Du, Xie, Hou, Zhou & Jiang, 2022, D. laeviventre (Wang, Jiang, Siler & Che, 2016), D. limingense Liu, Hou, Rao & Ananjeva, 2022, D. nangunhe Liu, Li, Yang, Hou, Rao & Ananjeva, 2024, D. panchi Wang, Zheng, Xie, Che & Siler, 2020, D. qilin Wang, Ren, Che & Siler, 2020, D. splendidum (Barbour & Dunn, 1919), D. tachengense Liu, Hou, Ananjeva & Rao, 2023, D. xinlongense Cai, Zhang, Li, Du, Xie, Hou, Zhou & Jiang, 2022, D. yangi Wang, Zhang & Li, 2022, D. yongshengense, D. yulongense, and D. zhaoermii (Gao & Hou, 2002) by the absence of a gular spot in males in life (vs presence of a colourful gular spot).

Diploderma bifluviale sp. nov. differs from D. drukdaypo (Wang, Ren, Jiang, Zou, Wu, Che & Siler, 2019) by having strongly keeled ventral scales of body (vs smooth or weakly keeled); from D. qiaojiaense (Liu, Hou & Rao, 2024) by having lemon-chiffon dorsolateral stripes in males in life (vs light green); from D. grahami (Stejneger, 1924) due to having relatively longer hind limbs (HLL/SVL 0.64~0.69 vs 0.61), and the presence of dorsolateral stripes (vs absence) in males; from D. kangdingense Cai, Zhang, Li, Du, Xie, Hou, Zhou & Jiang, 2022 by having dim grey ventrolateral surface of body in males in life (vs yellow); from D. shuoquense Liu, Hou, Rao & Ananjeva, 2022 by having strongly keeled ventral head scales and from D. vela (Wang, Jiang & Che, 2015) by having inconspicuous radial lines around the eyes (vs distinct radial stripes), and having moderately erected skin fold under nuchal (vs a pronounced, sail-like, and continuous vertebral crest) in males.

Distribution and natural history.

Diploderma bifluviale sp. nov. is currently known to inhabit the semi-arid region of warm-dry valley in the upper reaches of the Dadu River. It is primarily concentrated around Shuangjiangkou, located at the confluence of the Chuosijia River and the Jiaomuzu River, spanning Jinchuan County and Barkam City (Ma’erkang City) within the Aba Tibetan and Qiang Autonomous Prefecture, Sichuan Province, China (Fig. 1). This area is characterized by long hours of sunlight, frequent clear days, distinct wet and dry seasons, and significant diurnal temperature variations (Zhang 1992). The known distribution range of Diploderma bifluviale sp. nov. exhibits higher humidity and greater vegetation coverage compared to that of D. danbaense.

The species is known to inhabit altitudes ranging from 2187 to 2314 meters, residing in arid shrublands with small leaves and scattered rock piles, where the shrubs can reach heights of 0.5–2 meters (Fig. 5). All specimens were collected between 09:00 and 18:00 hr from June to August. During the investigation, it was observed that this species preys on valley insects, this species represents one of the few secondary consumers inhabiting this arid river valley ecosystem.

This species is oviparous. Specimens CB23JC16, CIB119369, CB23JC07, CB23JC03, and CB23JC20 were found to contain 3, 5, 6, 6, and 7 eggs, respectively.

Etymology.

The specific epithet bifluviale is derived from the Latin words bi- meaning two, and fluviale, relating to rivers. This name refers to the species’ discovery location near Shuangjiangkou (双江口), which denotes the area around the confluence of the Chuosijia River (绰斯甲河, Chuosi River) and the Jiaomuzu River (脚木足河, Kyom-kyo River) of Sichuan Province, China. We suggest Upper Dadu Mountain Lizard as its English common name and 双江口攀蜥 (Chinese phonetic alphabet: Shuāng jiāng kǒu Pānxī) as its Chinese common name.

Discussion

Based on integrated phylogenetic analysis and the PCA of morphological data, we propose that the Diploderma species from the upper Dadu River Valley represents a distinct species. The species delimitation employing ND2 gene-based phylogenetic reconstruction has been extensively validated (Wang et al. 2019b; Cai et al. 2022, 2024; Liu et al. 2023, 2024a, b), although minor topological discrepancies were observed between phylogenetic trees generated by two different algorithmic approaches (BI and ML). These variations likely reflect inherent methodological differences between BI and ML analytical frameworks (Yang 1994; Yang and Rannala 1997). Notably, in subclade II, both phylogenetic analyses consistently and unambiguously support the status of Diploderma bifluviale sp. nov. as a distinct species. Future studies with more genes and species will help strengthen the evolutionary relationships within the Diploderma genus. PCA further demonstrates that Diploderma bifluviale sp. nov. is morphometrically distinct from its two phylogenetically closest congeners, D. danbaense and D. flaviceps.

Diploderma bifluviale sp. nov. is the northernmost species within the D. flaviceps group, inhabiting shrublands on both sides of the upper Dadu River’s warm-dry valleys. Through several surveys conducted by us from 2018 to 2024, only a few individuals were observed on three occasions, indicating that this species is rare and may constitute a very small population. The discovery of this novel species carries substantial conservation significance for informing future biodiversity preservation strategies.

The known concentrated distribution area of this species has been partially submerged by the Shuangjiangkou Reservoir. This reservoir serves as a controlling reservoir for the upper reaches of the Dadu River mainstream and possesses annual regulation capabilities. The dam area is located approximately 2–6 kilometers downstream from the confluence of the Chuosijia River and the Jiaomuzu River in Barkam City and Jinchuan County, Aba Prefecture. Currently, the main structure of the reservoir has been completed, and initial water storage began in November 2024.

According to the relevant laws and regulations concerning ecological protection in China, the construction of hydropower stations follows a series of stringent procedures. However, practical implementation may sometimes fall short due to shorter project execution cycles, limited funding, and significant time pressures on construction schedules, which can lead to insufficient time allocated for biodiversity baseline surveys, EIA investigations, and ecological remediation. Consequently, some species within the region may be overlooked, and ecological compensation measures are frequently simplified. The timing of water storage often conflicts with biological rhythms, not avoiding critical periods for bird breeding or reptile hibernation.

To address these issues, it is recommended that relevant departments allocate sufficient time for biodiversity baseline surveys, environmental impact assessment investigations, and ecological remediation. Full consideration should be given to the impacts of reservoir construction on local native species, particularly endemic ones. Water storage schedules should respect biological rhythms, avoiding periods crucial for spawning and hibernation. Such an approach would mitigate adverse effects on wildlife, allowing them to adapt swiftly and migrate autonomously to areas above the new waterline, thereby adhering more closely to ecological management laws and principles of ecological protection.

Comparative specimens examined

Diploderma flaviceps : Sanhe Township, Luding County (YBU23217), Kongyu Township, Luding County (YBU22717), Marr Village, Danba County (YBU23222), Pengba, Luding County (KIZ 057784, KIZ 84001, KIZ 84003, KIZ 057785), Shelian, Kangding City (KIZ 820065, KIZ 820052, KIZ 820068, KIZ 820069, KIZ 820054, KIZ 820049, KIZ 820070, KIZ 820047, KIZ 820050, KIZ 820055, KIZ 820043, KIZ 820046, KIZ 820081, KIZ 820056, KIZ 820045, KIZ 820059, KIZ 820048, KIZ 820057, KIZ 820067, KIZ 820061, KIZ 820071, KIZ 820044, KIZ 820058).

Diploderma danbaense : Bawang Township, Danba County (CIB-CB23JC17, CIB-CB23JC18, KIZ2022048, KIZ2022049, KIZ2022050, KIZ2022056, KIZ2022051), Geshiza Township, Danba County (YBU231989).

Acknowledgements

We would like to express our gratitude to Professor Peng Guo from the Museum of Yibin Key Laboratory of Animal Diversity and Ecological Conservation, Yibin University (YBU), as well as Director Bin Wang and Mr. Ke Lyu from the Museum of Herpetology, Chengdu Institute of Biology, Chinese Academy of Sciences (CIB), for their assistance in examining the specimens. We also thank Sichuan Provincial Institute of Forestry and Grassland Inventory and Planning for their support and assistance.

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Use of AI

No use of AI was reported.

Funding

This work was supported by Survey and assessment of diversity and population status of amphibians and reptiles in typical mountain areas of Sichuan Province (grant no. 2024-ZX-ZCHTSQ-1100), Biological Resources Programme, Chinese Academy of Sciences, the Position of Bioclassonomist of Chinese Academy of Sciences (grant no. CAS-TAX-24), and Foundation of Yunnan Key Laboratory of Biodiversity Information, Kunming Institute of Zoology, Chinese Academy of Sciences.

Author contributions

Conceptualization: F.L. and B.C.; Data curation: F.L., Y.W., S.L. and B.C.; Formal analysis: F.L., and B.C.; Funding acquisition: S.L., J.Z. and J.C.; Investigation: F.L., Y.W., J.Z., X.C., Q.X. and B.C.; Methodology: F.L. and B.C.; Project administration: B.C.; Resources: G.Y. and B.C.; Software: F.L. and B.C.; Supervision: Q.X. and B.C.; Validation: F.L. and B.C.; Visualization: F.L. and B.C.; Writing – original draft: F.L., Y.W., S.L., X.C. and B.C.; Writing – review and editing: F.L., J.Z., G.Y., J.C. and B.C. All authors have read and agreed to the published version of the manuscript.

Author ORCIDs

Fengjing Liu https://orcid.org/0009-0002-7280-1416

Yayong Wu https://orcid.org/0000-0003-2752-4085

Guang Yang https://orcid.org/0000-0001-6285-6937

Shuo Liu https://orcid.org/0000-0001-7825-3006

Xue Chen https://orcid.org/0000-0002-1953-1333

Jiang Chang https://orcid.org/0000-0001-7064-9321

Bo Cai https://orcid.org/0000-0002-4214-9060

Data availability

All of the data that support the findings of this study are available in the main text or Supplementary Information.

References

  • Cai B, Zhang MH, Li J, Du SM, Xie F, Hou M, Zhou HM, Jiang JP (2022) Three new species of Diploderma Hallowell, 1861 (Reptilia: Squamata: Agamidae) from the Shaluli Mountains in Western Sichuan, China. Asian Herpetological Research 13(4): 205–223. https://doi.org/10.16373/j.cnki.ahr.220040
  • Cai B, Liu F, Liang D, Hou M, Zhou H, Zhong J, Li J, Chang J (2024) A new species of Diploderma (Squamata, Agamidae) from the Valley of Dadu River in Sichuan Province, with a Redescription of Topotypes of D. splendidum from Hubei Province, China. Animals 14(9): e1344. https://doi.org/10.3390/ani14091344
  • Che J, Jiang K, Yan F, Zhang YP (2021) Amphibians and Reptiles in Tibet: Diversity and Evolution. Science Press, Beijing, China, 459 pp. [In Chinese]
  • Grismer LL, Wood PLJ, Lee CH, Quah ESH, Anuar S, Ngadi E, Sites JWJ (2015) An integrative taxonomic review of the agamid genus Bronchocela (Kuhl, 1820) from Peninsular Malaysia with descriptions of new montane and insular endemics. Zootaxa 3948(1): 1–23. https://doi.org/10.11646/zootaxa.3948.1.1
  • Huelsenbeck JP, Ronquist F, Nielsen R, Bollback JP (2001) Bayesian inference of phylogeny and its impact on evolutionary biology. Science 294(5550): 2310–2314. https://doi.org/10.1126/science.1065889
  • Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS (2017) ModelFinder: Fast model selection for accurate phylogenetic estimates. Nature Methods 14(6): 587–589. https://doi.org/10.1038/nmeth.4285
  • Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Molecular Biology and Evolution 35(6): 1547–1549. https://doi.org/10.1093/molbev/msy096
  • Liu S, Hou M, Rao D (2024a) A New Species of Diploderma Hallowell, 1861 (Reptilia, Squamata, Agamidae) from Northeastern Yunnan Province, China. Taxonomy 4(2): 412–431. https://doi.org/10.3390/taxonomy4020020
  • Liu S, Li Z, Yang T, Hou M, Rao D, Ananjeva NB (2024b) A new species of Diploderma (Squamata: Sauria: Agamidae) from Yunnan Nangunhe National Nature Reserve, China. Russian Journal of Herpetology 31(6): 379–391. https://doi.org/10.30906/1026-2296-2024-31-6-379-391
  • Macey JR, Schulte JA II, Larson A, Ananjeva NB, Wang Y, Pethiyagoda R, Rastegar-Pouyani N, Papenfuss TJ (2000) Evaluating trans-Tethys migration: An example using acrodont lizard phylogenetics. Systematic Biology 49(2): 233–256. https://doi.org/10.1093/sysbio/49.2.233
  • McGuire JA, Heang KB (2001) Phylogenetic systematics of Southeast Asian flying lizards (Iguania: Agamidae: Draco) as inferred from mitochondrial DNA sequence data. Biological Journal of the Linnean Society. Linnean Society of London 72(2): 203–229. https://doi.org/10.1111/j.1095-8312.2001.tb01312.x
  • Minh BQ, Nguyen MAT, von Haeseler A (2013) Ultrafast Approximation for Phylogenetic Bootstrap. Molecular Biology and Evolution 30(5): 1188–1195. https://doi.org/10.1093/molbev/mst024
  • R Core Team (2025) R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna. http://www.R-project.org/ [accessed on 5 Jan 2025]
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029
  • Sitthivong S, Brakels P, Xayyasith S, Maury N, Idiiatullina S, Pawangkhanant P, Wang K, Nguyen TV, Poyarkov NA (2023) Hiding on jagged karst pinnacles: A new microendemic genus and species of a limestone-dwelling agamid lizard (Squamata: Agamidae: Draconinae) from Khammouan Province, Laos. Zoological Research 44(6): 1039–1051. https://doi.org/10.24272/j.issn.2095-8137.2023.062
  • Skwor T (2012) The use of DNASTAR lasergene educational software with molecular techniques to support bacterial identification. Proceedings of the 33rd Conference of the Association for Biology Laboratory Education (ABLE) 33: 327–334. http://www.ableweb.org/volumes/vol-33/?art=38
  • Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The CLUSTAL_X Windows Interface: Flexible Strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25(24): 4876–4882. https://doi.org/10.1093/nar/25.24.4876
  • Wang K, Jiang K, Wang YF, Poyarkov Jr NA, Che J, Siler CD (2018) Discovery of Japalura chapaensis Bourret, 1937 (Reptilia: Squamata: Agamidae) from Southeast Yunnan Province, China. Zoological Research 39(2): 105–113. https://doi.org/10.24272/j.issn.2095-8137.2017.064
  • Wang K, Che J, Lin S, Deepak V, Aniruddha D-R, Jiang K, Jin J, Chen H, Siler CD (2019a) Multilocus phylogeny and revised classification for mountain dragons of the genus Japalura s.l. (Reptilia: Agamidae: Draconinae) from Asia. Zoological Journal of the Linnean Society 185(1): 246–267. https://doi.org/10.1093/zoolinnean/zly034
  • Wang K, Ren J, Jiang K, Wu J, Yang C, Xu H, Messanger K, Lei K, Yu H, Yang J, Siler CD, Li J, Che J (2019b) Revised distributions of some species in the genus Diploderma (Reptilia: Agamidae) in China. Sichuan Journal of Zoology 38(5): 481–495. https://link.cnki.net/urlid/51.1193.Q.20190815.0932.002
  • Wang K, Wu JW, Jiang K, Chen JM, Miao BF, Siler CD, Che J (2019c) A new species of Mountain Dragon (Reptilia: Agamidae: Diploderma) from the D. dymondi complex in southern Sichuan Province, China. Zoological Research 40(5): 456–465. https://doi.org/10.24272/j.issn.2095-8137.2019.034
  • Wang K, Ren J, Wu J, Chen X, Jiang K, Che J, Siler CD (2020) Systematic revision of mountain dragons (Reptilia: Agamidae: Diploderma) in China, with descriptions of six new species and discussion on their conservation. Journal of Zoological Systematics and Evolutionary Research 59(1): 222–263. https://doi.org/10.1111/jzs.12414
  • Wang K, Gao W, Wu J, Dong W, Feng X, Shen W, Jin J, Shi X, Qi Y, Siler CD, Che J (2021) Two new species of Diploderma Hallowell, 1861 (Reptilia: Squamata: Agamidae) from the Hengduan Mountain Region in China and rediscovery of D. brevicaudum (Manthey, Wolfgang, Hou, Wang, 2012). Zootaxa 4941(1): 1–27. https://doi.org/10.11646/zootaxa.4941.1.1
  • Wang K, Gao W, Wu Y, Che J (2024) Current Status and Future Perspectives on the Research of the Genus Diploderma (Reptilia: Agamidae). Dongwuxue Zazhi 59: 129–131. https://doi.org/10.13859/j.cjz.202424012
  • Wilcox TP, Zwickl DJ, Heath TA, Hillis DM (2002) Phylogenetic relationships of the Dwarf Boas and a comparison of Bayesian and bootstrap measures of phylogenetic support. Molecular Phylogenetics and Evolution 25(2): 361–371. https://doi.org/10.1016/S1055-7903(02)00244-0
  • Yang Z (1994) Maximum likelihood phylogenetic estimation from DNA sequences with variable rates over sites: Approximate methods. Journal of Molecular Evolution 39(3): 306–314. https://doi.org/10.1007/BF00160154
  • Zhang RZ (1992) The Dry Valley of the Hengduan Mountains Regions. Science Press, Beijing, China, 6–20. [In Chinese]
  • Zhao EM, Zhao KT, Zhou KY (1999) Fauna Sinica, Reptilia (Vol. 2): Squamata, Lacertilia. Science Press, Beijing, China, 123–124. [In Chinese]

Supplementary materials

Supplementary material 1 

Uncorrected genetic pairwise distances (p-distances) (%) between Diploderma species in this study based on the mitochondrial ND2 gene sequences

Fengjing Liu, Yayong Wu, Jindong Zhang, Guang Yang, Shuo Liu, Xue Chen, Jiang Chang, Qiang Xie, Bo Cai

Data type: xlsx

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (26.82 kb)
Supplementary material 2 

Summary statistics of PCA analyses of males' morphometric characteristics in selected members

Fengjing Liu, Yayong Wu, Jindong Zhang, Guang Yang, Shuo Liu, Xue Chen, Jiang Chang, Qiang Xie, Bo Cai

Data type: xlsx

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (12.14 kb)
Supplementary material 3 

Summary statistics of PCA analyses of females' morphometric characteristics in selected members

Fengjing Liu, Yayong Wu, Jindong Zhang, Guang Yang, Shuo Liu, Xue Chen, Jiang Chang, Qiang Xie, Bo Cai

Data type: xlsx

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (12.16 kb)
login to comment