Research Article |
Corresponding author: David T. Bilton ( d.bilton@plymouth.ac.uk ) Academic editor: Mariano Michat
© 2017 David T. Bilton , Ignacio Ribera.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Bilton DT, Ribera I (2017) A revision of Meladema diving beetles (Coleoptera, Dytiscidae), with the description of a new species from the central Mediterranean based on molecules and morphology. ZooKeys 702: 45-112. https://doi.org/10.3897/zookeys.702.14787
|
Meladema Laporte, 1835 are relatively large, stream-dwelling diving beetles, distributed widely in the Western Palaearctic, from the Atlantic Islands to Turkey, and from southern France and the Balkans to the central Sahara. In addition to the three previously recognised taxa (M. coriacea Laporte, 1835, M. imbricata (Wollaston, 1871) and M. lanio (Fabricius, 1775)) we describe a new, cryptic, species from the central Mediterranean area, which can be distinguished from M. coriacea on both DNA sequence data and morphology, and provide a key to known species of the genus. Based on the study of genotyped material, both recent and archival, as well as the examination of a large number of museum specimens, we show that M. lepidoptera sp. n. occurs to the apparent exclusion of M. coriacea on Corsica, Sardinia and islands of the Tuscan Archipelago, but that both taxa are found in peninsular Italy, where they may occasionally hybridize. In the absence of the original type series, we designate a neotype for M. coriacea, and take the opportunity to designate a lectotype for M. lanio. Morphological variation in Meladema species is discussed, including that seen in known and presumed hybrids. Our study highlights the incomplete state of knowledge of Mediterranean biodiversity, even in relatively large, supposedly well-studied taxa.
Systematics, integrative taxonomy, biogeography, cryptic species, freshwater, biodiversity, entomology
Meladema Laporte, 1835 is a small genus of large diving beetles, found in streams in the Western Palaearctic, from the Canary Islands and Madeira, to western Turkey (
We have reexamined morphological variation in Meladema in the light of these recent molecular results, and demonstrate that whilst ‘coriacea CSM’ cannot be distinguished from other M. coriacea using male genital anatomy, these two lineages can be separated reliably on the basis of differences in the elytral sculpture of both sexes. By studying a combination of newly genotyped specimens and extensive museum material, we show that ‘coriacea CSM’, here described as M. lepidoptera sp. n., occurs on the Tyrrhenian Islands (Corsica, Sardinia, Elba, Montecristo) and on the Italian mainland, where it comes into contact with M. coriacea. Since the type series of M. coriacea could not be located, and is likely destroyed (
Specimens were studied with Leica MZ8 and M205C stereomicroscopes at x8–100, illuminated with a Fluopac FP1 flourescent light, or a swan-neck illuminator diffused using a tracing paper collar close to the specimen (to enable study of microsculpture). A wide range of morphological characters were initially compared across genotyped material of M. coriacea and M. lepidoptera sp. n., in the search for diagnostic features. These included dorsal and ventral sculpture of both sexes and secondary sexual characters (male and female genitalia and last abdominal ventrites, male tarsal modifications). Digital photographs were taken with a Canon EOS 500D camera with a Sigma 50mm f/2.8 EX DG macro lens, illuminated with two Fluopac FP1 flourescent lights (habitus photos) or with a Leica Z6 Apo macroscope, fitted with a 2x objective lens illuminated using a Leica LED5000 HDI dome illuminator to avoid shadow (all other features). Male and female genitalia were studied wet, temporarily mounted in alcohol-based hand sanitizer gel to stabilize their position during image stacking. Image stacks were produced by hand, and combined using Zerene Stacker software (www.zerenesystems.com). For scanning electron microscopy material was degreased for two days in 100% acetone and air-dried overnight at 60°C, before being mounted onto metal stubs using double-sided carbon conducting tape. Specimens were gold sputter coated using an Emitech K550 Coating Unit, then examined and photographed in a JEOL JSM6610LV Scanning Electron Microscope (SEM). Elytral sculpture was typically imaged at the shoulder and in the centre, close to the suture (Figure
The terminology to denote the orientation of male genitalia follows
Exact label data for specimens are cited in quotation marks; separate quotes for the same specimen indicate separate labels. A double slash (//) indicates separate label lines. All descriptions are based on genotyped material unless otherwise stated.
We added newly sequenced specimens from mainland Italy, some Tyrrhenian islands and North Africa (Table
Specimens of Meladema used in genetic analyses, with DNA voucher, locality, collector and accession numbers of available sequences (newly obtained sequences in bold). The COI-3’ sequence of specimen IBE-AN691 is of very low quality and was not submitted. Neotype of M. coriacea and holotype of M. lepidoptera sp. n. indicated with asterisks (all other specimens of M. lepidoptera sp. n. are paratypes). See text for full label data.
Taxon | Voucher | Country/Island | Locality | Collector | COI-5’ (barcode) | COI-3’ | 16S+tRNA-L +nad1 | H3 | WG |
---|---|---|---|---|---|---|---|---|---|
coriacea | IBE-AN691 | Sicily | Bosco Ficuzzo | M.Toledo | x | ||||
coriacea | IBE-AN739 | Chad | Tibesti, Koudou | Bruneau de Miré | LT898148 | ||||
coriacea | IBE-DV291 | Spain | Cáceres, PN Monfragüe | I.Ribera & P.Abellán | LT898152 | LT602719 | LT602827 | LT602736 | LT602782 |
coriacea | IBE-DV292 | Spain | Huesca, Bco. de Bernués | I.Ribera & A.Cieslak | LT898153 | LT602720 | LT602828 | LT602737 | LT602783 |
coriacea | IBE-DV293 | Spain | Girona, Port Bou | I.Ribera & A.Cieslak | LT898154 | LT602721 | LT602829 | LT602738 | LT602784 |
coriacea | IBE-DV294 | Turkey | Izmir, Phoca | I.Ribera & A.Cieslak | LT898155 | LT602722 | LT602830 | LT602739 | LT602785 |
coriacea | IBE-RA1064 | Malta | between Mosta and L-Imtarfa | A.Rudoy | LT602725 | LT602833 | LT602740 | LT602786 | |
coriacea | MNCN-AI104 | Spain | Corbera d’Ebre, riu Gaia | I.Ribera | LT602727 | LT602835 | LT602743 | LT602789 | |
coriacea | MNCN-AI1095 | Tenerife | Chamorga, Bco. Roque Bermejo | A.Castro | LT602730 | LT602838 | LT602744 | LT602790 | |
coriacea | MNCN-AI84 | Tunisia | Cite el Morjne | M.G.París | LT906387 | LT602726 | LT602834 | LT602745 | LT602791 |
coriacea | MNCN-AI860 | Spain | Castellón, Ballestar | I.Ribera | LT602728 | LT602836 | LT602746 | LT602792 | |
coriacea | MNCN-AI861 | Spain | Castellón, Ballestar | I.Ribera | LT602729 | LT602837 | |||
coriacea | MNCN-HI4 | Algeria | Oued Bagrat | S.Bouzid | LT602731 | LT602839 | LT602747 | LT602793 | |
coriacea | MNCN-HI6 | Algeria | Aïn Damous | S.Bouzid | LT602732 | LT602840 | LT602748 | LT602794 | |
coriacea | NHM-IR47 | Morocco | Taza, Tazzeka N.P. | I.Ribera | EF670124 | ||||
coriacea | NHM-IRM10a | Spain | Cádiz, Fancinas | I.Ribera | AF428215 | AF428189 | |||
coriacea | NHM-IRM11a | France | Var, La Londe-les-Maures | P.Ponel | AF428208 | AF428189 | |||
coriacea | NHM-IRM11b | France | Var, La Londe-les-Maures | P.Ponel | AF428209 | AF428189 | LT602749 | LT602795 | |
coriacea* | NHM-IRM11c | France | Var, La Londe-les-Maures | P.Ponel | AF428207 | AF428189 | |||
coriacea | NHM-IRM13a | Spain | Murcia, Fte. Caputa | A.Millán | AF428218 | AF428189 | LT602753 | LT602798 | |
coriacea | NHM-IRM14a | Spain | Córdoba, Baena, Arroyo de las Beatas | M.Baena | AF428216 | AF428190 | LT602754 | LT602799 | |
coriacea | NHM-IRM14b | Spain | Córdoba, Baena, Arroyo de las Beatas | M.Baena | AF428216 | AF428190 | |||
coriacea | NHM-IRM14c | Spain | Córdoba, Baena, Arroyo de las Beatas | M.Baena | AF428217 | AF428189 | |||
coriacea | NHM-IRM18a | Tenerife | Bco. Del Infierno | D.T.Bilton | AF428222 | AF428189 | LT602757 | LT602802 | |
coriacea | NHM-IRM19a | Tenerife | Bco. De Masca | D.T.Bilton | AF428222 | AF428189 | LT602758 | LT602803 | |
coriacea | NHM-IRM19b | Tenerife | Bco. De Masca | D.T.Bilton | AF428222 | AF428189 | LT602759 | LT602804 | |
coriacea | NHM-IRM1a | Morocco | Taza, Tazzeka N.P. | I.Ribera | AF428212 | AF428189 | LT602760 | LT602805 | |
coriacea | NHM-IRM1c | Morocco | Taza, Tazzeka N.P. | I.Ribera | AF428213 | AF428189 | |||
coriacea | NHM-IRM20a | Gran Canaria | S. Nicolas de Tolentino, bco. Guy Guy grande | I.Ribera & A.Cieslak | AF428221 | AF428189 | LT602761 | LT602806 | |
coriacea | NHM-IRM21a | Morocco | Immouzèr-des-Ida-Outanane, Assif Tanit | I.Ribera & A.Cieslak | AF428214 | AF428189 | LT602762 | LT602807 | |
coriacea | NHM-IRM21b | Morocco | Immouzèr-des-Ida-Outanane, Assif Tanit | I.Ribera & A.Cieslak | AF428215 | AF428189 | |||
coriacea | NHM-IRM22a | Morocco | Tachokchte, Assif Siroua | I.Ribera & A.Cieslak | AF428216 | AF428189 | LT602763 | LT602808 | |
coriacea | NHM-IRM22b | Morocco | Tachokchte, Assif Siroua | I.Ribera & A.Cieslak | AF428216 | AF428189 | |||
coriacea | NHM-IRM23a | Mallorca | Mortixet, Te. Son March | I.Ribera & A.Cieslak | AF428219 | AF428191 | LT602764 | LT602809 | |
coriacea | NHM-IRM23b | Mallorca | Mortixet, Te. Son March | I.Ribera & A.Cieslak | AF428220 | AF428189 | |||
coriacea | NHM-IRM24a | Mallorca | Els Casals, Te. Son March | I.Ribera & A.Cieslak | AF428215 | AF428189 | |||
coriacea | NHM-IRM2a | Morocco | Anti Atlas, Oued Massa | I.Ribera | AF428210 | AF428189 | |||
coriacea | NHM-IRM2b | Morocco | Anti Atlas, Oued Massa | I.Ribera | AF428211 | LT602765 | LT602810 | ||
imbricata | NHM-IRM15a | Gomera | El Cedro | D.T.Bilton | AF428224 | AF428192 | LT602766 | LT602811 | |
imbricata | NHM-IRM15b | Gomera | El Cedro | D.T.Bilton | AF428225 | AF428192 | LT602767 | LT602812 | |
imbricata | NHM-IRM17a | Tenerife | Bco. del Río | D.T.Bilton | KJ637881 | AF428228 | KJ637898 | KJ638011 | |
imbricata | NHM-IRM17b | Tenerife | Bco. del Río | D.T.Bilton | AF428230 | AF428192 | LT602768 | LT602813 | |
imbricata | NHM-IRM3a | Gomera | El Cedro | D.T.Bilton | AF428224 | AF428192 | LT602770 | LT602815 | |
imbricata | NHM-IRM4a | Gomera | El Cedro | D.T.Bilton | AF428224 | AF428192 | LT602771 | LT602816 | |
imbricata | NHM-IRM4b | Gomera | El Cedro | D.T.Bilton | AF428224 | AF428192 | LT602772 | LT602817 | |
imbricata | NHM-IRM5a | Tenerife | Bco. del Río | D.T.Bilton | AF428230 | AF428192 | LT602773 | LT602818 | |
imbricata | NHM-IRM5d | Tenerife | Bco. del Río | D.T.Bilton | AF428229 | ||||
imbricata | NHM-IRM6a | La Palma | Bco. del Hoyo Verde | D.T.Bilton | AF428227 | ||||
imbricata | NHM-IRM6b | La Palma | Bco. del Hoyo Verde | D.T.Bilton | AF428227 | AF428192 | LT602775 | LT602820 | |
imbricata | NHM-IRM6c | La Palma | Bco. del Hoyo Verde | D.T.Bilton | AF428227 | AF428192 | LT602776 | LT602821 | |
imbricata | NHM-IRM7a | La Palma | Bco. del Rio above Santa Cruz | D.T.Bilton | AF428226 | AF428192 | |||
lanio | IBE-DV298 | Madeira | Canhas, Paul da Serra | A.Rudoy | LT898156 | LT602733 | LT602841 | LT602777 | LT602822 |
lanio | NHM-IRM8a | Madeira | Ribera dos Cedros | L.C.Kelly | AF428233 | AF428194 | LT602778 | LT602823 | |
lanio | NHM-IRM9a | Madeira | Levada das Faias | L.C.Kelly | AF428231 | AF428194 | |||
lanio | NHM-IRM9b | Madeira | Levada das Faias | L.C.Kelly | AF428232 | AF428194 | LT602779 | LT602824 | |
lepidoptera sp. n. | IBE-AN692 | Elba | Pomonte, Fosco Barione | M.Toledo | LT898157 | ||||
lepidoptera sp. n. | IBE-AN693 | Italy | Toscana, S. Luce | M.Toledo | LT898158 | LT898147 | |||
lepidoptera sp. n. | IBE-AN760 | Italy | Monti della Tolfa | V.Buono | LT898149 | LT898159 | |||
lepidoptera sp. n. | IBE-DV289 | Montecristo | R.Vila | LT898150 | LT602717 | LT602825 | LT602734 | LT602780 | |
lepidoptera sp. n. | IBE-DV290 | Montecristo | R.Vila | LT898151 | LT602718 | LT602826 | LT602735 | LT602781 | |
lepidoptera sp. n. | IBE-RA18 | Sardinia | Ogliastra, ca. 5 km WNW Tortoli | H.Fery & M.Toledo | LT602724 | LT602832 | LT602741 | LT602787 | |
lepidoptera sp. n. | IBE-RA5 | Sardinia | Nuoro prov., Villagrande Strìsaili | H.Fery & M.Toledo | LT602723 | LT602831 | LT602742 | LT602788 | |
lepidoptera sp. n. | NHM-IRM12a | Corsica | Porto-Vecchio, l’Ospedale | I.Ribera & A.Cieslak | LT906388 | AF428203 | |||
lepidoptera sp. n. | NHM-IRM12b | Corsica | Ghisoni, road to Campannella | I.Ribera & A.Cieslak | AF428204 | AF428187 | LT602750 | ||
lepidoptera sp. n. | NHM-IRM12c | Corsica | Cap Corse, Bettolacce | I.Ribera & A.Cieslak | LT906389 | AF428205 | AF428188 | LT602751 | LT602796 |
lepidoptera sp. n. | NHM-IRM12d | Corsica | Porto-Vecchio, l’Ospedale | I.Ribera & A.Cieslak | LT906390 | AF428203 | AF428187 | LT602752 | LT602797 |
lepidoptera sp. n.* | NHM-IRM12e | Corsica | Cap Corse, Bettolacce | I.Ribera & A.Cieslak | AF428206 | AF428188 | |||
lepidoptera sp. n. | NHM-IRM12f | Corsica | Cap Corse, Bettolacce | I.Ribera & A.Cieslak | LT906391 | AF428207 | AF428187 | ||
lepidoptera sp. n. | NHM-IRM12g | Corsica | Porto-Vecchio, l’Ospedale | I.Ribera & A.Cieslak | AF428203 | AF428187 | |||
coriaceaximbricata | NHM-IRM16a | Tenerife | Bco. del Río | D.T.Bilton | AF428223 | AF428192 | LT602755 | LT602800 | |
coriaceaximbricata | NHM-IRM16b | Tenerife | Bco. del Río | D.T.Bilton | AF428223 | AF428192 | LT602756 | LT602801 | |
imbricataxcoriacea | NHM-IRM5b | Tenerife | Bco. del Río | D.T.Bilton | AF428222 | AF428189 | |||
imbricataxcoriacea | NHM-IRM5c | Tenerife | Bco. del Río | D.T.Bilton | AF428222 | AF428189 | LT602774 | LT602819 | |
imbricataxcoriacea | NHM-IRM17c | Tenerife | Bco. del Río | D.T.Bilton | AF428222 | AF428189 | LT602769 | LT602814 |
We amplified fragments of the Cytochrome Oxidase Subunit 1 mitochondrial gene (5’ end, COI-5’, and 3’ end, COI-3’) and an internal fragment of the nuclear gene Histone 3 (H3) (see Table
To place newly sequenced specimens in a phylogenetic context we included them in a matrix with the COI data from
Primers used for amplification and sequencing. In brackets, length of the amplified fragment.
Gene | Primer | Sequence | Reference |
COI-3’ | Jerry (5’) | CAACATTTATTTTGATTTTTTGG |
|
(826) | Pat (3’) | TCCAATGCACTAATCTGCCATATTA |
|
Chy (5’) | T(A/T)GTAGCCCA(T/C)TTTCATTA(T/C)GT |
|
|
Tom (3’) | AC(A/G)TAATGAAA(A/G)TGGGCTAC(T/A)A |
|
|
COI-5’ | LepF1b | ATTCAACCAATCATAAAGATATTGGAAC |
|
(658) | LepR1 | TAAACTTCTGGATGTCCAAAAAATCA |
|
H3 | H3aF (5’) | ATGGCTCGTACCAAGCAGACRCG |
|
(327) | H3aR (3’) | ATATCCTTRGGCATRATRGTGAC |
|
CBF Collection H. Bussler, Freising, Germany
CBP Collection D.T. Bilton, Plymouth, UK
CFA Collection G.N. Foster, Ayr, UK (to be deposited in Hunterian Museum, Glasgow University, Glasgow, UK)
CTP Collection M. Toledo, Parma, Italy
CVR Collection V. Volpe, Roma, Italy
ISNB Institut royal des Sciences naturelles de Belgique, Brussels, Belgium
TL Total length, front of head to elytral apices
EL Elytral length
MW Maximum width, elytra
HW Handwriting
We obtained enough sequence data from the COI gene to allow an unambiguous phylogenetic placement of two specimens from mainland Italy (Toscana and Lazio, DNA vouchers
In the RAxML analysis with the COI-3’ marker the two sequenced specimens from mainland Italy and the one from Elba were clearly clustered with other specimens from Corsica, Sardinia and Montecristo, with strong bootstrap support (Figure
For the Sicilian specimen (
We obtained the H3 sequence from one of the specimens from the Tibesti (AN739, Table
Meladema
Laporte, 1835:98, gender feminine; type species: Meladema coriacea Laporte, 1835:98, by monotypy; conserved in ICZN Opinion 1725 (
Adults can be recognised within the Colymbetinae on the following combination of characters: pronotal beading absent; protibiae only weakly emarginate basoventrally; prosternal process medially rounded; anterior margin of metaventrite deeply incised for reception of prosternal process; metatarsomeres I-IV distinctly sinuate apically, with apicolateral lobes and metatarsal claws subequal in length, outer approximately two-thirds length of inner (
Compound eyes large, rounded, laterally somewhat protruding (Figure
Meladema species males, colour pattern of isolated elytra (DNA voucher codes, where applicable). A M. coriacea, Spain, Murcia, Fte. Caputa B M. lepidoptera sp. n., Corsica, Cap Corse (NHM-IRM12F) C M. imbricata, La Gomera, El Cedro (NHM-IRM3A) D M. lanio, Madeira, Ribeira dos Cedros (NHM-IRM8A). Scale bar = 5 mm.
Male. Foretarsi (Figure
Female. Fore and mesotarsi simple, with ambulatory spines and setae only. Abdominal ventrite 6 (Figure
Both molecular and morphological data suggest a close relationship between Meladema and the Nearctic Hoperius Fall, 1927 and Neoscutopterus J. Balfour-Browne, 1943 (
Scutopterus coriaceus Dejean, 1833: 54, nomen nudum.
Meladema
coriacea
Laporte, 1835: 98 (partim);
Colymbetes
coriaceus
(Laporte, 1835):
Scutopterus
coriaceus
(Laporte, 1835):
Meladema
coriaceum
Laporte, 1835:
Of these earlier works, only
Laporte’s original description (1835) could refer to either M. coricaea as redefined here, or M. lepidoptera sp. n., the only reference to the unique elytral sculpture of these beetles being “corps couvert de points très serrés, presque chagriné”. As discussed by
“Midi de la France”.
Neotype ♀ (herein designated): “24/viii/2006 FRANCE Var// La Londe-les-Maures,// Vallon de Valcros, Les// Gaouby (ruines), pools in// Maravenne Torrent, 45m// P. Ponel leg.” “43°09'45.74"N 9°15'38.82"E” “DNA Voucher// NHM-IRM11C” “Meladema coriacea// Laporte, 1835// NEOTYPE// D T Bilton & I Ribera des. 2017” (
Algeria: 1 ♂ “24/viii/2006 ALGERIA// Aïn Damous 36 25.350N// 07 51.367E 523m V67// S. Bouzid leg.” “Meladema// coriacea Laporte// Fery det. 2007” “DNA voucher//
Additional material examined (non-genotyped specimens). Algeria: 8 ♂♂, 15 ♀♀ “Algerie// Yakouren// J Dayren// VI.VII. 1909” “MUSÉUM PARIS// 1952// COLL R OBERTHUR” [blue label] (
Size: Neotype TL = 22.66 mm; EL = 16.90 mm; MW = 11.52 mm. Other material examined TL = 18.56–23.17 mm; EL = 14.34–16.90 mm; MW = 8.45–11.14 mm.
Colour. Dorsum dark reddish brown to black (Figure
Head. Labrum shining, with moderate to coarse, sparse punctures. Reticulation absent in apical half, becoming increasingly more evident basally, here forming weakly impressed, transverse meshes. Clypeus and anterior half of frons shining, doubly punctate, without reticulation and with very close, fine and very sparse, coarse punctures. Coarse punctures approximately 5–8x diameter of fine; without visible reticulation. Paired epicranial foveae, one immediately behind the other, on each side of frons, close to lateral margins and immediately behind lateral remnants of frontoclypeal suture. Anterior epicranial foveae transverse, posterior slightly elongate oval; both with cluster of stout, yellow recumbent to decumbent setae. Areas between anterior and posterior foveae with coarse wrinkles. Posterior frons with open, elongate, wrinkled reticulation, especially alongside lateral margins of compound eyes and onto vertex; meshes tumid, with rugose appearance. Internal and posterior borders of compound eyes distinct, raised relative to level of adjacent cuticle. Lateral margins bordered by distinct narrow channel; deeper anteriorly than posteriorly and continuing behind posterior margin of eye onto vertex. Channel with dense punctures, bearing long, stiff, yellow recumbent to decumbent setae.
Pronotum. Posterior margin strongly sinuate laterally (Figure
Elytra. Somewhat shining, with dense, transverse, crescentic striolae (Figures
Meladema species males, elytral shoulder sculpture SEMs (DNA voucher codes, where applicable). AM. coricaea, Spain, Murcia, Fte. Caputa B M. lepidoptera sp. n., Corsica, Cap Corse (NHM-IRM12F) C M. imbricata, La Gomera, El Cedro (NHM-IRM3A) D M. lanio, Madeira, Ribeira dos Cedros (NHM-IRM8A).
Meladema species elytral shoulder sculpture SEMs (DNA voucher codes where applicable). A M. coriacea, male, Spain, Murcia, Fte. Caputa B M. lepidoptera sp. n., male, Corsica, Cap Corse (NHM-IRM12F) C M. coriacea, female, Spain, Murcia, Fte. Caputa D M. lepidoptera sp. n., female, Corsica, Porto-Vecchio (NHM-IRM12A).
Venter. Prementum shining, tumid in centre, with fine and medium, sparse punctures. Mentum shining; central projection with shallow median emargination. Lateral lobes with medium, sparse punctures, and scattered, whitish recumbent to decumbent setae. Submentum shining, with transverse wrinkles centrally, and elongate wrinkles laterally. Central 1/4 with medium, sparse punctures bearing long, white-yellowish, erect setae. Gula shining, with sparse, shallow, transverse wrinkles; patch of medium-coarse punctures posterolaterally. Genae shining, with obsolete, open, elongate reticulation. Prosternum shining, with irregular transverse ridges laterally. Strongly arched in centre and with fine, moderate to close punctures laterally, bearing long, white-yellowish, recumbent to erect setae; punctures and setae extending in a sparse, irregular row onto process, just below arch. Process lanceolate, tectiform; apex acuminately rounded. Centre of prosternum and process with double punctation of very fine, moderate and medium, very sparse punctures. Pronotal hypomeron shining, impunctate. Elytral epipleurs shining, with fine wrinkles; irregular puncture row close to internal margin, from centre to close to apex; punctures bearing fine, whitish, erect setae. Metaventrite shining, central portion with sparse, transverse scratches and fine to very fine, sparse to very sparse punctures; not clearly forming two size classes. Metaventral process strongly reticulate, with transverse, rugose meshes and traces of fine, sparse punctures; small, central patch at base with very small reticulation meshes. Metaventral process relatively broad; apex acuminate and upturned slightly anterolaterally. Metacoxal lines almost reaching anterior border of metacoxae; shallow and interrupted in anterior 1/5. Internal laminae of metacoxae shining, sculpture as on centre of metaventrite. Metacoxal lobes sculptured as internal laminae, strongly rounded, with irregular, elongate field of medium to coarse punctures close to lateral margins, bearing fine, white, recumbent to erect setae. External laminae of metacoxae shining, smooth close to process, but with strong reticulation elsewhere; reticulation meshes very elongate posteromedially, to transverse anteriorly. Abdominal ventrites shining. Ventrites 3–5 with cluster of golden, erect setae anteromedially. Ventrite 1 with elongate reticulation throughout. Ventrite 2 with similar reticulation; absent close to centre. Ventrite 3 with elongate reticulation laterally, becoming transverse close to smooth central 1/5. Reticulation of ventrites 4 and 5 restricted to lateral third and with superimposed elongate furrows. Ventrites 2–5 doubly punctate; very fine, moderate and fine, sparse to very sparse punctures; punctures most evident in areas without reticulation. Ventrites 3–5 with transverse irregular row of long, yellowish, recumbent to decumbent setae laterally. Ventrite 6 (Figure
Male. Foretarsi (Figure
Female. As male, except for simple fore and mesotarsi, differently shaped abdominal ventrite 6 (with bluntly pointed apex, Figure
Variation. Variation is evident in a number of characters. The size and density of the crescentic striolae on the elytra differs between individuals (e.g. Figures
Morphologically, this species is almost identical to M. lepidoptera sp. n., something which has prevented the latter’s formal description until now. The two species can be reliably separated only on details of their elytral sculpture, M. coriacea having smaller, less dense crescentic striolae than M. lepidoptera sp. n., this being particularly evident at the elytral base, close to the scutellum, and in the middle, close to the suture (see Figure
The genetic differences between M. coriacea and M. lepidoptera sp. n. are well defined and comparable to those seen between M. imbricata and M. lanio, although mostly seen in mitochondrial markers (
Even as redefined here, this is by far the most widespread species of the genus, distributed from the Canary Islands to Turkey, and south to massifs of the central Sahara (Figure
France, Corsica, Cap Corse, stream nr. Bettolacce, 42°58'2.4"N 9°24'42.4"E.
(genotyped specimens only). Holotype ♂: “11 FR Corsica 21.ix.1999// Cap Corse: Bettolacce// 42°58'2.4"N 9°24'42.4"E 250m// I.Ribera & A. Cieslak leg.” “DNA voucher// NHM-IRM12E” “Meladema lepidoptera// Bilton & Ribera, 2017//HOLOTYPE” (
(non-genotyped specimens). France, Corsica: 2 ♂♂, 1 ♀ “11/iv/1993// Corsica Francardo// Mediterranean stream// D. T. Bilton leg.” (CBP); 1 ♀ “Calvi// 29.VIII.” “Pietra// Maggiore” “KORSIKA// VIII.1955” “Meladema// coriacea Cast.// M/ Balke det. 1990” [Latin name, describer & 90 HW] (
Size: Holotype TL = 20.74 mm; EL = 15.74 mm; MW = 10.50 mm. Other material examined TL = 19.20–20.99 mm; EL = 14.98–16.38 mm; MW = 9.73–11.39 mm.
Colour. Dorsum dark reddish brown to black (Figure
Head. Labrum shining, with moderate to coarse, sparse punctures. Reticulation absent in apical half, becoming increasingly more evident basally, here forming weakly impressed, transverse meshes. Clypeus and anterior half of frons shining, doubly punctate, without reticulation and with very close, fine and very sparse, coarse punctures. Coarse punctures approximately 5–8x diameter of fine; without visible reticulation. Paired epicranial foveae, one immediately behind the other, on each side of frons, close to lateral margins and immediately behind lateral remnants of frontoclypeal suture. Anterior epicranial foveae transverse, posterior slightly elongate oval; both with cluster of stout, yellow recumbent to decumbent setae. Areas between anterior and posterior foveae with coarse wrinkles. Posterior frons with open, elongate, wrinkled reticulation, especially alongside lateral margins of compound eyes and onto vertex; meshes tumid, with rugose appearance. Internal and posterior borders of compound eyes distinct, raised relative to level of adjacent cuticle. Lateral margins bordered by distinct narrow channel; deeper anteriorly than posteriorly and continuing behind posterior margin of eye onto vertex. Channel with dense punctures, bearing long, stiff, yellow recumbent to decumbent setae.
Pronotum. Posterior margin strongly sinuate laterally (Figure
Elytra. Somewhat shining, with dense, transverse, sometimes contiguous, crescentic striolae, giving a very scaly appearance (Figure
Venter. Prementum shining, tumid in centre, with fine and medium, sparse punctures. Mentum shining; central projection with shallow median emargination. Lateral lobes with medium, sparse punctures, and scattered, whitish recumbent to decumbent setae. Submentum shining, with transverse wrinkles centrally, and elongate wrinkles laterally. Central 1/4 with medium, sparse punctures bearing long, white-yellowish, erect setae. Gula shining, with sparse, shallow, transverse wrinkles; patch of medium-coarse punctures posterolaterally. Genae shining, with obsolete, open, elongate reticulation. Prosternum shining, with irregular transverse ridges laterally. Strongly arched in centre and with fine, moderate to close punctures laterally, bearing long, white-yellowish, recumbent to erect setae; punctures and setae extending in a sparse, irregular row onto process, just below arch. Process lanceolate, tectiform; apex acuminately rounded. Centre of prosternum and process with double punctation of very fine, moderate and medium, very sparse punctures. Pronotal hypomeron shining, impunctate. Elytral epipleurs shining, with fine wrinkles; irregular puncture row close to internal margin, from centre to close to apex; punctures bearing fine, whitish, erect setae. Metaventrite shining, central portion with sparse, transverse scratches and fine to very fine, sparse to very sparse punctures; not clearly forming two size classes. Metaventral process strongly reticulate, with transverse, rugose meshes and traces of fine, sparse punctures; with small central patch of reticulation with very small meshes. Metaventral process relatively broad; apex acuminate and upturned slightly anterolaterally. Metacoxal lines almost reaching anterior border of metacoxae; shallow and interrupted in anterior 1/5. Internal laminae of metacoxae shining, sculpture as on centre of metaventrite. Metacoxal lobes sculptured as internal laminae, strongly rounded, with irregular, elongate field of medium to coarse punctures close to lateral margins, bearing fine, white, recumbent to erect setae. External laminae of metacoxae shining, smooth close to process, but with strong reticulation elsewhere; reticulation meshes very elongate posteromedially, to transverse anteriorly. Abdominal ventrites shining. Ventrites 3–5 with cluster of golden, erect setae anteromedially. Ventrite 1 with elongate reticulation throughout. Ventrite 2 with similar reticulation; absent close to centre. Ventrite 3 with elongate reticulation laterally, becoming transverse close to smooth central 1/5. Reticulation of ventrites 4 and 5 restricted to lateral third and with superimposed elongate furrows. Ventrites 2–5 doubly punctate; very fine, moderate and fine, sparse to very sparse punctures; punctures most evident in areas without reticulation. Ventrites 3–5 with transverse irregular row of long, yellowish, recumbent to decumbent setae laterally. Ventrite 6 (Figure
Male. Foretarsi (Figure
Female. As male, except for simple fore and mesotarsi, differently shaped abdominal ventrite 6 (with bluntly pointed apex - Figure
Variation. The size and density of the crescentic striolae on the elytra differs somewhat between individuals and localities (Figures
Morphologically almost identical to M. coriacea (see above). Only distinguishable on the size, shape and density of crescentic striolae on the elytra, which give M. lepidoptera sp. n. a very scaly appearance, evident even at relatively low magnification (e.g. Figure
From the ancient Greek “lepidos” (λεπίδος, scale, but also referring to roof tiles) and “pteron” (πτερόν, wing). The specific epithet is a noun in the nominative plural.
On the basis of current data, found on Corsica and Sardinia, islands of the Tuscan Archipelago (Elba, Montecristo) and parts of peninsular Italy, from Liguria to Umbria (Figure
Meladema species elytral middle sculpture SEMs (DNA voucher codes where applicable). A M. coriacea, male, Spain, Murcia, Fte. Caputa B M. lepidoptera sp. n., male, Corsica, Cap Corse (NHM-IRM12F) C M. coriacea, female, Spain, Murcia, Fte. Caputa D M. lepidoptera sp. n., female, Corsica, Porto-Vecchio (NHM-IRM12A).
Meladema coriacea female elytral sculpture; shoulder and middle left and right, respectively (DNA voucher codes). A neotype, France, Var, La-Londe-les-Maures (NHM-IRM11C) B Spain, Córdoba, Baena (NHM-IRM14B) C Morocco, Tazzeka (NHM-IRM1A) D Algeria, Oued Bagrat (
Scutopterus imbricatus Wollaston, 1871: 220.
Meladema
imbricata
(Wollaston, 1871):
Meladema lanio ab. imbricata (Wollaston, 1871): Gcshwendtner 1936: 42.
Meladema imbricatum Branden, 1885: 95.
Meladema lanio f. imbricata Sanfilippo, 1966: 49.
“Madeira” [mislabelled].
(
Note that as discussed by
(genotyped specimens). Spain, Canary Islands. 1 ♂ “1998 SPAIN Islas Canarias// La Gomera// El Cedro – stream in laurysilva// D. T. Bilton leg.” “M. IMBRICATA” [HW] “G4 Mel// below G3” [HW] “DNA voucher// NHM-IRM3A” (
Additional material examined (non-genotyped specimens). Spain, Canary Islands. 1 ♂ “April 1998 SPAIN// Islas Canarias la Gomera// El Cedro stream in Garajonay// laurisylva D. T. Bilton leg.” (CBP); 1 ♀ “April 1998 SPAIN// Islas Canarias La Palma// Bco. del Río upper reaches in// Laurisylva D. T. Bilton leg.” (CBP); 1 ♂ “Islas Canarias: Tene-// rife, 9.-10.vi. 1989// Bco. del Río 1100m.// Balke & Hendrich leg.” “Meladema// imbricata// M. Balke det 2011” “M. Balke//
(based on all material examined).Size: Holotype TL = 22.13 mm; EL = 15.79 mm; MW = 10.22 mm. Other material examined TL = 18.05–21.38 mm; EL = 13.57–15.62 mm; MW = 8.83–9.98 mm.
Colour. Dorsum (Figure
Head. Labrum shining, with medium to fine, sparse punctures. Reticulation absent anteriorly, clearly evident in posterior half, here fine and composed of small, isodiametric to slightly transverse meshes. Clypeus weakly shining, with medium to fine, sparse punctures and traces of very fine, shallow, close punctures. Frons weakly shining, entire surface with coarse, open reticulation, becoming stronger and more evident posteriorly. Meshes transverse to isodiametric apically and medially, strongly elongate posteriorly and onto vertex. Paired epicranial foveae on anterior frons, one immediately behind the other. Anterior foveae transverse, posterior foveae elongate oval. Foveae all strongly reticulate; anterior and posterior foveae linked by reticulated channel. Internal and posterior borders of compound eyes distinct, raised relative to level of adjacent cuticle. Lateral margins bordered by distinct narrow channel; deeper anteriorly than posteriorly and continuing behind posterior margin of eye onto vertex. Channel with dense punctures, bearing long, stiff, yellow recumbent to decumbent setae.
Pronotum. Posterior margin weakly sinuate laterally (Figure
Elytra. Shining, with short, transverse, usually straight or weakly curved crescentic striolae of varying sizes and density (Figures
Venter. Prementum shining, tumid in centre, with fine and medium, sparse punctures. Mentum shining; central projection with shallow median emargination. Lateral lobes with very fine, close punctures, scattered, whitish recumbent to decumbent setae and longitudinal wrinkles. Submentum shining, with transverse wrinkles. Central 1/4 with medium, sparse punctures bearing long, white-yellowish, erect setae. Gula shining, with sparse, shallow, transverse wrinkles; patch of medium-coarse punctures posterolaterally. Genae shining, strongly reticulate; meshes transverse anteriorly and posteriorly, almost isodiametric in centre. Prosternum shining, with weak, low irregular transverse ridges laterally. Arched in centre and with fine, moderate to close punctures laterally, bearing long, white-yellowish, recumbent to erect setae; punctures and setae extending in an irregular row onto process, just below arch. Process lanceolate, arched; apex acuminately rounded. Centre of prosternum and process with double punctation of very fine, close to very close and medium, sparse to moderate punctures. Pronotal hypomeron shining, impunctate. Elytral epipleurs shining, with fine wrinkles; irregular puncture row close to internal margin, from centre to close to apex, punctures bearing fine, whitish, erect setae. Metaventrite shining, central portion with reticulation reduced to sparse, transverse scratches and very fine, close and fine to medium, sparse punctures. Metaventral process strongly reticulate, with transverse to elongate, rugose meshes and traces of fine, sparse punctures; small central area with reticulation of very small meshes. Metaventral process relatively broad; apex acuminate and upturned slightly anterolaterally. Metacoxal lines not reaching anterior border of metacoxae, disappearing approx 1/10 from margin. Internal laminae of metacoxae shining, sculpture as on centre of metaventrite. Metacoxal lobes sculptured as internal laminae, strongly rounded, with irregular, elongate field of medium to coarse punctures close to lateral margins, bearing fine, white, recumbent to erect setae. External laminae of metacoxae shining, smooth close to process, but with strong reticulation elsewhere; reticulation meshes very elongate posteromedially, to transverse anteriorly. Abdominal ventrites shining. Ventrites 3–5 with cluster of golden, erect setae anteromedially. Ventrite 1 with elongate reticulation throughout. Ventrite 2 with similar reticulation; absent close to centre. Ventrite 3 with elongate reticulation laterally, becoming transverse close to smooth central 1/5. Reticulation of ventrites 4 and 5 restricted to lateral third and with superimposed elongate furrows. Ventrites 2–5 doubly punctate; very fine, moderate and fine, sparse to very sparse punctures; punctures most evident in areas without reticulation. Ventrites 3–5 with transverse irregular row of long, yellowish, recumbent to decumbent setae laterally. Ventrite 6 (Figure
Meladema species males, abdominal ventrite 6 (DNA voucher codes where applicable). AM. coricaea, Spain, Murcia, Fte. Caputa B M. lepidoptera sp. n., Corsica, Cap Corse (NHM-IRM12F) C M. imbricata, La Gomera, El Cedro (NHM-IRM3A) D M. lanio, Madeira, Ribeira dos Cedros (NHM-IRM8A). Scale bar = 1 mm.
Meladema species males, fore (A–D) and mesotarsi (E–H), ventral view (DNA voucher codes where applicable). A, E M. coriacea Spain, Cáceres, nr. Plasencia B, F M. lepidoptera sp. n. holotype, Corsica, Cap Corse (NHM-IRM12E) C, G M. imbricata, La Gomera, El Cedro (NMH-IRM3A) D, H M. lanio, Madeira, Rabacal. Scale bar = 1 mm.
Meladema species males, fore tarsal claws, lateral view (DNA voucher codes where applicable). A M. coriacea Spain, Cáceres, nr. Plasencia B M. lepidoptera sp. n. holotype, Corsica, Cap Corse (NHM-IRM12E) C M. imbricata, La Gomera, El Cedro (NMH-IRM3A) D M. lanio, Madeira, Rabacal. Scale bar = 1 mm.
Male. Foretarsi (Figure
Female. As male, except for simple fore and mesotarsi and differently shaped abdominal ventrite 6 (with bluntly pointed apex - Figure
Variation. The size and density of the crescentic striolae on the elytra differs somewhat between individuals and localities (e.g. Figure
Morphologically somewhat intermediate between M. coriacea/M. lepidoptera sp. n. and M. lanio. From M. coriacea and M. lepidoptera sp. n. M. imbricata can be distinguished on its different dorsal colouration, particularly the strongly mottled elytra, with much smaller, sparser crescentic striolae, as well as the less strongly sinuate posterior pronotal margin, details of the male genitalia (median lobe with sinuation further away from apex, with concave ventral margin in lateral view) and the last abdominal ventrites of both sexes. The habitus of M. imbricata is also typically more elongate than either of the above species (Figure
Meladema species male genitalia. Median lobe, lateral and ventral view; paramere (DNA voucher codes where applicable). A M. coriacea Spain, Cáceres, nr. Plasencia B M. lepidoptera sp. n. holotype, Corsica, Cap Corse (NHM-IRM12E) C M. imbricata, La Gomera, El Cedro (NMH-IRM3A) D M. lanio, Madeira, Rabacal. Silhouette indicates orientation of median lobe for imaging in ventral view. Scale bar = 1 mm.
Meladema species females, abdominal ventrite 6 (DNA voucher codes where applicable). AM. coricaea, Spain, Murcia, Fte. Caputa B M. lepidoptera sp. n., Corsica, Cap Corse (NHM-IRM12C) C M. imbricata, La Palma, Bco. Hoyo Verde D M. lanio, Madeira, Ribeira dos Cedros (NHM-IRM9A). Scale bar = 1 mm.
Meladema coriacea, Var, France, La-Londe-les-Maures, female reproductive tract and genitalia (DNA voucher codes). A reproductive tract anatomy (NHM-IRM11A) B gonocoxae and gonocoxosternite (left gonocoxosternite removed) (NHM-IRM11B) C gonocoxae with laterotergites expanded (NHM-IRM11B). Scale bars = 1 mm.
Endemic to the western Canary Islands (Figure
Dytiscus lanio Fabricius, 1775: 231.
Colymbetes lowei Gray, 1831: 284.
Scutopterus
lanio
(Fabricius, 1775):
Colymbetes
lanio
(Fabricius, 1775):
Meladema
lanio
(Fabricius, 1775):
“Maderae aquis”
(
(genotyped specimens). Portugal, Madeira: 1 ♂ “vi/1998 PORTUGAL Madeira// Ribeira dos Cedros// L. C. Kelly leg.” “M3 Hand// Coleoptera” [HW] “Meladema// lanio” [HW] “DNA voucher// NHM-IRM8A” (
(non-genotyped specimens). Portugal, Madeira: 1 ♀ “pouzo” [HW] “var. squamata” [HW] “passage à la m.// imbricatum Woll.” [HW] (ISNB); 1 ♀ “Madeira// 90.32.” [HW] (
Meladema species, Italy, male elytral sculpture; shoulder and middle left and right, respectively (DNA voucher codes, where applicable). A M. lepidoptera sp. n., Liguria, Levante B intermediate specimen, Campania, S. Michele (
(based on all material examined).Size: Lectotype TL = 20.30 mm; EL = 16.30 mm; MW = 10.18 mm. Other material examined TL = 17.40–21.12 mm; EL = 12.67–15.36 mm; MW = 8.70–10.50 mm.
Colour. Dorsum (Figure
Head. Labrum shining, with medium to fine, sparse punctures. Reticulation absent anteriorly, clearly evident in posterior half, here fine and composed of small, isodiametric to transverse meshes. Clypeus weakly shining, with medium to fine, sparse punctures and traces of very fine, shallow, close punctures. Frons weakly shining, entire surface with, open reticulation; weak in front of interocular patches, becoming stronger and more evident posteriorly. Meshes transverse to isodiametric apically and medially, strongly elongate posteriorly and onto vertex. Paired epicranial foveae on anterior frons, one immediately behind the other. Anterior foveae transverse, posterior foveae elongate oval. Foveae reticulate; anterior and posterior foveae linked by reticulated channel. Internal and posterior borders of compound eyes distinct, raised relative to level of adjacent cuticle. Lateral margins bordered by distinct narrow channel; deeper anteriorly than posteriorly and continuing behind posterior margin of eye onto vertex. Channel with dense punctures, bearing long, stiff, yellow recumbent to decumbent setae.
Pronotum. Posterior margin weakly sinuate laterally (Figure
Elytra. Shining, without crescentic striolae (except in some females – see below). Surface doubly punctate and reticulate (Figure
Meladema species, variation in male median lobes, lateral view. A–N M. coriacea; O–U M. lepidoptera sp. n. (DNA voucher codes, where applicable). A Spain, Huesca, Bernués (
Meladema lepidoptera sp. n. elytral sculpture (males); shoulder and middle left and right, respectively (DNA voucher codes). A holotype male, Corsica, Cap Corse (NHM-IRM12E) B Italy, Montecristo (
Venter. Prementum shining, tumid in centre, with fine and medium, sparse punctures. Mentum shining; central projection with shallow median emargination. Lateral lobes with medium, sparse punctures, and scattered, whitish recumbent to decumbent setae. Submentum shining, with transverse wrinkles centrally, and elongate wrinkles laterally. Central 1/4 with medium, sparse punctures bearing long, white-yellowish, erect setae. Gula shining, with sparse, shallow, transverse wrinkles; patch of medium-coarse punctures posterolaterally. Genae shining, with obsolete, open, elongate reticulation. Prosternum shining, with weak, low, irregular transverse ridges laterally. Arched in centre and with fine, moderate to close punctures laterally, bearing long, white-yellowish, recumbent to erect setae; punctures and setae extending in an irregular row onto process, just below arch. Process lanceolate, arched; apex acuminately rounded. Centre of prosternum and process with double punctation of very fine, close to very close and medium, sparse to moderate punctures. Pronotal hypomeron shining, impunctate. Elytral epipleurs shining, with fine wrinkles; irregular puncture row close to internal margin, from centre to close to apex, punctures bearing fine, whitish, erect setae. Metaventrite shining, central portion with reticulation reduced to sparse, transverse scratches and very fine, close and fine to medium, sparse punctures. Metaventral process strongly reticulate, with transverse to elongate, rugose meshes and traces of fine, sparse punctures. Metaventral process relatively broad; apex acuminate and upturned slightly anterolaterally. Metacoxal lines not reaching anterior border of metacoxae, disappearing approx 1/10 from margin. Internal laminae of metacoxae shining, sculpture as on centre of metaventrite. Metacoxal lobes sculptured as internal laminae, strongly rounded, with irregular, elongate field of medium to coarse punctures close to lateral margins, bearing fine, white, recumbent to erect setae. External laminae of metacoxae shining, smooth close to process, and with obsolete reticulation elsewhere; without distinct meshes, wrinkled, elongate around anterior and posterior margins; doubly ounctate, with very fine, close and fine, very sparse punctures. Abdominal ventrites shining. Ventrites 3–5 with cluster of golden, erect setae anteromedially. Ventrite 1 with weak reticulation of elongate scratches throughout. Ventrite 2 with similar reticulation; absent close to centre. Ventrite 3 and 4 with scratches restricted to lateral 1/3. Ventrites 2–5 doubly punctate; very fine, moderate and fine, sparse to very sparse punctures; punctures most evident in areas without reticulation. Ventrites 3–5 with transverse irregular row of long, yellowish, recumbent to decumbent setae laterally. Ventrite 6 (Figure
Male. Foretarsi (Figure
Female. As male, except for simple fore and mesotarsi, and differently shaped abdominal ventrite 6 (with bluntly pointed apex - Figure
Variation. Males and females generally have identical sculpture on the elytra. Two females studied, one from Ribeira da St. Luzia (Figure
Meladema distribution, material examined. Symbols with black border show locations of genotyped specimens. Symbol colours as follows: M. coriacea – red; M. lepidoptera sp. n. – blue; M. imbricata – green; M. lanio – yellow. Bicoloured symbols, hybrid or morphologically intermediate individuals.
Meladema species, Canary Islands, elytral shoulder sculpture SEMs A–E males F female (DNA voucher codes where applicable). A–B M. coriacea x imbricata hybrid, Tenerife, Bco. del Río 600 m (NHM-IRM16A) C M. coriacea, Tenerife, Bco. de Masca (NHM-IRM19A) D M. imbricata, La Gomera, El Cedro (NHM-IRM3A) E M. imbricata x coriacea hybrid, Tenerife, Bco. del Río 1,600 m (NHM-IRM5B) F M. imbricata, La Palma, Bco. Hoyo Verde.
Closest to M. imbricata; for diagnostic characters see under that species.
Restricted to the main island of Madeira (Figure
1 | Dorsum predominantly dark brown to black, unicolourous (Figure |
2 |
– | Dorsum not unicolourous, with elytra distinctly mottled and pronotum with distinct paler margins (Figure |
3 |
2 | Crescentic striolae on elytra relatively small and sparse, particularly on shoulder and on disc close to suture; most striolae not contiguous laterally with neighbours (Figures |
M. coriacea Laporte, 1835 |
– | Crescentic striolae on elytra relatively larger and denser, particularly on shoulder and on disc close to suture (Figures |
lepidoptera sp. n. |
3 | Elytra weakly shining, with (typically small) crescentic striolae in all specimens (Figures |
M. imbricata (Wollaston, 1871) |
– | Elytra strongly shining, without crescentic striolae in most specimens (Figures |
M. lanio (Fabricius, 1775) |
Meladema hybrid males, Tenerife, Bco. del Río; isolated elytron, fore and midtarsus, median lobe (lateral and ventral views) and abdominal ventrite 6, respectively (DNA voucher codes). A M. coriacea x imbricata, 600 m (NHM-IRM16A) B M. imbricata x coriacea, 1,600 m (NHM-IRM5B). Scale bars as follows: elytra 5 mm; tarsi, abdominal ventrites, median lobes 1 mm.
It is almost 15 years since it was first recognised that central Mediterranean populations of Meladema were genetically divergent from those elsewhere (
As noted above, Meladema specimens from central Saharan mountains (Hoggar, Tassili n’Ajjer, Tibesti) have an elytral sculpture unlike any other material examined. In the absence of more comprehensive genetic data, we treat these beetles here under the widespread M. coriacea, but they may represent an additional lineage within the genus. Whilst the Sahara probably originated on closure of the Tethys seaway ca. 7 million years ago (
As shown by
Whilst we do not have genetic data to confirm their status, we have seen Meladema material from mainland Italy which also suggests that hybridization occurs between M. coriacea and M. lepidoptera sp. n. in areas where they come into contact. Specimens with elytral sculpture intermediate between the two species (Figure
Hybridization between different Meladema taxa is perhaps facilitated by the relatively uniform nature of their genitalia and secondary sexual characteristics (see above). Compared to most dytiscid genera, the male genitalia of Meladema species are remarkably similar, particularly the median lobes. M. coriacea and M. imbricata, for example can be readily distinguished on a suite of external characters, but have median lobes which differ only slightly from each other. In the case of M. coriacea and M. lepidoptera sp. n., the median lobes are apparently identical in all aspects, as noted above. Despite evidence suggesting some hybridization, we retain these taxa as separate species since they are diagnosible on a suite of both molecular and morphological characters, and appear to remain distinct, suggesting limited gene exchange (
Hybrid/intermediate specimens examined are as follows: M. coriacea x imbricata hybrids. Genotyped specimens: 1 ♂ “13/v/2000 SPAIN Tenerife// Bco. del Río 600m// D. T. Bilton leg.” “DNA voucher// NHM-IRM16A” (CBP); 1 ♂ “13/v/2000 SPAIN Tenerife// Bco. del Río 600m// D. T. Bilton leg.” “DNA voucher// NHM-IRM16B” (CBP). Other specimens: 7 ♂♂ “Meladema// hybr. ♂// det. H. Bußler” [Meladema hybr. & ♂ HW] “La Gomera 1.4.94// Bco. de las Hoyas// leg. H Bußler” (CBF); 15 ♀♀ “Meladema// hybr. ♀// det. H. Bußler” [Meladema hybr. & ♀ HW] “La Gomera 1.4.94// Bco. de las Hoyas// leg. H Bußler” (CBF). M. imbricata x coriacea hybrids. Genotyped specimens: 1 ♂ “1998 SPAIN Islas Canarias// Tenerife// Barranco del Río 1,600m// D. T. Bilton leg.” “DNA voucher// NMH-IRM5B” (
Veiwed more widely, our study highlights the fact that our fundamental knowledge of biodiversity remains limited, even in the case of comparatively large taxa, in relatively well-studied regions of the world. If we are to understand the origins of such diversity, and how best to protect it in the future, we clearly need accurate taxonomies, which integrative approaches, such as those adopted here, are perhaps best able to supply.
We are grateful to Max Barclay and Roger Booth (