Research Article |
Corresponding author: Anh D. Nguyen ( ducanh410@yahoo.com ) Academic editor: Dragan Antić
© 2025 Anh D. Nguyen, Tam T. T. Vu, Thu-Anh T. Nguyen.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Nguyen AD, Vu TTT, Nguyen T-AT (2025) Mountainous millipedes in Vietnam. III. Two new dragon millipedes from limestone mountains in northern Vietnam (Polydesmida, Paradoxosomatidae, Hylomus), with an identification key to Vietnamese Hylomus species. ZooKeys 1223: 247-262. https://doi.org/10.3897/zookeys.1223.139649
|
Two new species of the dragon millipede genus Hylomus Cook & Loomis, 1924 are described from mountainous areas in northern Vietnam, namely Hylomus piccolo sp. nov. and Hylomus borealis sp. nov. The COI barcodes are provided for these species, and an identification key is presented to all Vietnamese Hylomus species.
Biodiversity, COI barcode, mountainous fauna, Southeast Asia, taxonomy
The term “dragon millipedes” refers to species from seven genera: Desmoxytes Chamberlin, 1923; Hylomus Cook & Loomis, 1924; Gigaxytes Srisonchai, Enghoff & Panha, 2018; Nagaxytes Srisonchai, Enghoff & Panha, 2018; Spinaxytes Srisonchai, Enghoff & Panha, 2018; Burmaxytes Srisonchai, Lin & Panha, 2020 and Siamaxytes Srisonchai & Panha, 2024 (
In Vietnam, Hylomus is the only known group of dragon millipedes, with 16 species described to date, including three considered troglobiotic (
This work is devoted to a better understanding of Hylomus diversity through the descriptions of two new species from limestone areas of northern Vietnam.
Millipede specimens were collected from limestone areas in northern Vietnam during expeditions organized by the Institute of Ecology and Biological Resources (IEBR), Vietnam Academy of Science and Technology.
Morphological characters were investigated under an Olympus SZX16 stereomicroscope. Gonopods were dissected for morphological examination and photographed. Color images were taken at various focal planes using a Sony A6000 camera coupled to a SMZ800N Nikon stereomicroscope. UV images were taken using the aforementioned camera-microscope in combination with illumination from a Nichia Convoy UV flashlight. Images were then stacked using Helicon Focus version 7.0 and assembled in Adobe Photoshop CS6.
For the scanning electron microscope (SEM), gonopods were dissected from the body, dehydrated using a series of ethanol concentrations, 90%, 95%, and 99%, for 24 hours, mounted on an aluminum stub, and then sputter coated with gold. SEM images were taken using the Prisma E system (ThermoFisher Scientific) at IEBR.
Total genomic DNA was extracted from the legs of midbody rings using a Qiagen DNeasy Blood and Tissue Kit. A 680 base pairs fragment of the mitochondrial gene, cytochrome c oxidase subunit I (COI), was amplified using a pair of universal primers, LCO1490 and HCO2198 (
Holotypes and paratypes are deposited in the myriapod collection, Institute of Ecology and Biological Resources (IEBR).
IEBR-Myr Institute of Ecology and Biological Resources, Myriapod collection.
Class Diplopoda de Blainville in Gervais, 1844
Order Polydesmida Pocock, 1887
Family Paradoxosomatidae Daday, 1889
Genus Hylomus Cook & Loomis, 1924
Holotype. Vietnam • 1 male; Cao Bang Province, Pia Oac - Pia Den National Park; 22.5943°N, 105.8846°E; 1200 m a.s.l.; 9 May 2021; Anh D. Nguyen leg.; bushes; IEBR-Myr 904H. Paratypes. Vietnam • 10 males, 5 females; same data as for holotype; EBR-Myr 904P • 1 male, 1 female; same data as for holotype; IEBR-Myr 901.
The species can be discriminated from the congeners by the presence of long spiniform paraterga, midbody metaterga with only two rows of 1+1 small setiferous spines in the middle and 2+2 longer setiferous spines near posterior margin; male femora 6 with a large tubercle ventrally; sternite 5 with a large, sparsely setose, bifid, trapeziform lamina between male coxae 4; epiproct without conspicuous setiferous knobs near tip; gonopod lamina lateralis broadly rounded, partly folded to sheathe distal part of solenomere; gonopod lamina medialis with a small rounded lobe at middle.
The new species is similar to Hylomus namek
The name refers to “piccolo”, a main character of the Japanese manga “Dragon balls” by Toriyama Akira (Japan). Noun in apposition.
Length c. 11.6–12.8 mm (male), 13.9–15.2 mm (female); width of midbody pro- and metazona (distance between two paratergal tips) 0.6–0.8 mm (male), 1.12–1.25 mm (female) and 3.1–3.3 mm (male), 3.4–3.6 mm (female), respectively. Holotype length c. 11.8 mm, width of midbody pro- and metazona 0.74 mm and 3.2 mm, respectively.
Coloration : Generally darkish-red to darkish-brown except paraterga, sterna, legs whitish-yellow; distal part of main branch pinkish.
Head
(Fig.
Collum
(Fig.
Body rings
: Ring 3 < 4 < 2 = 5–16 in width, thereafter gradually tapering towards telson. Prozona finely shagreened; metazona and pleura with microgranulations. Transverse sulcus present, but inconspicuous on metaterga 5–18. Axial line missing. Metaterga with two rows of 1+1 smaller setiferous spines in middle and 2+2 longer setiferous spines near posterior margin (Fig.
Paraterga
(Figs
Telson
(Fig.
Legs
: Extremely long, slender and thin, c. 1.8–2.0 times as long as midbody height. Prefemora not swollen. Male femora 6 each ventrally with a large, robust tubercle in middle (Figs
Sterna
: With distinct cross-impressions, no modification – except a large, sparsely setose, bifid, trapeziform lamina between male coxae 4 (Figs
Gonopod
(Fig.
Hylomus piccolo sp. nov., holotype (IEBR-Myr 904H), SEM A–D left gonopod, lateral view (A), dorsal view (B), ventral view (C), mesal view (D) E–H distal part of left gonopod, lateral view (E), dorsal view (F), ventral view (G), mesal view (H). Abbreviations: co = coxite; pref = prefemorite; fe = femorite; ca = canula; lm = lamina medialis; ll = lamina lateralis; sl = solenomere. Scale bars: 200 µm (A–D); 100 µm (E–G); 50 µm (H).
Holotype. Vietnam • 1 male; Cao Bang Province, Pia Oac - Pia Den National Park, on the way to Hang Ong; 22.5540°N, 105.8622°E; 850m a.s.l.; 8 May 2021; Anh D. Nguyen leg.; bushes; IEBR-Myr 908H. Paratypes. Vietnam • 2 females; same data as for holotype; IEBR-Myr 908P • 2 females; same data as for holotype; IEBR-Myr 906 • 2 females; same data as for the holotype, but 8 Jun. 2020; IEBR-Myr 851 • 1 female; same data as for sample IEBR-Myr 851; IEBR-Myr 854.
The species can be discriminated from the congeners by the presence of spiniform paraterga; metaterga densely covered with microgranulations; midbody metaterga with two rows of setiferous spines: 2+2 in anterior row and 2+2 near posterior margin, the anterior row hardly seen, the posterior row more distinct; male femora 6 each with a large tubercle ventrally; sternite 5 with a large, sparsely setose, bifid, trapeziform lamina between male coxae 4; epiproct with several evident setiferous knobs near tip; gonopod solenophore partly folded to sheathe distal part of solenomere; tip of solenophore consisting of seven overlapping laminae.
The new species is similar to H. proximus in body size and shape, but the two species are distinguished by the number of metatergal posterior spines (2+2 vs 3+3), male femoral modifications (femur 6 vs femora 5 & 6), and gonopod conformation. The new species has a well-developed gonopod solenophore (sph); a broadly rounded lamina medialis, partly folded to sheathe distal part of solenomere; and gonopod tip consisting of seven overlapping laminae while H. proximus has a gonopod femorite that is subequal to the postfemoral region in length; both solenophore and solenomere long; and a serrated solenophore tip.
Hylomus borealis sp. nov. is also similar to H. jeekeli (Golovatch & Enghoff, 1994) from northern Thailand in terms of general body and gonopod shape. However, the new species can be distinguished from it by the combination of these characters: smaller in size with 10.4 mm in males and 12.3–13.4 mm in females (vs 15–16 mm in males and 18–20 mm in females); metaterga with 2+2 spines in posterior rows (vs 3+3 spines); modification in only femur 6 (vs femora 6 and 7); tip of solenophore consisting of seven overlapping laminae and not serrate (vs serrated solenophore).
An adjective epithet “borealis” refers to the northern-most province (Cao Bang) of Vietnam, the type locality.
Holotype length 10.4 mm, width of mid pro- and metazona 0.6 mm and 1.8 mm (distance between two paratergal tips), respectively. Female length 12.3–13.4 mm, width of mid pro- and metazona 0.9–1.0 mm and 1.7–1.8 mm, respectively.
Coloration : Generally dark to castaneous brown except paratergal bases, sterna, leg coxae and prefemora whitish-yellow.
Head
(Fig.
Collum
(Fig.
Body rings
: Rings 3 < 4 < 2 = 5–16 in width, thereafter gradually tapering towards telson. Prozona finely shagreened; metazona and pleura with microgranulations. Transverse sulcus present, but inconspicuous on metaterga 5–18. Axial line missing. Metaterga with two rows of setiferous spines: 2+2 spines in anterior row and 2+2 spines near posterior margin (Figs
Paraterga
(Fig.
Telson
(Fig.
Legs : Extremely long, slender and thin, c. 1.5–1.6 times as long as midbody height. Prefemora not swollen. Male femora 6 each ventrally with a large, robust tubercle in middle.
Sterna
: with distinct cross-impression, no modification – except a large, sparsely setose, trapeziform lamina carrying two distal, separated lobes between male coxae 4 (Fig.
Gonopod
(Fig.
Hylomus borealis sp. nov., holotype (IEBR-Myr 908H), SEM A–D left gonopod, lateral view (A), ventral view (B), dorsal view (C), mesal view (D) E–G distal part of left gonopod, ventral view (E), dorsal view (F) G tip of left gonopod, ventral view. Abbreviations: co = coxite; pref = prefemorite; fe = femorite; ca = canula; lm = lamina medialis; ll = lamina lateralis; sl = solenomere. Scale bars: 200 µm (A–D); 100 µm (E), 50 µm (F), 30 µm (G).
(Appendix
(based on male characters)
1 | Body unpigmented. Troglobiotic | 2 |
– | Body pigmented. Non-troglobiotic | 4 |
2 | Paraterga well developed, spiniform. Metaterga with 56 + 56 setiferous spines in posterior row of midbody ring. Lamina lateralis of gonopod solenophore with dense setal region | H. songoku |
– | Paraterga small, poorly developed. Metaterga with less than 4 + 4 setiferous knobs in posterior row of midbody ring. Lamina lateralis of gonopod solenophore without dense setal region | 3 |
3 | Metaterga with 2 + 2 setiferous knobs in posterior row of midbody ring. Gonopod lamina lateralis with a small, but evident, slender, slightly twisted, apicomesal process, about half as long as a slender, distally conspicuously rugged and denticulate lamina medialis | H. srisonchai |
– | Metaterga with 3–4 + 3–4 setiferous knobs in posterior row of midbody ring. Gonopod lamina lateralis a simple rounded lobe, while lamina medialis deeply split into a long distal spine and a strongly bifid basal ribbon, both slightly spinulate | H. propinquus |
4 | Paraterga wing-shaped | H. spectabilis |
– | Paraterga antler- or spine-shaped | 5 |
5 | Paraterga antler-shaped | 6 |
– | Paraterga spine-shaped | 15 |
6 | Epiproct without conspicuous setiferous knobs near tip | 7 |
– | Epiproct with several evident setiferous knobs near tip | 12 |
7 | Metaterga smooth, more or less shining. Male femora 5–9 unmodified | H. asper |
– | Metaterga rough, dull, granular. Male femora 5/6/7/9 modified, inflated | 8 |
8 | Metaterga with 3 + 3 setiferous spines in posterior row. Male femora 6, 7 and 9 humped ventrally. Fifth sternum with a pair of tubercles between male coxae 4 | H. cervarius |
– | Metaterga with 2 + 2 setiferous spines in posterior row. Male femora 6 and 7, sometimes femur 5 modified, each with a large hump on ventral side. Fifth sternum with either a rectangular process or a bifid, trapeziform lamina between male coxae 4 | 9 |
9 | Body light or darkish-brown. Fifth sternum with a bifid, trapeziform lamina between male coxae 4 | 10 |
– | Body reddish or pinkish. Fifth sternum with four round tubercles on a prominent, elevated, rectangular lamina between male coxae 4 | H. enghoffi |
10 | Only male femur 6 with a big, robust ventral tubercle in middle | H. piccolo sp. nov. |
– | Male femora 6, 7, sometimes 5 humped ventrally | 11 |
11 | Male femora 6, 7 humped ventrally. Tip of solenophore lobuliform, broadly rounded | H. namek |
– | Male femora 6, 7, sometimes 5, humped ventrally. Tip of solenophore acute | H. saiyans |
12 | Metaterga with at least 3 + 3 spines in posterior row | 13 |
– | Metaterga with only 1 + 1 setae in posterior row | H. cattienensis |
13 | Body pink to red. Metaterga with numerous microsetae, and 4 + 4 spines in posterior row | H. pilosus |
– | Body dark to castaneous brown. Metaterga with microganulations, and with less 4+4 spines in posterior row | 14 |
14 | Metaterga with 3 + 3 spines in posterior row. Male femora 5 and 6 with a large ventral tubercle | H. proximus |
– | Metaterga with 2 + 2 spines in posterior row. Male femur 6 with a large ventral hump | H. borealis sp. nov. |
15 | Metaterga with 1 + 1 spines in posterior row. Gonopod subfalcate, femorite slightly curved; solenophore long | H. specialis |
– | Metaterga with 2 + 2 tubercles/spines in posterior row. Gonopod falcate; solenophore short, pointed terminally | 16 |
16 | Fifth sternum with two setiferous tubercles between male coxae 4, clearly separated. Antenna long and slender | H. grandis |
– | Fifth sternum with a bifid setiferous trapeziform lamina between male coxae 4. Antenna short and stout | H. hostilis |
The genus Hylomus is widely distributed from southern China to northern Thailand, all parts of Laos, and all regions of Vietnam, with
With an area exceeding 60,000 km2, Vietnam is renowned for its rich karst ecosystem, and is heavily reliant on its limestone karst regions, known for their extraordinary species diversity (
The number of Hylomus species in Vietnam has increased to 16, with the addition of two new species, H. piccolo sp. nov. and H. borealis sp. nov., from limestone forests in northern Vietnam. More extensive surveys and additional DNA data are needed to fully clarify the diversity, biogeography and phylogenetics of the genus Hylomus in Vietnam and Southeast Asia.
The work is supported by the Vietnam Academy of Science and Technology under the project NCXS01.04/23-25 “Developing the first-class research team on the discovery of diversity and application potential of hymenopterans, myriapods and soil nematodes in the limestone mountains of northeastern Vietnam”. Dr Jackson Means from Virginia Museum of Natural History (USA) is acknowledged for his kindly checking and correcting the English. Dr Sergei I. Golovatch (Russian Academy of Science, Moscow, Russia), Dr Ruttapon Srisonchai (Khon Kaen University, Thailand) and Dr Dragan Antić (University of Belgrade, Serbia) are acknowledged for their invaluable suggestions to improve the manuscript.
The authors have declared that no competing interests exist.
No ethical statement was reported.
The work is financially supported by the Vietnam Academy of Science and Technology under the project NCXS01.04/23-25.
Conceptualization: ADN. Data curation: TATN, ADN. Funding acquisition: TTTV, ADN. Investigation: ADN. Visualization: TATN. Writing – original draft: TTTV, ADN. Writing – review and editing: TTTV, TATN, ADN.
Anh D. Nguyen https://orcid.org/0000-0001-9273-0040
Tam T. T. Vu https://orcid.org/0000-0003-1145-975X
Thu-Anh T. Nguyen https://orcid.org/0000-0002-0564-3051
All of the data that support the findings of this study are available in the main text.
>IEBR_Myr_904 [organism = Hylomus piccolo sp.nov.]
TCTTCATTAAGAGGGATTATTCGGGTTGAGTTAAGAGGGTCTGGTAGATTAATTGGGGATGACCAG ATTTACAATGTAATAGTTACTGCTCATGCTTTTGTTATAATTTTTTTTATGGTTATGCCTATTA TAATCGGGGGGTTTGGAAATTGGTTGGTTCCTATTATAATTGGAGCTCCTGATATAGCTTTTCCT CGGATAAATAATTTAAGTTTTTGGTTACTACCTCCTTCTTTTCTTTTATTAATGATATCTTCTATG GTGGAAGGGGGAGTTGGAACAGGATGAACAGTTTATCCTCCTTTAGCTTCAAGTTTATTCCATGAG GGGTCAGCTGTTGATTTGGCTATTTTTTCTTTACATTTGGCTGGGGCCTCTTCTATTTTGGGTGCT
>IEBR_Myr_908 [organism = Hylomus borealis sp.nov.]
TCTTCTTTAAGAGGGATTATTCGGGTTGAATTAAGAGGGACTGGAAGATTAATCGGTGATGACC AGATTTATAATGTTATGGTAACAGCTCATGCTTTTGTAATGATTTTTTTTATGGTTATGCCT ATTATAATCGGGGGGTTCGGGAATTGATTGGTGCCTATTATGATTGGGGCTCCTGACATGGCT TTTCCGCGGATAAATAATTTGAGTTTTTGATTGTTACCTCCTTCTTTTTTTTTATTGATGTTGT CGTCAATGGTGGAGGGGGGGGTAGGGACTGGATGGACAGTTTATCCTCCGCTGGCTTCTAGATT GTTTCATGAGGGTTCGGCTGTGGATTTGGCTATTTTTTCTTTACATTTAGCTGGGGCTTCCTCTA TTTTAGGGGCTATTAATTTTATTTCTACTGTTATCAATATGCGGGTTCGTGGAATAATTTTTGAG CGTATTCCACTGGTTGTTTGATCGGTTTTTATTACTGCTATTCTGTTATTGTTATCTTTGCCTG TTCTGGCTGGGGCTATTACAATGTTATTAACTGATCGGAACTTTAATACAACTTTTTTTGACCC GGCTGGAGGGGGGGA