Catalogue |
Corresponding author: Charlotte A. Seid ( cseid@ucsd.edu ) Corresponding author: Greg W. Rouse ( grouse@ucsd.edu ) Academic editor: Andrew Davinack
© 2025 Charlotte A. Seid, Avery S. Hiley, Marina F. McCowin, José I. Carvajal, Harim Cha, Shane T. Ahyong, Oliver S. Ashford, Odalisca Breedy, Douglas J. Eernisse, Shana K. Goffredi, Michel E. Hendrickx, Kevin M. Kocot, Christopher L. Mah, Allison K. Miller, Nicolás Mongiardino Koch, Rich Mooi, Timothy D. O'Hara, Fredrik Pleijel, Josefin Stiller, Ekin Tilic, Paul Valentich-Scott, Anders Warén, Mary K. Wicksten, Nerida G. Wilson, Erik E. Cordes, Lisa A. Levin, Jorge Cortés, Greg W. Rouse.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Seid CA, Hiley AS, McCowin MF, Carvajal JI, Cha H, Ahyong ST, Ashford OS, Breedy O, Eernisse DJ, Goffredi SK, Hendrickx ME, Kocot KM, Mah CL, Miller AK, Mongiardino Koch N, Mooi R, O'Hara TD, Pleijel F, Stiller J, Tilic E, Valentich-Scott P, Warén A, Wicksten MK, Wilson NG, Cordes EE, Levin LA, Cortés J, Rouse GW (2025) A faunal inventory of methane seeps on the Pacific margin of Costa Rica. ZooKeys 1222: 1-250. https://doi.org/10.3897/zookeys.1222.134385
|
The methane seeps on the Pacific margin of Costa Rica support extensive animal diversity and offer insights into deep-sea biogeography. During five expeditions between 2009 and 2019, we conducted intensive faunal sampling via 63 submersible dives to 11 localities at depths of 300–3600 m. Based on these expeditions and published literature, we compiled voucher specimens, images, and 274 newly published DNA sequences to present a taxonomic inventory of macrofaunal and megafaunal diversity with a focus on invertebrates. In total 488 morphospecies were identified, representing the highest number of distinct morphospecies published from a single seep or vent region to date. Of these, 131 are described species, at least 58 are undescribed species, and the remainder include some degree of taxonomic uncertainty, likely representing additional undescribed species. Of the described species, 38 are known only from the Costa Rica seeps and their vicinity. Fifteen range extensions are also reported for species known from Mexico, the Galápagos seamounts, Chile, and the western Pacific; as well as 16 new depth records and three new seep records for species known to occur at vents or organic falls. No single evolutionary narrative explains the patterns of biodiversity at these seeps, as even morphologically indistinguishable species can show different biogeographic affinities, biogeographic ranges, or depth ranges. The value of careful molecular taxonomy and comprehensive specimen-based regional inventories is emphasized for biodiversity research and monitoring.
Biodiversity, biogeography, Central America, chemosynthetic ecosystem, COI, deep sea, DNA ‘barcodes’, molecular taxonomy, review
The Costa Rica margin (CRM) occupies a central position in the biogeographic and tectonic landscape of the eastern Pacific. The subduction of the Cocos Plate beneath the Caribbean Plate at the Middle America Trench gives rise to deep-sea methane seeps (hereafter called “seeps”) (
Active seepage of methane-rich fluids occurs at more than 100 sites located ca 50 km offshore along the CRM, from southern Nicaragua to the Osa Peninsula (
Map of the Costa Rica seep sites sampled in this study. Maps were generated using the R package marmap (
The first submersible dives at the CRM in 1994 revealed biological indicators of chemosynthetic activity, namely the presence of authigenic carbonates, microbial mats, and symbiont-bearing invertebrate megafauna (Fig.
Diversity of habitats at the Costa Rica seeps. Credit: ROV SuBastian/Schmidt Ocean Institute A authigenic carbonates at Mound 12 (1006 m, Dive S0215) B microbial mat at Rio Bongo Scar (609 m, Dive S0219) C vestimentiferan tubeworm aggregation (predominantly Lamellibrachia barhami) at Jacó Scar (1814 m, Dive S0212) D mussels (Bathymodiolus nancyschneiderae) and yeti crabs (Kiwa puravida) on authigenic carbonates at Mound 12 (1006 m, Dive S0215) E vesicomyid clams at Jacó Scar (1781 m, Dive S0214) F seepage of higher-temperature fluid at the Jacó Scar hydrothermal seep site (1803 m, Dive S0214) G wood fall at Jacó Scar (1875 m, Dive S0214) H animal fall (billfish skull, utilized by Grimothea monodon squat lobsters) at Quepos Slide (403 m, Dive S0216).
The CRM seeps also harbor a variety of animals that do not directly depend on chemosynthetic symbionts for nutrition. Initial records of such non-obligate seep fauna included limpets, snails, crabs, galatheoids, crinoids, actiniarians, corals, ophiuroids, echinoids, holothuroids, sponges, and macrurid fish (
Furthermore, the CRM seeps show environmental and biological connections to other chemosynthesis-based habitats. The Jacó Scar “hydrothermal seep” site at 1800 m depth (Fig.
During five research cruises to the CRM in 2009–2019, we used deep submergence vehicles to conduct intensive faunal sampling. Based on these expeditions and published literature, we compiled voucher specimen records, images, and DNA sequences to present a taxonomic inventory of faunal diversity at these seeps. We report new range extensions and depth records, discuss connections to other chemosynthesis-based ecosystems, and assess biogeographic patterns.
Specimens were collected during five research cruises to the central CRM (Fig.
Submersible dives and collection events. AD = HOV Alvin, R/V Atlantis. S = ROV SuBastian, R/V Falkor. MC = multicore. Multicores and plankton tows were deployed from R/V Atlantis. Coordinates reflect dive summaries as reported in the HOV Alvin dive logs (https://ndsf.whoi.edu/data/) and the R/V Falkor FK190106 cruise report. Dates reflect local time. Depth ranges reflect the minimum and maximum depth for sample collection events. In most cases, more precise coordinates and depths for specific animals are available on the SIO-BIC online database (https://sioapps.ucsd.edu/collections/bi/).
Cruise | Dive or deployment | Locality | Date | Latitude, Longitude | Depth, m |
---|---|---|---|---|---|
AT15-44 | AD4501 | Mound 12 | 2009-02-22 | 8.9300, -84.3135 | 984–997 |
AD4502 | Mound 12 | 2009-02-23 | 8.9285, -84.3132 | 987–997 | |
AD4503 | Mound 12 | 2009-02-24 | 8.9308, -84.3072 | 967–995 | |
AD4504 | Mound 11 | 2009-02-25 | 8.9208, -84.3054 | 1004–1011 | |
AD4505 | Mound 11 | 2009-02-26 | 8.9198, -84.3055 | 1019–1025 | |
AD4506 | Parrita Seep | 2009-02-27 | 8.9718, -84.6235 | 1030–1179 | |
AD4507 | Parrita Scar | 2009-02-28 | 8.9353, -84.6465 | 1659–1667 | |
AD4508 | Parrita Seep | 2009-03-01 | 9.0303, -84.6230 | 1401–1419 | |
AD4509 | Jacó Scar and Jacó Slope | 2009-03-03 | 9.1172, -84.8425 | 974–1856 | |
AD4510 | Jacó Summit | 2009-03-04 | 9.1723, -84.7987 | 741–744 | |
AD4511 | Mound 12 | 2009-03-05 | 8.9305, -84.3123 | 988–997 | |
AD4512 | Quepos Slide | 2009-03-06 | 8.8536, -84.2181 | 344–411 | |
AD4513 | Jacó Scar | 2009-03-07 | 9.1167, -84.8351 | 1744–1818 | |
MC1-2 | Transition site near Mound 12 (~ 500 m from active seep) | 2009-02-21 | 8.9316, -84.3168 | 1019 | |
AT15-59 | AD4586 | Mound 12 | 2010-01-07 | 8.9308, -84.3130 | 982–998 |
AD4587 | Mound 12 | 2010-01-08 | 8.9306, -84.3123 | 990–996 | |
AD4588 | Mound 12 | 2010-01-09 | 8.9308, -84.3125 | 995–997 | |
AD4589 | Mound 12 | 2010-01-10 | 8.9298, -84.3121 | 997 | |
AD4590 | Jacó Scar | 2010-01-11 | 9.1176, -84.8395 | 1791–1800 | |
AD4591 | Jacó Scar | 2010-01-12 | 9.1182, -84.8391 | 1752–1795 | |
MC1 | Transition site near Mound 12 (~ 400 m from active seep) | 2010-01-06 | 8.9325, -84.3158 | 995 | |
MC4 | Transition site near Mound 11 (~ 400 m from active seep) | 2010-01-10 | 8.9208, -84.3016 | 1031 | |
Plankton Tow 6 | Jacó Summit | 2010-01-12 | 9.1713, -84.7987 | 0–350 (350 m wire out) | |
AT37-13 | AD4906 | Mound 12 | 2017-05-21 | 8.9308, -84.3128 | 995–1002 |
AD4907 | Mound 12 | 2017-05-22 | 8.9304, -84.3128 | 990–999 | |
AD4908 | Mound 12 | 2017-05-23 | 8.9304, -84.3126 | 989–1001 | |
AD4909 | Mound 12 | 2017-05-24 | 8.9305, -84.3125 | 967–1000 | |
AD4910 | Mound 12 | 2017-05-25 | 8.9304, -84.3126 | 988–1004 | |
AD4911 | Jacó Scar | 2017-05-26 | 9.1151, -84.8468 | 1757–1892 | |
AD4912 | Jacó Scar | 2017-05-27 | 9.1154, -84.8362 | 1795–1859 | |
AD4913 | Jacó Scar | 2017-05-28 | 9.1156, -84.8401 | 1798–1908 | |
AD4914 | Jacó Scar | 2017-05-29 | 9.1175, -84.8395 | 1632–1886 | |
AD4915 | Jacó Scar | 2017-05-30 | 9.1180, -84.8404 | 1741–1885 | |
AD4916 | Jacó Scar | 2017-05-31 | 9.1193, -84.8428 | 1604–1854 | |
AD4917 | Mound 12 | 2017-06-01 | 8.9293, -84.3150 | 965–1000 | |
AD4918 | Quepos Slide | 2017-06-02 | 8.8535, -84.2177 | 333–408 | |
AD4919 | Quepos Slide | 2017-06-03 | 8.8527, -84.2174 | 379–410 | |
AD4921 | Quepos Slide | 2017-06-04 | 8.8532, -84.2155 | 345–394 | |
AD4922 | Mound 12 | 2017-06-05 | 8.9296, -84.3078 | 964–1009 | |
AD4923 | Parrita Seep | 2017-06-06 | 8.9759, -84.6238 | 1037–1097 | |
AD4924 | Parrita Seep | 2017-06-07 | 9.0305, -84.6202 | 1400–1410 | |
AT42-03 | AD4971 | Jacó Scar | 2018-10-17 | 9.1170, -84.8426 | 1746–1824 |
AD4972 | Jacó Scar | 2018-10-18 | 9.1164, -84.8403 | 1746–1845 | |
AD4973 | Jacó Scar | 2018-10-19 | 9.1148, -84.8398 | 1784–1887 | |
AD4974 | Mound 12 | 2018-10-20 | 8.9297, -84.3078 | 990–1010 | |
AD4975 | Mound 12 | 2018-10-21 | 8.9310, -84.3075 | 988–1002 | |
AD4976 | Jacó Scar | 2018-10-22 | 9.1139, -84.8401 | 1836–1887 | |
AD4977 | Jacó Scar | 2018-10-23 | 9.1163, -84.8418 | 1783 | |
AD4978 | Mound 12 | 2018-10-24 | 8.9294, -84.3143 | 996–999 | |
AT42-03 | AD4979 | Quepos Slide | 2018-10-25 | 8.8539, -84.2178 | 380–397 |
AD4984 | Mound 12 | 2018-10-30 | 8.9300, -84.3137 | 964–998 | |
AD4985 | Mound 12 | 2018-10-31 | 8.9303, -84.3129 | 991–1002 | |
AD4986 | Quepos Slide | 2018-11-01 | 8.8540, -84.2195 | 308–379 | |
AD4987 | Mound 12 West | 2018-11-02 | 8.9292, -84.3167 | 995–1012 | |
AD4988 | Mound 11 | 2018-11-03 | 8.9193, -84.3027 | 998–1025 | |
AD4989 | Jacó Scar | 2018-11-04 | 9.1174, -84.8417 | 1758–1792 | |
AD4990 | Parrita Seep | 2018-11-05 | 9.0321, -84.6197 | 1400–1435 | |
FK190106 | S0212 | Jacó Scar | 2019-01-06 | 9.1175, -84.8393 | 1780–1869 |
S0213 | Jacó Summit | 2019-01-06 | 9.1734, -84.8038 | 730–820 | |
S0214 | Jacó Scar | 2019-01-07 | 9.1175, -84.8393 | 1780–1875 | |
S0215 | Mound 12 | 2019-01-08 | 8.9307, -84.3126 | 982–1016 | |
S0216 | Quepos Slide | 2019-01-09 | 8.8539, -84.2193 | 275–404 | |
S0217 | The Thumb | 2019-01-10 | 9.0486, -84.3945 | 940–1074 | |
S0218 | Parrita Scar | 2019-01-11 | 8.9498, -84.6381 | 1110–1988 | |
S0219 | Rio Bongo Scar | 2019-01-13 | 9.2862, -85.2757 | 480–661 | |
S0220 | Subduction Plume | 2019-01-14 | 8.8785, -84.8695 | 3399–3601 | |
S0230 | Mound Jaguar | 2019-01-25 | 9.6558, -85.8813 | 1895–2000 |
The submersible dives in this study primarily investigated areas of active methane seepage, as indicated by the presence of non-sedimented authigenic carbonates, microbial mats, or symbiont-bearing megafauna (
We generally follow the locality names listed in
Most specimens were collected during submersible dives using equipment such as hydraulic arms, suction samplers, scoops, push cores, a Bushmaster Jr. device for sampling tubeworm aggregations (
Specimens were maintained alive in chilled seawater, treated with an appropriate relaxing agent, and processed following recommended practices for DNA taxonomy of marine invertebrates (
Specimens were deposited in the Scripps Institution of Oceanography Benthic Invertebrate Collection (SIO-BIC) and the Museo de Zoología, Universidad de Costa Rica (
We targeted benthic invertebrate macrofauna (retained on a 300 µm mesh and typically > 1 mm in size) and megafauna due to the nature of our sampling gear, although a few opportunistically collected exceptions such as large nematodes are reported. The meiofaunal (
We reported only taxa that were linked to physical specimens, given the importance of museum vouchers for genetic characterization, species descriptions, scientific reproducibility, and the principles of Findable, Accessible, Interoperable, and Reusable (FAIR) research (
Following preliminary morphological identification during shipboard processing, specimens were identified to the lowest possible taxonomic level based on genetics and/or morphology. Genetic identification was facilitated by querying sequences against the NCBI GenBank database (
Taxonomic uncertainty was expressed using recommended terminology and practices for open nomenclature (
Genomic DNA was extracted following the manufacturer’s protocol for commercial kits such as the DNeasy Tissue Kit (Qiagen); the EZNA Micro-Elute Genomic DNA Kit (Omega Bio-Tek); or the Quick-DNA Miniprep, Microprep Plus, or 96 Plus Kit (Zymo Research, Irvine, CA and Tustin, CA). Polymerase chain reaction (PCR) amplification of phylogenetically informative gene fragments was performed using the primer pairs summarized in Table
PCR primers and temperature profiles. Mitochondrial genes: COI = cytochrome c oxidase subunit I; COIII = cytochrome c oxidase subunit III; 16S = ribosomal RNA 16S subunit. Nuclear genes: 18S = ribosomal RNA 18S subunit.
Amplified gene fragment | Primer pair | References for primer sequences | Temperature profile | Taxa |
---|---|---|---|---|
COI | LCO1490/ HCO2198 |
|
94 °C/180s – (94 °C/30s – 47 °C/45s – 72 °C/60s) * 5 cycles – (94 °C/30s – 52 °C/45s – 72 °C/60s) * 30 cycles – 72 °C/300s | Annelida, Arthropoda, Mollusca, Nemertea |
COI | dgLCO/ dgHCO |
|
95 °C/120s – (95 °C/40s – 45 °C/40s – 72 °C/60s) * 35 cycles – 72 °C/420s or 95 °C/300s – (95 °C/30s – 48 °C/30s – 72 °C/45s) * 35 cycles – 72 °C/300s | Annelida, Mollusca, Holothuroidea, Caridea |
COI | PolyLCO/ PolyHCO |
|
95 °C/180 s – (95 °C/40 s – 42 °C/40 s – 72 °C/50 s) * 40 cycles – 72 °C/300 s | Annelida |
COI | HCO2198/LCO_Apl |
|
95 °C/60s – (95 °C/20s – 52 °C/15s – 72 °C/30s) * 40 cycles – 72 °C/420s | Aplacophora |
COI | HCO2198/ CrustF2 |
|
95 °C/60s – (95 °C/30s – 42 °C/90s – 72 °C/60s) *35 cycles – 72 °C/300s | Arthropoda |
COI | COIceF/ COIceR |
|
95 °C/180s – (94 °C/45s – 48 °C/70s – 72 °C/80s) * 40 cycles – 72 °C/600s | Echinodermata |
COI | ECOLa/ HCO2198 |
|
94 °C/240s – (94 °C/30s – 50 °C/30s – 72 °C/45s) * 35 cycles – 72 °C/300s | Asteroidea |
COI | Fsco1/ Co13r |
|
94 °C/180s – (94 °C/45s – 48 °C/45s – 72 °C/60s) * 35 cycles – 72 °C/480s | Crinoidea |
COI | COIef/ COIer |
|
95 °C/120s – (95 °C/30s – 48 °C/30s – 72 °C/45s) * 35 cycles – 72 °C/600s | Holothuroidea, Echinoidea |
COI | VesLCO/ VesHCO |
|
94 °C/240s – (94 °C/40s – 40 °C/40s – 72 °C/60 s) * 40 cycles – 72 °C/600 s | Vesicomyidae |
COI | jgLCO1490/ jgHCO2198 |
|
95 °C/300s – (95 °C/30s – 48 °C/30s – 72 °C/45s) * 35 cycles – 72 °C/300s | Hyalogyrina |
COIII | COIIIF/ COIIIR |
|
95 °C/120s – (95 °C/30s – 45 °C/30s – 72 °C/60s) * 30 cycles – 72 °C/300s | Actiniaria |
16S | 16SarL/ 16SbrH |
|
95 °C/180s – (95 °C/40s – 50 °C/40s – 68 °C/50 s) * 35 cycles – 68 °C/300 s or 95 °C/180s – (95 °C/40s – 50 °C/40s – 72 °C/50 s) * 40 cycles – 72 °C/300 s | Annelida, Nemertea, Holothuroidea, Polyplacophora, Paracrangon areolata, Grimothea monodon |
16S | ANEM16SA/ ANEM16SB |
|
95 °C/120s – (95 °C/30s – 60 °C/30s – 72 °C/60s) * 30 cycles – 72 °C/300s | Anthozoa |
16S | 16S_arL_solenos (CGACTGTTTAACAAAAACATTGCTC)/ 16S_brH_solenos (CCGATTTGAACTCAGATCATGTAG) | this work (K. Kocot) | 95 °C/60s – (95 °C/20s – 52 °C/15s – 72 °C/30s) *40 cycles – 72 °C/420s | Aplacophora |
16S | AnnF/ 16Sb |
|
94 °C/120s – (94 °C/40s – 60 °C/40s – 70 °C/45s) * 35 cycles – 72 °C/420s | Sabellidae, Macellicephalinae |
18S | Three overlapping fragments: 1F/5R, 3F/bi, a2.0/9R |
|
1F/5R: 95 °C/180s – (95 °C/60s – 49 °C/30s – 72 °C/90s) * 40 cycles – 72 °C/480s; 3F/bi: 95 °C/180s – (95 °C/30s – 52 °C/30s – 72 °C/90s) *40 cycles – 72 °C/480s; a2.0/9R: 95 °C/180s – (95 °C/30s – 49 °C/30s – 72 °C/90s) *40 cycles – 72 °C/480s | Sabellidae |
18S | Three overlapping fragments: TimA/1100R2, 3F/bi, a2.0/9R |
|
TimA/1100R2: 94 °C/180s – (94 °C/30s – 53 °C/45s – 72 °C/120s) * 40 cycles – 72 °C/300s; 3F/bi, a2.0/9R: see previous | Sabellidae |
18S | Sol18F/ Sol18R |
|
94 °C/300s – (91 °C/40s – 50 °C/40s – 72 °C/90s) * 40 cycles – 72 °C/300s | Solemyidae |
Sequences were aligned using the MAFFT online service v. 7.471, option L-INS-I (
Selected aplacophoran specimens were dried and mounted on stubs without critical point drying or sputter coating. Specimens were imaged on a Phenom Pro SEM.
Specimen collection and field operations were performed under the following permits issued by CONAGEBIO (Comisión Nacional para la Gestión de la Biodiversidad), INCOPESCA (Instituto Costarricense de Pesca y Acuicultura), and SINAC (Sistema Nacional de Áreas de Conservación) under MINAE (Ministerio de Ambiente y Energía), Government of Costa Rica: INCOPESCA-CPI-003-12-2018, R-070-2018-OT-CONAGEBIO, SINAC-CUSBSE-PI-R-032-2018, SINAC-SE-CUS-PI-R-035-2017. In accordance with the Nagoya Protocol on Access and Benefit Sharing, DNA sequencing for this project was authorized by the Contract for the Grant of Prior Informed Consent between MINAE-SINAC-ACMC and Jorge Cortés-Nuñez for the Basic Research Project: “FK190106-Cuantificación de los vínculos biológicos, químicos y físicos entre las comunidades quimiosintéticas con el mar profundo circundante.”
For each taxonomic entry, we summarize the known localities and depths of occurrences at the CRM seeps, incorporating both published references and additional material examined in this work. Representative voucher specimens and their associated DNA sequences are listed by dive/deployment number (details in Table
We also summarize the known localities and depths of occurrences beyond the CRM seeps. We indicate new biogeographic records, new depth records (defined here as at least 100 m from a previously reported minimum or maximum depth), and new seep records of species previously associated with vents or organic falls. Exact collection depths are provided where possible; approximations are indicated by ~ .
References indicate previously published records from the CRM seeps. Original species descriptions are indicated by **. References generally include voucher specimen listings with representative images and DNA sequences; where possible, we provide any missing components. Specimen catalog numbers pertain to SIO-BIC unless otherwise indicated. GenBank numbers refer to COI sequences unless otherwise indicated. New sequences are shown in bold.
For higher-level taxonomy, we follow the World Register of Marine Species (WoRMS Editorial Board 2024) or taxon-specific references. We notate higher classification according to the recommended best practice for the DarwinCore term higherClassification (Darwin Core Maintenance Group 2021), with full taxonomic authorities and Linnaean ranks available in the applicable references. Our ordering of major animal groups reflects the phylogeny in
We list entries following the taxonomic arrangement in
Protodrilidae stet.
Fig.
Annelida: Protodrilidae and Polynoidae, representative live images A Protodrilidae stet. (A8456) B Bathykurila sp. A sec.
Material examined. AD4906: A8261; AD4923: A8456 (PQ449314).
Localities. Mound 12 (1002 m), Parrita Seep (~ 1040–1101 m).
Bathykurila sp. A sec.
Fig.
Material examined. AD4906: A8264; S0213: A10050 (PQ449253); S0217: A10086.
Localities. Jacó Summit (~ 730–820 m), Mound 12 (~ 997–1002 m), Mound 11 (1004–1040 m), The Thumb (1072 m).
Remarks. COI sequences of this morphospecies were > 99.42% identical to those of Bathykurila haplotype group A (GenBank DQ074778.1, DQ074779.1, DQ074780.1), which morphologically resembles B. guaymasensis Pettibone, 1989 as discussed in
Branchinotogluma sp. SIO_BIC_A8265
Fig.
Material examined. AD4907: A8265 (OR682087).
Localities. Mound 12 (~ 990–999 m).
Remarks. An undescribed species. Specimen A8265 was associated with experimentally deployed wood.
Branchinotogluma sp. SIO_BIC_A8460
Fig.
Material examined. AD4913: A13252 (OR682108); AD4924: A8460 (OR682111), A8461, A16362; S0218: A10190 (OR682109).
Localities. Parrita Scar (1364 m), Parrita Seep (~ 1400–1410 m), Jacó Scar (1847 m).
Remarks. An undescribed species.
Branchinotogluma sp. SIO_BIC_A9682
Fig.
Annelida: Polynoidae, representative images. Live specimens are depicted unless otherwise specified A Branchinotogluma sp. SIO_BIC_A9682 (A9682, dorsal view) B Branchinotogluma sp. SIO_BIC_A9682 (A9682, ventral view) C Branchinotogluma sp. SIO_BIC_A9682 (A9763, dorsal view without scales) D Branchipolynoe eliseae (A6660, preserved specimen, dorsal and ventral views) E Branchipolynoe halliseyae (A1322, dorsal and ventral views) F Branchipolynoe kajsae (A6611, dorsal and ventral views) G Branchipolynoe meridae (A6616, dorsal and ventral views) H Gorgoniapolynoe cf. caeciliae (A8485, with host coralliid Co2947). Scale bars: 1 mm (A–C, H); 1 cm (D–G).
Material examined. AD4505: A1363 (OR682006); AD4924: A8459 (OR682020); AD4972: A9682 (OR682056); AD4978: A9763 (OR682070); S0230: A10185 (OR682045), A10187 (OR682037).
Localities. Mound 12 (~ 1000 m), Mound 11 (1025 m), Parrita Seep (~ 1400 m), Jacó Scar (~ 1800 m), Mound Jaguar (1908–1909 m).
Remarks. An undescribed species.
Branchipolynoe eliseae Lindgren, Hatch, Hourdez, Seid & Rouse, 2019
Fig.
Reference.
Localities. Mound 12 (997 m; type locality), Jacó Scar (~ 1752–1800 m).
Distribution. Known only from the CRM seeps.
Remarks. Symbiont of the mussels Bathymodiolus billschneideri and Ba. nancyschneiderae (
Branchipolynoe halliseyae Lindgren, Hatch, Hourdez, Seid & Rouse, 2019
Fig.
Reference.
Localities. Mound 12 (~ 1000 m; type locality), Parrita Seep (~ 1400 m), Jacó Scar (1758–1811 m).
Distribution. Known only from the CRM seeps.
Remarks. Symbiont of the mussels Bathymodiolus billschneideri, Ba. nancyschneiderae, and Ba. earlougheri (
Branchipolynoe kajsae Lindgren, Hatch, Hourdez, Seid & Rouse, 2019
Fig.
Reference.
Localities. Mound 12 (~ 1000 m; type locality), Parrita Seep (~ 1400 m), Jacó Scar (~ 1800 m).
Distribution. Known only from the CRM seeps.
Remarks. Symbiont of the mussels Bathymodiolus billschneideri, Ba. nancyschneiderae, and Ba. earlougheri (
Branchipolynoe meridae Lindgren, Hatch, Hourdez, Seid & Rouse, 2019
Fig.
Reference.
Localities. Mound 12 (~ 1000 m), Jacó Scar (~ 1800 m; type locality).
Distribution. Known only from the CRM seeps.
Remarks. Symbiont of the mussels Bathymodiolus billschneideri and Ba. earlougheri (
Gorgoniapolynoe cf. caeciliae (Fauvel, 1913)
Figs
Annelida: Polynoidae, representative images. Live specimens are depicted unless otherwise specified A Gorgoniapolynoe cf. caeciliae (A8485, removed from host Co2947) B Macellicephala sp. SIO_BIC_A8368 (A8368, preserved specimen) C Macellicephala sp. SIO_BIC_A9775 (A9775) D Macellicephala sp. SIO_BIC_A10055 (A10055, dorsal view) E Macellicephala sp. SIO_BIC_A10055 (A10055, ventral view) F Macellicephala sp. SIO_BIC_A10094 (A10094, dorsal view) G Macellicephala sp. SIO_BIC_A10094 (A10094, ventral view) H Macellicephala sp. SIO_BIC_A10099 (A10099, in situ on host cladorhizid sponge P1754). Credit: ROV SuBastian/Schmidt Ocean Institute. Scale bars: 1 mm (A, B, D–G); 1 cm (C).
Material examined. AD4506: A1549; AD4923: A8455 (PQ449313), A8485.
Localities. Parrita Seep (~ 1030–1094 m).
Remarks. Associated with coralliid octocorals: A1549 with coral Co2271, A8455 and A8485 with coral Co2947. The COI sequence of A8455 was 98.20% identical to a reference sequence of Gorgoniapolynoe cf. caeciliae molecular operational taxonomic unit (MOTU) 1 from the central Atlantic (ON479554.1), representing one of two lineages in a potential cryptic species complex with inter-lineage COI distances of 2–7% (
Macellicephala sp. SIO_BIC_A8368
Fig.
Material examined. AD4913: A8368 (PQ449306).
Localities. Jacó Scar (~ 1817–1896 m).
Macellicephala sp. SIO_BIC_A9775
Fig.
Material examined. AD4975: A9775 (PQ449325).
Localities. Mound 12 (1000 m).
Remarks. An undescribed species. At least six individuals were associated with the ambulacral groove of an asteroid, Thrissacanthias penicillatus (E7246).
Macellicephala sp. SIO_BIC_A10055
Fig.
Material examined. S0213: A10055 (OP648305).
Localities. Jacó Summit (~ 730–820 m).
Macellicephala sp. SIO_BIC_A10094
Fig.
Material examined. S0219: A10094 (PQ449266).
Localities. Rio Bongo Scar (659 m).
Remarks. Afflicted with copepod parasites.
Macellicephala sp. SIO_BIC_A10099
Figs
Annelida: Polynoidae, representative live images A Macellicephala sp. SIO_BIC_A10099 (A10099) B Macellicephalinae sp. SIO_BIC_A8365 (A8365, dorsal view) C Macellicephalinae sp. SIO_BIC_A8365 (A8365, ventral view) D Macellicephalinae sp. SIO_BIC_A8458 (A8458) E Macellicephalinae sp. SIO_BIC_A10186 (A10186, dorsal view) F Macellicephalinae sp. SIO_BIC_A10186 (A10186, ventral view) G Peinaleopolynoe elvisi (A10059) H Peinaleopolynoe mineoi (
Material examined. S0220: A10099 (OP648306; 16S: PQ304650).
Localities. Subduction Plume (3601 m).
Remarks. An undescribed species associated with a cladorhizid sponge, P1754.
Macellicephalinae sp. SIO_BIC_A8365
Fig.
Material examined. AD4914: A8365 (PQ449304).
Localities. Jacó Scar (1839 m).
Remarks. Associated with a holothuroid, Achlyonice stet. (E7042 or E7043).
Macellicephalinae sp. SIO_BIC_A8458
Fig.
Material examined. AD4923: A8458 (PQ449315).
Localities. Parrita Seep (~ 1037–1108 m).
Macellicephalinae sp. SIO_BIC_A10186
Fig.
Material examined. S0230: A10186.
Localities. Mound Jaguar (1909 m).
Peinaleopolynoe elvisi Hatch, Liew, Hourdez & Rouse, 2020
Fig.
Reference.
Additional material examined. S0214: A10059 (PQ449258).
Localities. Jacó Scar (1845–1887 m).
Distribution. Also known from a whale fall in Monterey Submarine Canyon, off California, 1820 m (type locality) and from cow bones experimentally deployed at 2091 m at Seamount 1, which lies on the CRM ca 41 km southwest of Jacó Scar (
Remarks. A10059 was associated with a naturally occurring wood fall. All known occurrences of P. elvisi have been associated with vertebrate bones or wood (naturally occurring and experimentally deployed, for both substrates) (
Peinaleopolynoe mineoi Hatch, Liew, Hourdez & Rouse, 2020
Fig.
Reference.
Localities. Mound 12 (992–1011 m; type locality), Mound 11 (1010 m).
Distribution. Known only from the CRM seeps.
Remarks. All known occurrences of P. mineoi have been associated with wood (naturally occurring and experimentally deployed) or experimentally deployed vertebrate bones (
Polynoidae sp. SIO_BIC_A8426
Fig.
Annelida: Polynoidae, representative live images A Polynoidae sp. SIO_BIC_A8426 (A8426, on host holothuroid E7063) B Polynoidae sp. SIO_BIC_A8426 (A8426, dorsal view) C Polynoidae sp. SIO_BIC_A8426 (A8426, ventral view) D Polynoidae sp. SIO_BIC_A9652 (A9652, dorsal view) E Polynoidae sp. SIO_BIC_A9652 (A9652, ventral view) F Polynoidae sp. SIO_BIC_A9714 (A9714, dorsal view) G Polynoidae sp. SIO_BIC_A9714 (A9714, ventral view) H Polynoidae sp. SIO_BIC_A10082 (A10082, dorsal view). Scale bars: 1 cm (A, D–G); 1 mm (B, C, H).
Material examined. AD4922: A8426 (PQ449308).
Localities. Mound 12 (1006 m).
Remarks. Associated with a holothuroid, Bathyplotes sp. SIO_BIC_E7063.
Polynoidae sp. SIO_BIC_A9652
Fig.
Material examined. AD4972: A9720; AD4973: A9652 (PQ449319), A9653.
Localities. Jacó Scar (1784 m).
Polynoidae sp. SIO_BIC_A9714
Fig.
Material examined. AD4974: A9714 (PQ449321).
Localities. Mound 12 (~ 1001–1003 m).
Polynoidae sp. SIO_BIC_A10082
Figs
Annelida: Polynoidae, Syllidae, and Nephtyidae, representative live images A Polynoidae sp. SIO_BIC_A10082 (A10082, ventral view) B Polynoidae sp. SIO_BIC_A10096 (A10096, dorsal view) C Polynoidae sp. SIO_BIC_A10096 (A10096, ventral view) D Polynoidae sp. SIO_BIC_A10189 (A10189, dorsal view) E Polynoidae sp. SIO_BIC_A10189 (A10189, ventral view) F Anguillosyllis sp. SIO_BIC_A12403 (A12403) G Synmerosyllis stet. (A1928) H Nephtys stet. (A1437, dorsal view). Scale bars: 1 mm (A, D–H); 1 cm (B, C).
Material examined. AD4919: A8421; AD4986: A9899; S0216: A10082 (PQ449262).
Localities. Quepos Slide (~ 308–410 m)
Remarks. A10082 was associated with bones from a naturally occurring sailfish carcass.
Polynoidae sp. SIO_BIC_A10096
Fig.
Material examined. S0219: A10095, A10096 (PQ449267), A10098, A10109, A10110.
Localities. Rio Bongo Scar (~ 480–650 m).
Remarks. A10096 and A10098 were commensals in a sponge, Farrea occa (P1753).
Polynoidae sp. SIO_BIC_A10189
Fig.
Material examined. AD4913: A8369; S0230: A10189 (PQ449271).
Localities. Jacó Scar (~ 1817–1896 m), Mound Jaguar (2000 m).
Remarks. A10189 was associated with a naturally occurring wood fall.
Anguillosyllis sp. SIO_BIC_A9613
Material examined. AD4975: A9613; AD4978: A9771.
Localities. Mound 12 (~ 992–999 m).
Remarks. An undescribed species. A9613 was associated with experimentally deployed wood and bone at 992 m.
Anguillosyllis sp. SIO_BIC_A12403
Fig.
Reference. (
Localities. Near Mound 12 (995 m).
Remarks. An undescribed species, morphologically similar to Anguillosyllis sp. SIO_BIC_A9613. This specimen was collected in a sediment core adjacent to Mound 12, ca 400 m from known sites of active seepage and likely representing the far-transition zone to the surrounding environment.
Synmerosyllis stet.
Fig.
Reference.
Localities. Mound 12 (997 m).
Nephtys stet.
Figs
Annelida: Nephtyidae, Pilargidae, and Chrysopetalidae, representative live images A Nephtys stet. (A1437, ventral view) B Sigambra sp. SIO_BIC_A9597 (A9597) C Chrysopetalinae sp. SIO_BIC_A8064 D Laubierus alvini (A1323) E Micospina auribohnorum (A1427) F Natsushima sashai (A1447) G Shinkai fontefridae (A1384) H Shinkai longipedata (A1360). Scale bars: 1 mm (A–F, H); 1 cm (G).
Material examined. AD4510: A1437.
Localities. Jacó Summit (742 m).
Sigambra sp. SIO_BIC_A9597
Fig.
Material examined. AD4503: A1346; AD4972: A9597; AD4987: A9843.
Localities. Mound 12 (~ 967–999 m), Jacó Scar (1795 m).
Remarks. An undescribed species.
Chrysopetalinae sp. SIO_BIC_A8064
Fig.
Material examined. AD4508: A1404, A2410; AD4914: A8063; AD4917: A8065; AD4922: A8064, A10280; AD4974: A9609, A9758; AD4985: A9853; AD4990: A9879.
Localities. Mound 12 (~ 965–1002 m), Parrita Seep (1401–1402 m), Jacó Scar (~ 1632–1886 m).
Remarks. An undescribed genus and species.
Laubierus alvini Aguado & Rouse, 2011
Fig.
Reference.
Additional material examined. S0214: A10057 (PQ449257).
Localities. Mound 12 (~ 982–999 m), Mound 11 (~ 1004–1011 m; type locality), Jacó Scar (~ 1752–1860 m).
Distribution. Known only from the CRM seeps.
Remarks. As noted in the original description, L. alvini is a symbiont of the mussel Bathymodiolus earlougheri, but not of the two sympatric species subsequently described as B. billschneideri and B. nancyschneiderae. The worms are found among the gill filaments, with typically 2–25 individuals per host, and the number of individuals linearly correlates with the length of the host (
Micospina auribohnorum Watson, Carvajal, Sergeeva, Pleijel & Rouse, 2016
Fig.
Reference.
Additional material examined. S0217: A10088 (PQ449265).
Localities. Jacó Summit (~ 750 m), Mound 12 (~ 1000 m), Mound 11 (~ 1040 m), The Thumb (1072 m; this study), Jacó Scar (~ 1800 m).
Distribution. Also known from a whale fall at 845 m off San Diego, California (type locality) (
Natsushima sashai Aguado & Rouse, 2011
Fig.
Reference.
Localities. Mound 12 (~ 1000 m; type locality).
Distribution. Known only from the CRM seeps.
Remarks. A symbiont of the solemyid clam Acharax cf. johnsoni; the worms are found among the gill lamellae, with no more than four individuals per host, in three possible combinations: one female, one male and one female, or two males and two females (
Shinkai fontefridae Aguado & Rouse, 2011
Fig.
Reference.
Localities. Parrita Seep (1186 m), Parrita Scar (~ 1660 m), Jacó Scar (~ 1752–1800 m; type locality).
Distribution. Known only from the CRM seeps.
Remarks. Symbiont of the vesicomyid clams Phreagena soyoae and Archivesica gigas (previously cited as Calyptogena kilmeri and Vesicomya gigas, respectively); the worms are found between the gill lamellae and foot, typically with one male and one female per host (
Shinkai longipedata Miura & Ohta, 1991
Fig.
Reference.
Localities. Mound 11 (~ 1019–1025 m).
Distribution. Originally described from hydrothermal vents at Iheya Ridge off southern Japan (
Remarks. Originally described as a commensal symbiont in the mantle cavity of the vesicomyid clam Calyptogena sp. (
Vigtorniella sp. SIO_BIC_A8061
Fig.
Annelida: Chrysopetalidae and Hesionidae, representative live images A Vigtorniella sp. SIO_BIC_A8061 (A8061) B Amphiduropsis cf. axialensis (A8110) C Gyptis robertscrippsi (A1750) D Gyptis sp. SIO_BIC_A10083 (A10083) E Leocrates gen. inc. (A10184) F Neogyptis jeffruoccoi (A1448) G Sirsoe dalailamai (
Material examined. AD4914: A8061, A8062.
Localities. Jacó Scar (~ 1632–1886 m).
Remarks. An undescribed species.
Amphiduropsis cf. axialensis (Blake & Hilbig, 1990)
Fig.
Reference.
Localities. Mound 12 (~ 984–997 m).
Remarks. The type locality of Amphiduropsis axialensis is hydrothermal vents at 1545 m on the Axial Seamount of the Juan de Fuca Ridge (
Gyptis robertscrippsi Rouse, Carvajal & Pleijel, 2018
Fig.
Reference.
Localities. Mound 12 (~ 982–1002 m; type locality), Mound 11 (~ 1019–1025 m), Jacó Scar (1783–1794 m).
Distribution. Known only from the CRM seeps.
Gyptis sp. SIO_BIC_A10083
Fig.
Material examined. AD4919: A8114; S0216: A10083.
Localities. Quepos Slide (~ 379–398 m).
Remarks. An undescribed species.
Leocrates gen. inc.
Fig.
Material examined. AD4914: A8113; S0230: A10184.
Localities. Jacó Scar (1886 m), Mound Jaguar (1909 m).
Remarks. Taxonomic placement of these specimens requires further assessment, particularly in light of recent revisions to several hesionid genera (
Neogyptis jeffruoccoi Rouse, Carvajal & Pleijel, 2018
Fig.
Reference.
Localities. Mound 12 (~ 988–997 m; type locality), Mound 11 (~ 1019–1025 m).
Distribution. Also known from seeps in the Guaymas Basin, Gulf of California, 1572–1613 m, and off Del Mar, California, 1020 m (
Remarks. Found in the mantle cavity of the solemyid clam Acharax cf. johnsoni, with either one individual or two (one male and one female) per host (
Sirsoe dalailamai Rouse, Carvajal & Pleijel, 2018
Fig.
Reference.
Localities. Mound 12 (997 m), Parrita Seep (1402 m), Jacó Scar (1784–1795 m; type locality).
Distribution. Also described from a seep in the Guaymas Basin, Gulf of California, 1560–1613 m (
Remarks. Associated with vestimentiferan and mussel communities at areas of active methane seepage (
Sirsoe munki Rouse, Carvajal & Pleijel, 2018
Fig.
Reference.
Additional material examined. S0217: A10087 (PQ449264).
Localities. Jacó Slope (1063 m), The Thumb (1072 m; this study), Jacó Scar (~ 1800 m; type locality).
Distribution. Known only from the CRM seeps.
Sirsoe sp. SIO_BIC_A8288
Fig.
Annelida: Hesionidae, Nereididae, Sphaerodoridae, and Lacydoniidae, representative images. Live specimens are depicted unless otherwise specified A Sirsoe sp. SIO_BIC_A8288 (A8288, preserved specimen) B Vrijenhoekia sp. A sec.
Material examined. AD4909: A8288 (PQ449293).
Localities. Mound 12 (990 m).
Remarks. An undescribed species associated with a microbial mat.
Vrijenhoekia sp. A sec.
Fig.
Material examined. AD4508: A1406; AD4907: A8101; AD4974: A9606, A9608, A9612, A9615; AD4988: A9926.
Localities. Mound 11 (1010 m), Mound 12 (~ 990–999 m), Parrita Seep (1419 m).
Remarks. The undescribed species Vrijenhoekia sp. A was previously known only from a single specimen, SIO-BIC A3255, from a seep in the Guaymas Basin, Gulf of California, 1565–1598 m; the specimen was collected in poor condition and diagnostic morphological features could not be assessed (
These specimens will be further examined and compared to other eastern Pacific Nereididae in a separate work.
Nereis stet.
Fig.
Material examined. AD4906: A8258; AD4910: A8291.
Localities. Mound 12 (997–1002 m).
Remarks. A8258 was associated with experimentally deployed bone.
Nereididae sp. SIO_BIC_A9614
Fig.
Material examined. AD4974: A9614.
Localities. Mound 12 (992 m)
Remarks. An undescribed species. Associated with experimentally deployed wood and pig bones.
Pectinereis strickrotti Villalobos-Guerrero, Huč, Tilic, Hiley & Rouse, 2024
Fig.
Reference.
Material examined. AD4984: A9889.
Localities. Mound 12 (996–1010 m).
Distribution. Known only from the CRM seeps.
Remarks. Known from epitokous males, all collected while swimming just above the seafloor, and from a fragment of an atokous infaunal female recovered from a push core sample (
Sphaerephesia sp. SIO_BIC_A10069
Fig.
Material examined. S0214: A10069 (PQ449261; no voucher remaining).
Localities. Jacó Scar (1875 m).
Remarks. Associated with a naturally occurring wood fall. The closest COI BLASTN result on GenBank was a specimen of Sphaerephesia cf. discolis (Borowski, 1994) from the Brazilian Basin, 5180 m (KR019875.1, 95.39% identity, formerly Sphaerodoropsis cf. discolis) (
Sphaerodoropsis sp. SIO_BIC_A10068
Fig.
Material examined. S0214: A10068 (PQ449260).
Localities. Jacó Scar (1875 m).
Remarks. Associated with a naturally occurring wood fall.
These specimens will be further examined and compared to other eastern Pacific Lacydonia in a separate work.
Lacydonia sp. SIO_BIC_A1432
Fig.
Material examined. AD4504: A1525, A1526; AD4510: A1432.
Localities. Jacó Summit (~ 741–744 m), Mound 11 (~ 1004–1011 m).
Remarks. An undescribed species.
Lacydonia sp. SIO_BIC_A1606
Material examined. AD4510: A1606.
Localities. Jacó Summit (~ 741–744 m).
Remarks. An undescribed species.
Lacydonia sp. SIO_BIC_A9774
Fig.
Annelida: Lacydoniidae and Phyllodocidae, representative live images A Lacydonia sp. SIO_BIC_A9774 (A9774) B Eulalia sp. SIO_BIC_A1383 (A1383, wide view) C Eulalia sp. SIO_BIC_A1383 (A1383, anterior detail) D Galapagomystides patricki (A9934) E Galapagomystides verenae (A10044) F Phyllodoce sp. SIO_BIC_A1469 (A1469) G Phyllodoce sp. SIO_BIC_A8454 (A8454, wide view) H Phyllodoce sp. SIO_BIC_A8454 (A8454, anterior detail). Scale bars: 1 mm.
Material examined. AD4588: A1925; AD4978: A9774; AD4990: A9880; S0217: A10090 (MZ562520).
Localities. The Thumb (~ 940–1070 m), Mound 12 (~ 996–999 m), Parrita Seep (1401 m).
Remarks. An undescribed species.
Lacydonia sp. SIO_BIC_A16347
Material examined. AD4504: A16347.
Localities. Mound 11 (~ 1004–1011 m).
Remarks. An undescribed species.
Eulalia sp. SIO_BIC_A1383
Fig.
Material examined. AD4506: A1383 (PQ449278).
Localities. Parrita Seep (~ 1030–1179 m).
Galapagomystides patricki Pearson & Rouse, 2022
Fig.
Reference.
Localities. Parrita Seep (~ 1401–1419 m; type locality), Jacó Scar (1762–1785 m).
Distribution. Known only from the CRM seeps and vicinity. One paratype was collected from a multicore sample ca 21 km northwest of Parrita Seep, at 805 m depth (Cruise AT15-44, Multicore 17: 9.1713, -84.7459) (
Remarks. Some specimens were associated with empty vestimentiferan tubes (
Galapagomystides verenae (Blake & Hilbig, 1990)
Fig.
Reference.
Localities. Mound 12 (~ 984–997 m), Parrita Seep (~ 1400–1410 m), Jacó Scar (~ 1632–1908 m).
Distribution. Originally described from vents on the Juan de Fuca and Explorer Ridges, 1545–2195 m (
Remarks. At the CRM seeps, G. verenae is associated with the tubes of juvenile Escarpia spicata and may feed on the blood of vestimentiferans (
Phyllodoce sp. SIO_BIC_A1469
Fig.
Material examined. AT15-44 MC1-2: A1469 (PQ449283).
Localities. Near Mound 12 (1019 m).
Remarks. This specimen was collected in a sediment core adjacent to Mound 12, ca 500 m from known sites of active seepage and likely representing the far-transition zone to the surrounding environment.
Phyllodoce sp. SIO_BIC_A8454
Fig.
Material examined. AD4505: A1366; AD4508: A1399; AD4922: A8454 (PQ449312); AD4975: A9795; AD4978: A9798 (PQ449326).
Localities. Mound 12 (~ 964–1009 m), Mound 11 (~ 1019–1025 m), Parrita Seep (~ 1401–1419 m).
Phyllodocidae sp. SIO_BIC_A10054
Fig.
Annelida: Phyllodocidae, Paralacydonia, Eunicidae, and Onuphidae, representative live images A Phyllodocidae sp. SIO_BIC_A10054 (A10054) B Sige sp. SIO_BIC_A8263 (A8263) C Sige sp. SIO_BIC_A8263 (A8356) D Sige sp. SIO_BIC_A8430 (A8430) E Paralacydonia stet. (A1412, wide view) F Lumbrineridae stet. (A1370) G Eunicidae stet. (A1431) H Hyalinoecia stet. (A10060). Scale bars: 1 mm (A–G); 1 cm (H)
Material examined. S0212: A10054 (PQ449256).
Localities. Jacó Scar (~ 1780–1860 m).
Sige sp. SIO_BIC_A8263
Fig.
Material examined. AD4906: A8263 (PQ449290); AD4912: A8356 (PQ449301).
Localities. Mound 12 (1002 m), Jacó Scar (~ 1795–1859 m).
Sige sp. SIO_BIC_A8430
Fig.
Material examined. AD4907: A8284 (PQ449292); AD4922: A8430 (PQ449311).
Localities. Mound 12 (~ 990–1002 m).
Remarks. A8430 was associated with a naturally occurring wood fall.
Paralacydonia stet.
Fig.
Material examined. AD4509: A1412.
Localities. Jacó Scar (1855 m).
Lumbrineridae stet.
Fig.
Material examined. AD4505: A1370 (PQ448999).
Localities. Mound 11 (~ 1019–1025 m).
Eunicidae stet.
Fig.
Material examined. AD4510: A1431; AD4914: A8386; AD4985: A9895 (PQ449332).
Localities. Mound 12 (991 m), Jacó Summit (741 m), Jacó Scar (1798 m).
Remarks. The closest COI BLASTN result on GenBank was Leodice antarctica (Baird, 1869) (GQ497532.1, 92.64% identity, formerly Eunice antarctica), known from Antarctic and sub-Antarctic waters (
Hyalinoecia stet.
Fig.
Material examined. AD4510: A1440; S0214: A10060 (PQ449259).
Localities. Jacó Summit (~ 741–744 m), Jacó Scar (1875 m).
Ophryotrocha cf. batillus Wiklund et al., 2012
Fig.
Annelida: Dorvilleidae: Ophryotrocha, representative live images A Ophryotrocha cf. batillus (A9610) B Ophryotrocha cf. flabella (A1410) C Ophryotrocha cf. platykephale (A9878) D Ophryotrocha sp. SIO_BIC_A8367 (A8367) E Ophryotrocha sp. SIO_BIC_A9611 (A9611) F Ophryotrocha sp. SIO_BIC_A9723 (A9723) G Ophryotrocha sp. SIO_BIC_A9800 (A9800) H Ophryotrocha sp. SIO_BIC_A10052 (A10052). Scale bars: 1 mm.
Material examined. AD4974: A9610 (MT444001).
Localities. Mound 12 (992 m).
Remarks. Associated with experimentally deployed wood. To be discussed in a forthcoming study. Ophryotrocha batillus was originally described from whale falls and wood falls off southern California, 960–1960 m (
Ophryotrocha cf. flabella Wiklund et al., 2012
Fig.
Material examined. AD4509: A1410 (MT435616); AD4988: A9928 (MT435618; no specimen remaining), A9929 (MT435617).
Localities. Mound 11 (1010 m), Jacó Slope (1064 m).
Remarks. To be discussed in a forthcoming study. Ophryotrocha flabella was originally described from whale falls off southern California, 960–1960 m (
Ophryotrocha cf. platykephale Blake, 1985
Fig.
Material examined. AD4990: A9878 (MT435620).
Localities. Parrita Seep (~ 1400–1435 m).
Remarks. To be discussed in a forthcoming study. Ophryotrocha platykephale was originally described from sedimented vents at 2000–2030 m in the Guaymas Basin, Gulf of California (
Ophryotrocha sp. SIO_BIC_A8367
Fig.
Material examined. AD4914: A8367 (PQ449305).
Localities. Jacó Scar (~ 1632–1886 m).
Remarks. Likely an undescribed species.
Ophryotrocha sp. SIO_BIC_A9611
Fig.
Material examined. AD4974: A9611 (PQ449317).
Localities. Mound 12 (992 m).
Remarks. An undescribed species, associated with experimentally deployed bone and wood.
Ophryotrocha sp. SIO_BIC_A9723
Fig.
Material examined. AD4976: A9723 (PQ449322).
Localities. Jacó Scar (1887 m).
Remarks. Likely an undescribed species. Associated with experimentally deployed wood.
Ophryotrocha sp. SIO_BIC_A9800
Fig.
Material examined. AD4912: A8354; AD4913: A8360; AD4978: A9800 (MT435612).
Localities. Mound 12 (999 m), Jacó Scar (~ 1795–1859 m).
Remarks. An undescribed species.
Ophryotrocha sp. SIO_BIC_A10052
Fig.
Material examined. S0213: A10052 (MT435579).
Localities. Jacó Summit (~ 730–820 m).
Remarks. An undescribed species.
Ophryotrocha sp. SIO_BIC_A10084
Fig.
Annelida: Dorvilleidae and Myzostomida, representative live images A Ophryotrocha sp. SIO_BIC_A10084 (A10084) B Ophryotrocha sp. SIO_BIC_A10106 (A10106) C Ophryotrocha sp. SIO_BIC_ A10114 (A10114) D Parougia ceruleibohnorum (A1446) E Parougia cf. billiemiroae (A9678) F Parougia cf. sulleyi (A1333) G Parougia theloniousblueski (A1337) H Eenymeenymyzostoma sp. SIO_BIC_A8428 (A8428, dorsal view). Scale bars: 1 mm.
Material examined. S0217: A10084 (MT435566),
Localities. Rio Bongo Scar (610 m), The Thumb (1072 m).
Remarks. An undescribed species.
Ophryotrocha sp. SIO_BIC_A10106
Fig.
Material examined. S0219: A10106 (PQ449268).
Localities. Rio Bongo Scar (661 m).
Remarks. An undescribed species associated with a naturally occurring wood fall.
Ophryotrocha sp. SIO_BIC_ A10114
Fig.
Material examined. S0219: A10114 (MT435596),
Localities. Rio Bongo Scar (~ 480–650 m).
Remarks. An undescribed species to be described in a forthcoming study.
Parougia ceruleibohnorum Yen & Rouse, 2020
Fig.
Reference.
Localities. Mound 12 (996 m), Parrita Seep (~ 1401–1419 m; type locality).
Distribution. Known only from the CRM seeps.
Parougia cf. billiemiroae Yen & Rouse, 2020
Fig.
Reference.
Localities. Jacó Scar (1796 m).
Remarks. Parougia billiemiroae sensu stricto is found at seeps, 587–1583 m, from Hydrate Ridge off Oregon (type locality) to the Guaymas Basin, Gulf of California (
Parougia cf. sulleyi Yen & Rouse, 2020
Fig.
Reference.
Localities. Mound 12 (~ 987–997 m).
Remarks. P. sulleyi sensu stricto is found at seeps, 600–1600 m, from Hydrate Ridge off Oregon to the Guaymas Basin, Gulf of California (type locality) (
Parougia theloniousblueski Yen & Rouse, 2020
Fig.
Reference.
Localities. Mound 12 (987–997 m), Mound 11 (1010 m; type locality).
Distribution. Known only from the CRM seeps.
Eenymeenymyzostoma sp. SIO_BIC_A8428
Figs
Annelida: Myzostomida, Nerillidae, and Sabellidae, representative live images A Eenymeenymyzostoma sp. SIO_BIC_A8428 (A8428, ventral view) B Myzostoma josefinae (A8362) C Pulvinomyzostomum inaki (A1579, dorsal and ventral views of female with dwarf males) D Pulvinomyzostomum sp. SIO_BIC_A8361 (A8361, dorsal and ventral views of female) E Pulvinomyzostomum sp. SIO_BIC_A8361 (A8361, dorsal and ventral views of male) F Nerillidae stet. (A9797) G Bispira sp. SIO_BIC_A9587 (A1396) H Bispira sp. SIO_BIC_A9587 (A1460, in tubes attached to rocks photographed ex situ in the shipboard laboratory). Scale bars: 1 mm.
Material examined. AD4501: A1476; AD4503: A1340; AD4922: A8427 (PQ449309), A8428, A8431.
Localities. Mound 12 (~ 966–995 m).
Remarks. An undescribed species associated with the antipatharian coral Lillipathes ritamariae.
Myzostoma josefinae Summers & Rouse in Summers et al. 2014
Fig.
Material examined. AD4913: A8362.
Localities. Jacó Scar (1878 m).
Distribution. Originally described from a whale fall at 1020 m in Monterey Submarine Canyon, off California (type locality) and in the vicinity of sedimented vents and seeps at ~ 1350 m in the Guaymas Basin, Gulf of California (
New records. The CRM specimen represents a new southern record and a new maximum depth record for this species.
Remarks. The specimen, showing the distinctive paired elongate caudal appendages, was associated with the crinoid Psathyrometra cf. fragilis (E7034), consistent with previous records of M. josefinae on P. fragilis (
Pulvinomyzostomum inaki Summers & Rouse in Summers et al. 2014
Fig.
Reference.
Localities. Jacó Scar (1789 m; type locality).
Distribution. Known only from the CRM seeps.
Remarks. Associated with an antedonid crinoid (E4399) (
Pulvinomyzostomum sp. SIO_BIC_A8361
Fig.
Material examined. AD4913: A8361 (PQ449303).
Localities. Jacó Scar (1878 m)
Remarks. An undescribed species. One female and one male were associated with the crinoid Psathyrometra cf. fragilis (E7034).
Nerillidae stet.
Fig.
Material examined. AD4979: A9797.
Localities. Quepos Slide (~ 380–395 m).
Bispira sp. SIO_BIC_A9587
Figs
Annelida: Sabellidae and Serpulidae, representative live images A Bispira sp. SIO_BIC_A9587 (A9587) B Chone sp. SIO_BIC_A8422 (A8422) C Chone sp. SIO_BIC_A8462 (A8462) D Jasmineira stet. (A8282) E Pseudopotamilla sp. SIO_BIC_A1455 (A1455) F Pseudopotamilla sp. SIO_BIC_A9732 (A9732) G Sabellidae sp. SIO_BIC_ A8286 (A8286) H Hyalopomatus sp. SIO_BIC_A1434 (A1434). Scale bars: 1 cm (A); 1 mm (B–H).
Reference.
Material examined. AD4508: A1396; AD4513: A1460 (PQ449282; 18S: PQ304645); AD4916: A8387; AD4971: A9587.
Localities. Parrita Seep (1402 m; this study), Jacó Scar (~ 1604–1854 m).
Remarks. An undescribed species, abundant at zones of active seepage and utilizing methanotrophic bacterial symbionts for nutrition (
Chone sp. SIO_BIC_A8422
Fig.
Material examined. AD4918: A8419; AD4919: A8422.
Localities. Quepos Slide (~ 379–410 m).
Remarks. Likely an undescribed species (María Ana Tovar-Hernández, pers. comm. 8 August 2020).
Chone sp. SIO_BIC_A8462
Fig.
Material examined. AD4916: A8389; AD4919: A8462 (16S: PQ304651).
Localities. Parrita Seep (~ 1400–1410 m), Jacó Scar (1746 m).
Remarks. Likely an undescribed species (María Ana Tovar-Hernández, pers. comm. 8 August 2020).
Jasmineira stet.
Fig.
Material examined. AD4907: A8282.
Localities. Mound 12 (999 m).
Pseudopotamilla sp. SIO_BIC_A1455
Fig.
Material examined. AD4512: A1455; AD4918: A8418; AD4979: A9796.
Localities. Quepos Slide (~ 338–411 m).
Remarks. An undescribed species.
Pseudopotamilla sp. SIO_BIC_A9732
Fig.
Material examined. AD4978: A9732.
Localities. Mound 12 (~ 996–999 m).
Sabellidae sp. SIO_BIC_A8286
Fig.
Material examined. AD4908: A8286 (18S: PQ304646), A8287.
Localities. Mound 12 (1000 m).
Hyalopomatus sp. SIO_BIC_A1434
Fig.
Reference.
Material examined. AD4510: A1434.
Localities. Jacó Summit (741–745 m).
Remarks. Possibly an undescribed species (
Laminatubus joycebrooksae Rouse & Kupriyanova, 2021
Fig.
Annelida: Serpulidae, Spionidae, and Opheliidae, representative live images A Laminatubus joycebrooksae (A1315) B Laminatubus paulbrooksi (
Reference.
Localities. Mound 12 (~ 1000 m; type locality).
Distribution. Known only from the CRM seeps.
Laminatubus paulbrooksi Rouse & Kupriyanova, 2021
Fig.
Reference.
Localities. Parrita Seep (1402 m), Jacó Scar (~ 1800 m; type locality).
Distribution. Also known from seeps in the Guaymas Basin and Pescadero Basin, Gulf of California, 1565–2478 m (
Remarks. Abundant at zones of active seepage, this species utilizes methanotrophic bacterial symbionts for nutrition (
Protis stet.
Material examined. AD4506: A1553 (18S: PQ304668; no image available).
Localities. Parrita Seep (1186 m).
Remarks. We thank Elena Kupriyanova (Australian Museum Research Institute) for generating the 18S sequence.
Spirorbinae stet.
Fig.
Material examined. AD4507: A1385.
Localities. Parrita Scar (~ 1659–1667 m).
Aonides sp. SIO_BIC_A1344
Fig.
Material examined. AD4503: A1344; AD4505: A1372,
Localities. Mound 12 (~ 967–995 m), Mound 11 (~ 1019–1025 m).
Remarks. An undescribed species to be described in a forthcoming study.
Lindaspio dibranchiata Blake & Maciolek, 1992
Fig.
Material examined. AD4511: A1453 (PQ449281); AD4972: A9601 (PQ449316); S0213: A10053 (PQ449255).
Localities. Jacó Summit (~ 730–820 m), Mound 12 (989 m), Jacó Scar (~ 1791–1800 m).
Distribution. Originally described from sedimented vents in the Guaymas Basin, Gulf of California, 2004–2008 m (
New records: The CRM specimens represent new southern records, the first records from seeps, and, for specimen A10053, a new minimum depth for this species (820 m as the most conservative value). The COI sequences for the Costa Rica specimens were identical to that of a specimen from the type locality: A3258 (PQ432663) from 1581 m at Pinkie’s "Vent", Guaymas Basin.
Prionospio stet.
Fig.
Material examined. AD4509: A1415; AD4979: A9809.
Localities. Quepos Slide (393 m), Jacó Scar (1855 m).
Remarks. These specimens are members of the Prionospio complex; the shape of the head of A1415 is consistent with Apoprionospio, but some sources place this genus into synonymy with Prionospio (Vasily Radashevsky, pers. comm. 8 July 2021).
Opheliidae stet.
Fig.
Material examined. AD4971: A9651; AD4972: A9596; AD4977: A9730; AD4989: A9938 (PQ449337).
Localities. Jacó Scar (1783–1796 m).
Remarks. A9651 likely represents an undescribed species of Ophelina (Sergio Salazar-Vallejo, pers. comm. 12 February 2020).
Ophelina sp. 3 sec.
Fig.
Reference.
Localities. Mound 12 (~ 990–996 m).
We refer to the clade formerly known as Echiura using the revised taxonomy of
Prometor stet.
Fig.
Annelida: Thalassematidae, Capitellidae, Scalibregmatidae, Maldanidae, and Ampharetidae, representative live images A Prometor stet. (A9638) B Capitellidae stet. (A1418) C Scalibregma stet. (A1391) D Travisia stet. (A1386) E Nicomache cf. lokii (A8257) F Notoproctus sp. SIO_BIC_A9801 (A9801) G Notoproctus sp. SIO_BIC_A9802 (A9802) H Ampharetini stet. (A1377). Scale bars: 1 mm (A–C, E–H); 1 cm (D).
Material examined. AD4971: A9638 (PQ449318).
Localities. Jacó Scar (1824 m).
Capitellidae stet.
Fig.
Material examined. AD4506: A1376; AD4508: A1403; AD4509: A1418; AD4976: A9755 (16S: PQ304666).
Localities. Parrita Seep (~ 1186–1419 m), Jacó Scar (~ 974–1887 m).
Remarks. Associated with vesicomyid clams (A1376, A1418), Lamellibrachia barhami (A1403), or experimentally deployed wood (A9755).
Scalibregma stet.
Fig.
Material examined. AD4507: A1391 (PQ449279); AD4914: A8385.
Localities. Parrita Scar (~ 1659–1667 m), Jacó Scar (1886 m).
Travisia stet.
Fig.
Material examined. AD4507: A1386.
Localities. Parrita Scar (~ 1659–1663 m).
Nicomache cf. lokii Kongsrud & Rapp, 2012
Fig.
Material examined. AD4504: A1350 (PQ450403); AD4509: A1420 (PQ450404); AD4906: A8257; AD4911: A8295.
Localities. Mound 11 (~ 1002–1011 m), Mound 12 (995–1001 m), Jacó Scar (~ 974–1856 m).
Remarks. The closest COI BLASTN results on GenBank were sequences of Nicomache lokii (95.03–98.17% identity to A1350, 95.18–98.31% identity to A1420), and the closest matches (MG975502.1, FR877578.1) were from the type locality of the Loki’s Castle vent system on the Arctic Mid-Ocean Ridge at 2350 m (
Notoproctus sp. SIO_BIC_A9801
Fig.
Material examined. AD4978: A9801 (PQ449327).
Localities. Mound 12 (997 m).
Remarks. This specimen showed a COI difference of 19.1% (uncorrected) from A9802 (below) so we regard them as separate species.
Notoproctus sp. SIO_BIC_A9802
Fig.
Material examined. AD4978: A9802 (PQ449328).
Localities. Mound 12 (997 m).
Ampharetini stet.
Fig.
Material examined. AD4506: A1377 (PQ450382).
Localities. Parrita Seep (1030 m).
Amphisamytha fauchaldi Solís-Weiss & Hernández-Alcántara, 1994
Fig.
Annelida: Ampharetidae, Trichobranchidae, and Terebellidae, representative live images A Amphisamytha fauchaldi (A8352) B Grassleia cf. hydrothermalis (A12401) C Pavelius sp. EP-B sec.
References.
Additional material examined. AD4906: A8260 (PQ449288, PQ449289); AD4912: A8352 (PQ449299, PQ449300); AD4913: A8358 (PQ449302); AD4914: A12602 (PQ449273).
Localities. Mound 12 (~ 1000 m), Jacó Scar (~ 1800 m).
Distribution. Originally described from sedimented hydrothermal vents at 2000 m in the Guaymas Basin, Gulf of California (
Grassleia cf. hydrothermalis Solís-Weiss, 1993
Fig.
Material examined. AD4510: A12401 (PQ449272).
Localities. Jacó Summit (744 m).
Remarks. The closest COI BLASTN result on GenBank was a specimen identified as Grassleia cf. hydrothermalis from seeps at 1572–1583 m in the Guaymas Basin, Gulf of California (KX497032.1, 96.51% identity). Grassleia hydrothermalis was described from vents at the Escabana Trough, Gorda Ridge, off northern California, at 3271 m (
Pavelius sp. EP-B sec.
Fig.
Material examined. AD4586: A1887 (PQ449284); AD4587: A1894 (PQ449285).
Localities. Mound 12 (~ 982–998 m).
Remarks. The CRM specimens represent records of an undescribed species also reported from seeps at Hydrate Ridge off Oregon, 809 m, as cited in supplementary table S2 of
Terebellides stet.
Fig.
Material examined. AT15-44 MC1-2: A1293.
Localities. Near Mound 12 (1019 m).
Remarks. This specimen was collected in the upper 1 cm of a sediment core adjacent to Mound 12, ca 500 m from known sites of active seepage and likely representing the far-transition zone to the surrounding environment.
Biremis sp. SIO_BIC_A10093
Fig.
Material examined. S0218: A10091, A10092, A10093.
Localities. Parrita Scar (1110–1470 m).
Remarks. An undescribed species.
Polycirrus stet.
Fig.
Material examined. S0219: A10067, A10097, A10115 (PQ449270).
Localities. Rio Bongo Scar (609–659 m).
Remarks. These specimens were buried or partially buried in soft sediments with tentacles extended.
Eupolymnia cf. heterobranchia (Johnson, 1901)
Fig.
Material examined. AD4906: A8259 (PQ449287); AD4910: A8280 (PQ449291), A8296 (PQ449294), A8297 (PQ450386); AD4911: A8299 (PQ449295), A8301 (PQ449296).
Localities. Mound 12 (998–1002 m), Jacó Scar (1758 m).
Remarks. Likely an undescribed species, with morphological similarity to Eupolymnia heterobranchia, known from shallow waters from Alaska to Mexico (
The CRM specimens appeared to show genetic structure between Mound 12 and Jacó Scar, with 3.2–3.6% COI divergence (uncorrected, corresponding to 17–19 bp) between localities and a maximum divergence of only < 0.2% (1 bp) within localities (Fig.
Neoamphitrite cf. hydrothermalis Reuscher, Fiege & Wehe, 2012
Fig.
Annelida: Terebellidae, Melinnidae, and Cirratulidae, representative live images A Neoamphitrite cf. hydrothermalis (A1351) B Neoamphitrite cf. robusta (A1456) C Melinnopsis cf. armipotens (A12604, in situ, tentacle protruding from the tube extending from the sediment and covered with hydroids, Co3088). Credit: ROV SuBastian/Schmidt Ocean Institute D Melinnopsis cf. armipotens (A12604) E Aphelochaeta sp. SIO_BIC_A1380 (A1380) F Aphelochaeta sp. SIO_BIC_A1380 (A1429) G Aphelochaeta sp. SIO_BIC_A9729 (A9729) H Chaetozone sp. SIO_BIC_A9846 (A9846). Scale bars: 1 mm (A, B, E–H); 1 cm (D).
Material examined. AD4504: A1351 (PQ450387).
Localities. Mound 11 (1010 m).
Remarks. Likely an undescribed species, morphologically similar to Neoamphitrite hydrothermalis, which is known from western Pacific hydrothermal vents in the Lihir Basin, 1474–1480 m (
Neoamphitrite cf. robusta (Johnson, 1901)
Fig.
Material examined. AD4512: A1456 (PQ450389); AD4588: A2150 (PQ449286).
Localities. Quepos Slide (400 m), Mound 12 (~ 995–997 m).
Remarks. Likely an undescribed species. Morphologically similar to Neoamphitrite robusta, which was described from shallow water in Puget Sound (
Melinnopsis cf. armipotens (Moore, 1923)
Fig.
Material examined. S0220: A12604 (PQ449274).
Localities. Subduction Plume (3502 m).
Remarks. The tubes of these animals protruded above the sediment and were encrusted with Candelabrum hydroids (Co3088). They warrant comparison to Melinnopsis armipotens, known only from southern California, 4075 m (
We thank Jim Blake (Aquatic Research & Consulting) for morphological identification of these specimens. These specimens will be further discussed in a separate work.
Aphelochaeta sp. SIO_BIC_A1380
Fig.
Material examined. AD4506: A1380 (PQ449000), AD4510: A1429.
Localities. Jacó Summit (741 m), Parrita Seep (1186 m).
Aphelochaeta sp. SIO_BIC_A9729
Fig.
Material examined. AD4977: A9729 (PQ449323).
Localities. Jacó Scar (1783 m).
Remarks. Likely an undescribed species.
Chaetozone sp. SIO_BIC_A9846
Fig.
Material examined. AD4987: A9846 (PQ449331).
Localities. Mound 12 (999 m).
Remarks. An undescribed species.
Cirratulus stet.
Fig.
Annelida: Cirratulidae and Flabelligeridae, representative live images A Cirratulus stet. (A1435) B Raricirrus cf. maculatus (A1342) C Macrochaeta stet. (A8420) D Bradabyssa cf. pilosa (A9902) E Bradabyssa sp. SIO_BIC_A1356 (A1356) F Flabelligera cf. bophortica (A9751) G Lamispina polycerata (
Material examined. AD4510: A1435 (PQ449280); AD4912: A8303 (PQ449297); AD4973: A9677 (PQ449320); AD4989: A9907 (PQ449334), A9962 (PQ449339); S0213: A10051 (PQ449254).
Localities. Jacó Summit (~ 741–744 m), Jacó Scar (~ 1768–1811 m).
Remarks. Multiple species may be represented.
Raricirrus cf. maculatus Hartman, 1961
Fig.
Material examined. AD4503: A1342 (PQ449276).
Localities. Mound 12 (990 m).
Remarks. Possibly Raricirrus maculatus, described from southern California, 46–70 m (
Macrochaeta stet.
Fig.
Material examined. AD4512: A1457; AD4918: A8420 (PQ449307); AD4985: A9854.
Localities. Quepos Slide (~ 338–411 m), Mound 12 (~ 995–1002 m).
We thank Sergio Salazar-Vallejo (El Colegio de la Frontera Sur) for morphological identification of these specimens.
Bradabyssa cf. pilosa (Moore, 1906)
Fig.
Material examined. AD4987: A9840 (PQ449330), A9902 (PQ449333).
Localities. Mound 12 (1010–1012 m).
Remarks. B. pilosa has been recorded from Alaska (type locality, 362–573 m) to Baja California, 40–1800 m, including seeps off Oregon and southern California (
Bradabyssa sp. SIO_BIC_A1356
Fig.
Material examined. AD4504: A1356 (PQ449277); AD4590: A1962 (PQ450390).
Localities. Mound 11 (~ 1004–1011 m), Jacó Scar (~ 1791–1800 m).
Flabelligera cf. bophortica Annenkova-Chlopina, 1924
Fig.
Material examined. AD4512: A1458; AD4976: A9751 (PQ449324).
Localities. Quepos Slide (~ 344–411 m), Jacó Scar (1887 m).
Remarks. These specimens resemble F. bophortica, which was described from the Chukchi Sea, Arctic Ocean, 13–48 m (
Lamispina polycerata Salazar-Vallejo, 2020
Fig.
Reference.
Localities. Mound 12 (999 m; type locality).
Distribution. Known only from the CRM seeps.
Saphobranchia canela Salazar-Vallejo, 2020
Fig.
Reference.
Localities. Mound 12 (~ 987–997 m; type locality), Jacó Scar (1785 m).
Distribution. Known only from the CRM seeps.
Remarks. S. canela is distinguished from S. ilys and S. omorpha based on morphology, but genetic data do not corroborate the delineation of three species, as acknowledged in the original description (
Annelida: Flabelligeridae, Paraonidae, and Sternaspidae, representative live images A haplotype network of COI sequences from the descriptions of Saphobranchia canela, S. ilys, and S. omorpha B Saphobranchia ilys (
Saphobranchia ilys Salazar-Vallejo, 2020
Fig.
Reference.
Localities. Jacó Scar (1783–1784 m; type locality).
Distribution. Known only from the CRM seeps.
Saphobranchia omorpha Salazar-Vallejo, 2020
Fig.
Reference.
Localities. Jacó Scar (1795 m; type locality).
Distribution. Known only from the CRM seeps.
Aricidea mirifica Strelzov, 1973
Fig.
Reference.
Material examined. AT15-44 MC1-2: A1464.
Localities. Near Mound 12 (1019 m).
Distribution. Also reported from shallow Pacific waters of Costa Rica, 18–26 m, as well as the eastern and western Pacific and Antarctic (
Remarks. This specimen was collected in a sediment core adjacent to Mound 12, ca 500 m from known sites of active seepage and likely representing the far-transition zone to the surrounding environment.
Aricidea rubra Hartman, 1963
Fig.
Reference.
Material examined. AD4511: A1616; S0213: A10049 (PQ449252).
Localities. Jacó Summit (~ 730–820 m; this study), Mound 12 (988 m).
Distribution. Originally described from submarine canyons in southern California, 603–1298 m (
Aricidea sp. A sec.
Fig.
Reference.
Material examined. AD4591: A1970.
Localities. Jacó Scar (~ 1752–1795 m).
Remarks. This specimen is an epitoke.
Sternaspis stet.
Fig.
Reference.
Material examined. AT15-44 MC1-2: A1473 (16S: MK810080; 18S: MK809977); AD4989: A9943, A9945 (PQ449338), A9948.
Localities. Near Mound 12 (1019 m), Jacó Scar (1762 m; this study).
Remarks. Based on 16S and 18S sequences, specimen A1473 is phylogenetically distinct from its closest reported relative, the Antarctic species Sternaspis sendalli Salazar-Vallejo, 2014 (
Escarpia spicata Jones, 1985
Fig.
Annelida: Siboglinidae and Orbiniidae, representative live images A Escarpia spicata (A8364) B Lamellibrachia barhami (A1564, incomplete specimens) C Lamellibrachia donwalshi (A8382) D Osedax frankpressi (A9592) E Osedax frankpressi (A9594, in bone) F Osedax knutei (A9617) G Siboglinum stet. (A8349) H Leitoscoloplos sp. SIO_BIC_A9939 (A9939). Scale bars: 1 cm (A–C); 1 mm (D–H).
References.
Material examined. AD4503: A1343; AD4507: A1390 (PQ450388); AD4511: A1445; AD4513: A1463; AD4590: A1826; AD4591: A1838; AD4914: A8364; AD4924: A8464; AD4971: A9618, A9619, A9620, A9621, A9622, A9623, A9624, A9625, A9626, A9627; AD4987: A9901; S0217: A10089; S0230: A10172.
Localities. Mound 12 (~ 1000 m), The Thumb (1074 m; this study), Parrita Seep (~ 1400 m), Parrita Scar (~ 1600 m; this study), Jacó Scar (~ 1800 m), Mound Jaguar (1909 m; this study).
Distribution. Originally described from seeps at 1829 m in the San Clemente Basin off California (
Remarks. The three described species of Escarpia (E. laminata Jones, 1985; E. southwardae Andersen et al., 2004; E. spicata Jones, 1985) are morphologically distinguishable with separate geographic ranges (
Lamellibrachia barhami Webb, 1969
Fig.
References.
Localities. Parrita Seep (~ 1400 m), Jacó Scar (~ 1800–1890 m), Parrita Scar (~ 2200 m).
Distribution. Originally described from seeps at 1125 m off southern California (
Lamellibrachia donwalshi McCowin & Rouse, 2018
Fig.
Reference.
Localities. Mound 12 (~ 1000 m; type locality), Mound 11 (~ 1040 m).
Distribution. Known only from the CRM seeps.
Osedax frankpressi Rouse, Goffredi & Vrijenhoek, 2004
Fig.
Reference.
Material examined. AD4972: A9591 (OM994442), A9592 (OM994444), A9593 (OM994443), A9594 (OM994445).
Localities. Jacó Scar (1845 m).
Distribution. Originally described from Monterey Submarine Canyon off California (
Remarks. Collected from experimentally deployed pig bones.
Osedax knutei Rouse, Goffredi, Johnson & Vrijenhoek, 2018
Fig.
Reference.
Material examined. AD4974: A9617 (ON041090).
Localities. Mound 12 (992 m).
Distribution. Monterey Submarine Canyon off California (type locality) to the CRM, 845–2898 m (
Remarks. Collected from experimentally deployed pig or cow bones.
Siboglinum stet.
Fig.
Material examined. AD4911: A8349 (PQ449298); AD4916: A8388; AD4989: A9942.
Localities. Jacó Scar (~ 1757–1892 m).
Remarks. Collected from sediment cores, except for A8349 which was associated with a rock substrate. The occurrence of a field of frenulate siboglinids at Jacó Scar was noted by
Leitoscoloplos sp. SIO_BIC_A9939
Fig.
Material examined. AD4989: A9939.
Localities. Jacó Scar (1785 m).
Remarks. This single damaged specimen likely represents an undescribed species (Jim Blake, pers. comm. 7 October 2019).
Cossura stet.
Fig.
Annelida: Cossura, Amphinomidae, Sipuncula, and Chaetopteridae, representative live images A Cossura stet. (A1388) B Amphinomidae stet. (A10107) C Amphinominae sp. SIO_BIC_A1379 (A1379) D Archinome levinae (A1398) E Sipuncula sp. SIO_BIC_A9803 (A9803) F Sipuncula sp. SIO_BIC_A9839 (A9839) G Phyllochaetopterus sp. 6 sec.
Material examined. AD4507: A1388; AD4988: A9922.
Localities. Mound 11 (~ 1005–1025 m), Parrita Scar (~ 1659–1663 m).
Amphinomidae stet.
Fig.
Material examined. S0219: A10107 (PQ449269).
Localities. Rio Bongo Scar (661 m).
Remarks. The COI sequence did not closely match any available GenBank reference sequences (<82% identity).
Amphinominae sp. SIO_BIC_A1379
Fig.
Material examined. AD4506: A1379 (PQ300673).
Localities. Parrita Seep (1186 m).
Remarks. An undescribed genus and species. We thank Liz Borda (Texas A&M University San Antonio) for providing the COI sequence.
Archinome levinae Borda, Kudenov, Chevaldonné, Blake, Desbruyères, Fabri, Hourdez, Pleijel, Shank, Wilson, Schulze & Rouse, 2013
Fig.
Reference.
Localities. Mound 12 (~ 1000 m), Mound 11 (~ 1040 m; type locality), Parrita Seep (1402 m), Jacó Scar (~ 1800 m).
Distribution. Also known from vents in the Guaymas Basin, Gulf of California, ~ 2400 m (
Sipuncula sp. SIO_BIC_A9803
Fig.
Material examined. AD4978: A9803 (PQ449329).
Localities. Mound 12 (997 m).
Remarks. The closest COI BLASTN results on GenBank were an unidentified sipunculan from southern California (MK550656.1, 85.74% identity) and several golfingiids (~ 79–81% identity).
Sipuncula sp. SIO_BIC_A9839
Fig.
Material examined. AD4987: A9839 (PQ450416).
Localities. Mound 12 (1012 m).
Remarks. Collected near a naturally occurring wood fall. The closest COI BLASTN results on GenBank were Nephasoma abyssorum (Koren & Danielssen, 1876) (JN865109.1, 82.14% identity) and several other golfingiids (~ 78–79% identity).
Phyllochaetopterus sp. 6 sec. Moore et al. 2017
Fig.
Reference.
Material examined. AD4501: A1324 (PQ449275); AD4505: A1540 (KX896487); AD4508: A1394; S0217: A10085 (PQ449263).
Localities. Mound 11 (~ 1019–1025 m), Mound 12 (~ 984–997 m; this study), The Thumb (~ 940–1070 m; this study), Parrita Seep (1402 m; this study).
Remarks. An undescribed species.
Phyllochaetopterus sp. SIO_BIC_A8429
Fig.
Material examined. AD4922: A8429 (PQ449310); AD4988: A9916 (PQ449335), A9918 (PQ449336).
Localities. Mound 11 (1010 m), Mound 12 (1002 m).
Remarks. Associated with naturally occurring wood falls. Despite its sympatry with Phyllochaetopterus sp. 6 at Mound 12, this undescribed species is morphologically and genetically distinct, with a COI divergence of 14.89–15.41% from the previously published P. sp. 6 voucher SIO-BIC A1540 (KX896487.1). The closest COI BLASTN result on GenBank was an undescribed species of Spiochaetopterus from the East Pacific Rise (KX896501.1, voucher SIO-BIC A3619, 90.36–90.73% identity) (
We list higher-level taxonomy according to
Tubulanus cf. lutescens Cantell, 2001
Fig.
Nemertea, representative live images A Tubulanus cf. lutescens (N233) B Lineidae sp. SIO_BIC_N254 (N254) C Tetrastemma polyakovae (N258) D Tetrastemma sundbergi (N256) E Eumonostilifera sp. SIO_BIC_N109 (N109) F Alvinonemertes christianeae (N253) G Alvinonemertes dariae (N262) H Chernyshevia escarpiaphila (N266). Scale bars: 1 cm (A); 1 mm (B–H).
Reference.
Localities. Mound 11 (~ 1019–1025 m), Mound 12 (~ 982–998 m).
Remarks. Despite disparate geography and internal and external morphological differences, the CRM specimens show only 1.3% COI divergence from Tubulanus lutescens Cantell, 2001, known from shallow waters off Sweden, warranting further examination (
Lineidae sp. SIO_BIC_N254
Fig.
Reference.
Localities. Jacó Scar (1887 m).
Remarks. Associated with experimentally deployed wood. This single specimen (destroyed for DNA extraction) could not be attributed to a known genus and likely represents an undescribed species (
Tetrastemma polyakovae Sagorny, von Döhren, Rouse & Tilic, 2022
Fig.
Reference.
Localities. Mound 12 (~ 996–999 m; type locality).
Distribution. Known only from the CRM seeps.
Tetrastemma strandae Sagorny, von Döhren, Rouse & Tilic, 2022
Reference.
Localities. Jacó Scar (1885 m; type locality).
Distribution. Known only from the CRM seeps.
Tetrastemma sundbergi Sagorny, von Döhren, Rouse & Tilic, 2022
Fig.
Reference.
Localities. Mound 12 (~ 996–999 m; type locality).
Distribution. Known only from the CRM seeps.
Eumonostilifera sp. SIO_BIC_N109
Fig.
Reference.
Localities. Parrita Seep (~ 1401–1419 m).
Remarks. An undescribed species represented by a single specimen (
Alvinonemertes christianeae Sagorny, von Döhren, Rouse & Tilic, 2022
Fig.
Reference.
Localities. Jacó Scar (1887 m; type locality).
Distribution. Also reported from the non-seep seamount Quepos Plateau, 67 km south of Jacó Scar, at 2184 m depth.
Remarks. Associated with experimentally deployed or naturally occurring wood (
Alvinonemertes dariae Sagorny, von Döhren, Rouse & Tilic, 2022
Fig.
Reference.
Localities. Parrita Seep (1407 m; type locality).
Distribution. Known only from the CRM seeps.
Remarks. Associated with Paragorgia stet. (Co3054) (
Chernyshevia escarpiaphila Sagorny, von Döhren, Rouse & Tilic, 2022
Fig.
Reference.
Localities. Jacó Scar (~ 974–1856 m), Mound Jaguar (1909 m; type locality).
Distribution. Known only from the CRM seeps.
Remarks. Associated with the exterior surfaces and tubes of Escarpia spicata (
Platidia anomioides (Scacchi & Philippi in Philippi, 1844) sp. inc.
Fig.
Brachiopoda and Mollusca: Bivalvia: Nuculidae, Solemyidae, and Nuculanidae, representative live images A Platidia anomioides sp. inc. (B211, exterior view) B Platidia anomioides sp. inc. (B211, interior view) C Ennucula colombiana (M17879) D Ennucula stet. (M16966) E Nucula chrysocoma (M11989) F Acharax cf. johnsoni (M15768, adult specimen, opened) G Acharax cf. johnsoni (M17077, young specimen) H Nuculana cf. callimene (M17063). Scale bars: 1 mm (A–E, H); 1 cm (F, G).
Material examined. AD4512: B211; AD4979: M16876.
Localities. Quepos Slide (~ 380–395 m).
Remarks. We thank Sandra Carlson (University of California Davis) for the identification of these specimens as Platidia, most likely P. anomioides, which is considered cosmopolitan at depths 18–2190 m (
We list the major clades according to the phylogenetic relationships in
We list entries following the taxonomic arrangement in
Ennucula colombiana (Dall, 1908)
Fig.
Material examined. AD4588: M17879.
Localities. Mound 12 (997 m).
Distribution. Originally described from the Gulf of Panama, 54 m, and known from the Gulf of California to Peru, 11–734 m (
New records. The CRM specimen represents a new maximum depth record for this species.
Ennucula stet.
Fig.
Material examined. AD4988: M16966 (PQ449418).
Localities. Mound 11 (1010 m).
Remarks. This damaged juvenile specimen was associated with a naturally occurring wood fall. The closest COI BLASTN results on GenBank were nuculids: Ennucula cumingii (Hinds, 1843) (KC984750.1, 84.89% identity), E. tenuis (Montagu, 1808) from Japan (LC144804.1, 83.23% identity), E. niponica (E. A. Smith, 1885) from Japan (LC144803.1, 83.10% identity), and Acila mirabilis (A. Adams & Reeve, 1850) from Japan (LC144802.1, 83.36% identity).
Nucula chrysocoma Dall, 1908
Fig.
Material examined. AD4503: M11989.
Localities. Mound 12 (~ 965–995 m).
Distribution. Originally described from several stations off Peru, Ecuador, and southern Mexico, 734–4064 m (Dall, 1908), and known from Cascadia Abyssal Plain, Oregon, to Coquimbo, central Chile, 734–4134 m (
Acharax cf. johnsoni (Dall, 1891)
Fig.
References.
Additional material examined. AD4503: M11980; AD4505: M12003; AD4507: M12012 (juvenile); AD4511: M12054, M16239; AD4513: M12072; AD4910: M15768 (18S: PQ304648), M15769; S0217: M17062; S0220: M17077 (18S: PQ304649; juvenile).
Localities. Mound 12 (~ 1000 m), Mound 11 (~ 1020 m), The Thumb (1069 m; this study), Parrita Scar (~ 1659–1663 m; this study), Jacó Scar (1744 m; this study), Subduction Plume (3410 m; this study). The collection locality in
Remarks. Originally described from 1838 m off Baja California (
The two 18S sequences in this study matched different previously reported clades, suggesting the presence of at least two cryptic species at the CRM, potentially segregated by depth. M17007 from Subduction Plume (3410 m) showed 99.94% identity to the Jacó Summit specimen (AJ563763.1) in
CRM specimens from Mound 11 and Mound 12 are hosts of copepods (see Cyclopoida sp. SIO_BIC_C12780), the chrysopetalid Natsushima sashai (
Nuculana cf. callimene (Dall, 1908)
Fig.
Material examined. S0220: M17063.
Localities. Subduction Plume (3434 m).
Remarks. This specimen is morphologically similar to N. callimene except for the posterior end and may represent an undescribed species. N. callimene is known from western Baja California to the Pacific margin of Panama (type locality), 183–3200 m (
Nuculana cf. hamata (Carpenter, 1864)
Fig.
Mollusca: Bivalvia: Nuculanidae, Bathyspinulidae, Yoldiidae, and Mytilidae, representative live images A Nuculana cf. hamata (M12047) B Tindariopsis grasslei (M16806) C Yoldiella stet. (M12046) D Bathymodiolus billschneideri (M12074) E Bathymodiolus earlougheri (M14479) F Bathymodiolus nancyschneiderae (M14531) G Bathymodiolus thermophilus (M17023) H Idas stet. (M17069). Scale bars: 1 mm (A–C, H); 1 cm (D–G).
Material examined. AD4510: M12047.
Localities. Jacó Summit (742 m).
Remarks. This specimen resembles N. hamata, which is known from Alaska to the Gulf of California (type locality: Catalina Island, southern California), 20–1100 m, and may include cryptic species; records of this morphologically variable species from further south are considered suspect and warrant further investigation (
Tindariopsis grasslei (Allen, 1993)
Fig.
Material examined. AD4503: M11985 (dead shell only); AD4506: M12005; AD4590: M12141; AD4971: M16735, M16736; AD4973: M16749, M16750; AD4977: M16806; AD4987: M16902; AD4985: M16908; AD4988: M16964; S0217: M17042.
Localities. Mound 12 (990 m, dead shell; 992–1010 m, live specimens), Mound 11 (1009 m), Parrita Seep (~ 1030–1179 m), The Thumb (1069 m), Jacó Scar (1783–1817 m).
Distribution. Known from the Guaymas Basin, Gulf of California (type locality, 2003 m), to the Costa Rica Subduction Zone, 1400–2012 m (
New records. CRM specimen M16908 from 992 m represents a new minimum depth for this species.
Remarks. This species is placed “with reluctance” in Tindariopsis (
Yoldiella stet.
Fig.
Material examined. AD4510: M12046.
Localities. Jacó Summit (742 m).
Bathymodiolus billschneideri McCowin, Feehery & Rouse, 2020
Fig.
Reference.
Localities. Parrita Seep (~ 1400 m), Jacó Scar (~ 1750–1900 m; type locality).
Distribution. Known only from the CRM seeps and apparently found no shallower than ~ 1400 m.
Remarks. B. billschneideri is a host of the scaleworms Branchipolynoe eliseae, Br. halliseyae, Br. kajsae, and Br. meridae (
Bathymodiolus earlougheri McCowin, Feehery & Rouse, 2020
Fig.
Reference.
Localities. Mound 12 (~ 1000 m), The Thumb (1073 m), Jacó Scar (~ 1750–1900 m; type locality).
Distribution. Known only from the CRM seeps.
Remarks. B. earlougheri likely also occurs at sites of intermediate depth (e.g., Parrita Seep, ~ 1400 m) but has not been collected there, likely due to limited sampling (
Bathymodiolus nancyschneiderae McCowin, Feehery & Rouse, 2020
Fig.
Reference.
Localities. Mound 12 (~ 1000 m), Jacó Slope (1063 m; type locality), The Thumb (1073 m).
Distribution. Known only from the CRM seeps and apparently found no deeper than ~ 1000 m.
Remarks. B. nancyschneiderae is a host of the scaleworms Branchipolynoe eliseae, Br. halliseyae, Br. kajsae, and possibly also Br. meridae (
Bathymodiolus thermophilus Kenk & B. R. Wilson, 1985
Fig.
References.
Localities. Jacó Scar (1794–1814 m).
Distribution. Originally described from 2495 m at the Galápagos Rift (
Remarks. B. thermophilus specimens from the CRM seeps were not observed to contain Branchipolynoe spp. scaleworms, but this apparent absence may reflect limited sample size and the tendency of the worms to evacuate the mussels upon disturbance.
Idas stet.
Fig.
Reference.
Material examined. AD4587: M13006 (KU975037); AD4907: M16100; S0219: M17069 (PQ450399).
Localities. Rio Bongo Scar (661 m; this study), Mound 12 (996–999 m).
Remarks. Associated with naturally occurring and experimentally deployed wood. As described in
Delectopecten vancouverensis (Whiteaves, 1893)
Fig.
Mollusca: Bivalvia: Pectinidae, Thyasiridae, Galeommatidae, and Vesicomyidae, representative live images A Delectopecten vancouverensis (M16184) B Delectopecten zacae (M16188) C Thyasira methanophila (M17098, valve only) D Thyasira stet. (M12059) E Axinodon cf. redondoensis (M16845) F Archivesica gigas (M12011) G Archivesica sp. 6 sec.
Material examined. AD4512: M12063; AD4918: M16184.
Localities. Quepos Slide (338–~ 400 m).
Distribution. Originally described from British Columbia, Canada; recorded in the eastern Pacific from Alaska to Baja California as well as the Bering Sea and northwestern Pacific to the Sea of Japan, 20–4100 m (
New records. Pending verification of the GBIF record, the CRM specimens represent new southern records for this species.
Remarks. M16184 was associated with epibiotic hydroids. DNA sequences could not be obtained.
Delectopecten zacae (Hertlein, 1935)
Fig.
Material examined. AD4921: M16188.
Localities. Quepos Slide (~ 345–394 m).
Distribution. Known from Baja California (type locality: Cabo San Lucas, 37–402 m) (
Remarks. DNA sequences could not be obtained.
Thyasira methanophila P. G. Oliver & Sellanes, 2005
Fig.
Reference.
Additional material examined. S0230: M17098 (juvenile specimen, only valves collected).
Localities. Parrita Seep (1408 m); Mound Jaguar (1909 m; this study, valves).
Distribution. Also known from seeps at the type locality off Concepción, central Chile, 780 m (
Thyasira stet.
Fig.
Material examined. AD4512: M12059 (PQ450412); AD4978: M16840; AD4988: M16977.
Localities. Quepos Slide (~ 344–411 m), Mound 12 (~ 996–999 m), Jacó Scar (1783 m).
Remarks. This morphospecies warrants comparison to other eastern Pacific specimens that have been dubiously reported as Thyasira flexuosa (Montagu, 1803) (type locality: Great Britain) and likely represent several cryptic species (
Axinodon cf. redondoensis (T. A. Burch, 1941)
Fig.
Material examined. AD4978: M16845.
Localities. Mound 12 (~ 996–999 m).
Remarks. Likely an undescribed species. Possibly a range and depth extension of Axinodon redondoensis, presently known from Washington to Redondo Beach, southern California (type locality, 137 m), 120–330 m (
We thank Elena Krylova (P.P. Shirshov Institute of Oceanology, Russian Academy of Sciences) for input on this section.
Archivesica gigas (Dall, 1896)
Fig.
References.
Additional material examined. AD4506: M12007; AD4507: M12011 (PQ449002); AD4508: M12014 (PQ449401).
Localities. Parrita Seep (1186 m, ~ 1400 m; this study), Parrita Scar (~ 1659–1667 m; this study), Jacó Scar (~ 1800 m); an unnamed locality ~ 85 km northwest of Mound Jaguar (10.3000, -86.3053; 1531 m) (
Distribution. Originally described from the Guaymas Basin, Gulf of California, 1567 m (
Archivesica sp. 6 sec. Audzijonyte et al. 2012
Fig.
Reference.
Additional material examined. AD4590: M13509 (PQ450381, PQ450398; tissues); AD4912: M16141 (PQ449413).
Localities. Jacó Scar (1677 m; ~ 1791–1842 m, this study).
Distribution. Known only from the CRM seeps.
Remarks. Morphologically resembles A. gigas and may warrant description as a new species (
Archivesica sp. 7 sec.
References.
Localities. An unnamed seep at 3002 m (9.69850, -86.06817) and a “low-temperature vent” at 3096 m (9.7112, -86.0777) (
Distribution. Also known from a seep at 4300 m in the Middle America Trench off Mexico (
Remarks. This taxon warrants consideration as a new species based on COI sequences, but no morphological voucher specimens are available (
Archivesica sp. SIO_BIC_M12070 aff. gigas (Dall, 1896)
Fig.
Material examined. AD4513: M12070 (PQ450402).
Localities. Jacó Scar (1744 m).
Remarks. An undescribed species. The COI sequence of this specimen was 94.83–95.20% identical to sequences of A. gigas from northern Japan (PP899629.1), the Guaymas Basin, Gulf of California (MF959623.1 (
Calyptogena costaricana Krylova & Sahling, 2006
Reference.
Localities. Mound 10 (2258–2263 m; type locality).
Distribution. Also known from seeps in Monterey Canyon, off California, 2193–2219 m, and a vent on the Peru margin, 2500 m (
Calyptogena diagonalis Barry & Kochevar, 1999
Fig.
Mollusca: Bivalvia: Vesicomyidae, Xylophagaidae, and Teredinidae, representative live images A Calyptogena diagonalis (M17064) B Phreagena soyoae (M11999) C Phreagena sp. 5 sec.
References.
Additional material examined. S0220: M17064, M17065.
Localities. Subduction Plume (3408 m; this study); an unnamed seep (9°42.28'N, 86°4.38'W; 2980–3800 m; type locality) (
Distribution. Also known from seeps at the Oregon margin, 2021–2089 m (
Remarks. M17065 was associated with an anemone, Co3084. Based on morphological and genetic similarities,
Calyptogena sp. 3 sec.
Reference.
Localities. Unnamed seep ~ 25 km west of Mound Jaguar (9.6678, -86.1193; 3560 m) (
Distribution. Also known from seep and whale fall habitats off central California, 2895–3449 m (
Remarks. This taxon warrants consideration as a new species based on COI sequences, but no morphological voucher specimens are available (
Calyptogena sp. mt-V sec. Goffredi et al. 2003
References.
Localities. Unnamed “low-temperature vent” ~ 20 km west of Mound Jaguar (9.7112, -86.0777; 3096 m) (
Remarks. The single genetic sample of this taxon was originally identified as Calyptogena pacifica (
Phreagena extenta (Krylova & Moskalev, 1996)
Reference.
Localities. Unnamed seep ~ 20 km west of Mound Jaguar (9.6983, -86.0682; 3002 m).
Distribution. Originally described from a seep in Monterey Bay at 3041 m; recorded from the Gulf of Alaska to Costa Rica, 2889–4445 m (
Remarks. Previously placed in Ectenagena and then Calyptogena (
Phreagena soyoae (Okutani, 1957)
Fig.
Reference.
Additional material examined. AD4505: M11999 (PQ449397, PQ449398, PQ449399, PQ450407, PQ450408).
Localities. Mound 11 (~ 1019-1025 m; this study); Mound Carablanca, Nicaragua margin (1432 m).
Distribution. Originally described from seeps off Japan, 750–1500 m (type locality: Sagami Bay, 750 m), P. soyoae is found at seep, vent, and whale fall habitats from the Juan de Fuca Ridge to the Costa Rica and Nicaragua margins, 519–2400 m (
Phreagena sp. 5 sec. Audzijonyte et al. 2012
Fig.
Reference.
Additional material examined. AD4506: M12009 (PQ449400), M12085 (PQ450380); AD4508: M12088 (PQ450379); AD4988: M16960 (PQ449417).
Localities. Mound 11 (1012 m; this study), Jacó Slope (1024 m), Parrita Seep (1186 m and ~ 1400 m, this study; 1408 m). The locality “Mound Quepos” at 1408 m and the upslope region of Jacó Scar at 1024 m in
Remarks. Morphologically resembles Phreagena soyoae and may warrant description as a new species (
Pliocardia krylovata A. M. Martin & Goffredi, 2012
Fig.
Reference.
Additional material examined. S0213: M17026.
Localities. Jacó Summit (~ 741–744 m; type locality), Mound 12 (~ 967–995 m).
Distribution. Known only from the CRM seeps.
Remarks. Found in sediments near microbial mats and typically positioned with approximately half the shell length above the sediment, forming “a spatial bridge between the oxic overlying water and the sulphide-rich sediment” (
Xylophaga stet.
Fig.
Material examined. AD4906: M15767, M16099, M16111.
Localities. Mound 12 (1002 m).
Remarks. Associated with experimentally deployed wood. We thank Chiara Romano (University of Gastronomic Sciences) for this identification.
Xyloredo gen. inc.
Fig.
Material examined. AD4588: M17870.
Localities. Mound 12 (~ 1000 m).
Remarks. Associated with a naturally occurring palm wood fall.
We thank Reuben Shipway (University of Plymouth) for these identifications.
Teredinidae sp. SIO_BIC_M17100
Fig.
Material examined. AD4913: M16147; S0230: M17100 (PQ449424).
Localities. Jacó Scar (1817 m), Mound Jaguar (1896 m).
Remarks. An undescribed species associated with naturally occurring wood falls.
Teredinidae stet.
Fig.
Material examined. AD4588: M12290.
Localities. Mound 12 (995 m).
Remarks. Associated with a naturally occurring wood fall. DNA sequences could not be obtained.
Bathyneaera tillamookensis (Dall, 1916)
Fig.
Mollusca: Bivalvia and Gastropoda: Patellogastropoda, representative live images A Bathyneaera tillamookensis (M16982) B Luzonia chilensis (M16808) C Iothia stet. (M16172, separate specimens in dorsal and lateral view) D Iothia stet. (M16173, separate specimens in dorsal and lateral view) E Eulepetopsis gen. inc. (M17882, dorsal view) F Eulepetopsis gen. inc. (M17882, ventral view) G Neolepetopsidae stet. (M11963, dorsal view) H Neolepetopsidae stet. (M11963, ventral view). Scale bars: 1 mm.
Material examined. AD4989: M16982.
Localities. Jacó Scar (1762 m).
Distribution. Originally described from the Oregon margin, 1438 m, and known from British Columbia, Canada, to Peru as well as the Atlantic and New Zealand, 439–2850 m (
Luzonia chilensis (Dall, 1890)
Fig.
Material examined. AD4508: M12026; AD4974: M16769; AD4977: M16808; AD4989: M16980, M16981, M16983.
Localities. Mound 12 (990 m), Parrita Seep (1402 m), Jacó Scar (1762–1783 m).
Distribution. Originally described from Isla Mocha, central Chile, 1238 m, and known from the U.S. Pacific coast off Washington to southern Chile, 100–1875 m (
We list the six widely accepted major gastropod clades (
Iothia stet.
Fig.
Reference. Electronic supplemental table S6 of
Material examined. AD4508: M12025 (PQ450378); AD4916: M16172, M16173.
Localities. Parrita Seep (~ 1401–1419 m), Jacó Scar (1611 m).
Remarks. For M12025, the closest COI BLASTN results on GenBank were specimens of Iothia fulva (O. F. Müller, 1776) from the North Sea (KR084663.1, KR084581.1; 94.53% identity).
Eulepetopsis gen. inc.
Fig.
Reference. Electronic supplemental table S6 of
Material examined. AD4506: M12004; AD4590: M17882, M18921, M19153.
Localities. Parrita Seep (1186 m), Jacó Scar (~ 1800 m).
Remarks. Morphologically similar to Eulepetopsis, although the two described species of Eulepetopsis are known only from high-temperature vents and Neolepetopsidae may require revision (
Neolepetopsidae stet.
Fig.
Reference. Several morphospecies were reported in Electronic supplemental table S6 of
Material examined. AD4501: M11963; AD4502: M12093; AD4586: M18777, M18780, M18800, M18802, M18804, M18807; AD4587: M19015, M19116, M19155, M19156; AD4588: M19019, M19020, M19025, M19031, M19034, M19035, M19040, M19041, M19060, M19065, M19071, M19097, M19108, M19138, M19046, M19050, M19053, M19064, M19070, M19084, M19154; AD4589: M18813, M18827, M18839, M18842, M18848, M18858, M18864, M18910, M18918, M18926, M18929, M18958, M18964, M18966, M19139, M19140, M19141, M19157; AD4590: M18990; AD4591: M18874, M18882, M18885, M18892, M18902, M18903, M19163.
Localities. Mound 12 (~ 1000 m), Jacó Scar (~ 1800 m).
Remarks. Under genetic and morphological investigation (
Paralepetopsis cf. clementensis J. H. McLean, 2008
Fig.
Mollusca: Gastropoda: Patellogastropoda and Caenogastropoda, representative images. Live specimens are depicted unless otherwise specified A Paralepetopsis cf. clementensis (M18937, preserved specimen in dorsal, ventral, and lateral view) B Bathyacmaea stet. (M11987, same specimen in dorsal and lateral view) C Fuscapex stet. (M12006) D Alvania stet. (M18834, same preserved specimen in lateral and apertural view) E Vitrinellidae stet. (M19091, same preserved specimen in apical and umbilical view) F Neptunea stet. (M12023) G Cancellaria nr. rosewateri (M12051, apertural view) H Cancellaria nr. rosewateri (M12051, lateral view). Scale bars: 1 mm (A–F); 1 cm (G, H).
Reference. Reported in Electronic supplemental table S6 of
Material examined. AD4590: M18930, M18935, M18937, M18961, M18969, M18976, M18980, M18989, M19142; AD4591: M18884, M18901.
Localities. Jacó Scar (~ 1800 m).
Distribution. Paralepetopsis clementensis is known only from a whale fall off southern California at 1800 m depth (
Bathyacmaea stet.
Fig.
Reference. Electronic supplemental table S6 of
Material examined. AD4503: M11987; AD4587: M18812; AD4590: M18925, M18928, M18945, M18953, M18960, M18968, M18978, M18987; AD4591: M18873, M18881, M18888, M18893, M19151.
Localities. Mound 12 (~ 1000 m), Jacó Scar (~ 1800 m).
Remarks. Under genetic and morphological investigation (
Fuscapex stet.
Fig.
Material examined. AD4506: M12006.
Localities. Parrita Seep (~ 1030–1033 m).
Remarks. The host of this specimen was not determined, but Fuscapex is only known as a parasite on ophiuroids (
Alvania stet.
Fig.
Material examined. AD4589: M18834.
Localities. Mound 12 (997 m).
Remarks. Associated with a naturally occurring wood fall.
Vitrinellidae stet.
Fig.
Material examined. AD4587: M19091.
Localities. Mound 12 (996 m).
Remarks. Associated with a naturally occurring wood fall.
Neptunea amianta (Dall, 1890) sp. inc.
Fig.
Material examined. AD4508: M12023; AD4913: M16143; S0230: M17099.
Localities. Parrita Seep (~ 1401–1419 m), Jacó Scar (1847 m), Mound Jaguar (1908 m).
Remarks. Possibly a southern range extension of Neptunea amianta, which was originally described from southern California at 757 m and has been reported from the Bering Sea off Alaska to northern Baja California, 100–3500 m (
Cancellaria nr. rosewateri Petit, 1983
Fig.
Material examined. AD4510: M12051.
Localities. Jacó Summit (744 m).
Remarks. This specimen warrants further comparison to Cancellaria rosewateri, described from the Gulf of Mexico, 366 m (
Gymnobela stet.
Fig.
Mollusca: Gastropoda: Caenogastropoda, representative images. Live specimens are depicted unless otherwise specified A Gymnobela stet. (M17041, three specimens) B Phymorhynchus gen. inc. (M17038, apertural view) C Phymorhynchus gen. inc. (M17038, lateral view) D Abyssochrysos stet. (M18994, same preserved specimen in lateral and apertural view) E Provanna ios (M16807, apertural views) F Provanna ios (M16807, apico-lateral views) G Provanna laevis (M16104) H Provanna laevis (M17030, with bacteria). Scale bars: 1 cm (A–C); 1 mm (D–H).
Material examined. AD4504: M11990 (PQ449396); AD4988: M16958; S0217: M17041.
Localities. Mound 11 (~ 999–1025 m), The Thumb (1069 m).
Remarks. For M11990, the closest COI BLASTN result on GenBank was a specimen of Typhlosyrinx (Raphitomidae) from Papua New Guinea, 680–689 m (MH308407.1, 93.26% identity) (
Phymorhynchus gen. inc.
Fig.
Material examined. S0214: M17038.
Localities. Jacó Scar (1801 m).
Abyssochrysos stet.
Fig.
Material examined. AD4587: M18994.
Localities. Mound 12 (~ 9900–996 m).
Provanna ios Warén & Bouchet, 1986
Fig.
Reference.
Localities. Jacó Scar (~ 1800–2000 m) and an unnamed locality (8.5958, -84.4370) at 1917 m depth, ca 12 km northwest of Parrita Seep.
Distribution. Eastern Pacific vents, 21°N to 17°S (type locality: 13°N on the East Pacific Rise) (
Provanna laevis Warén & Ponder, 1991
Fig.
References.
Localities. Jacó Summit (~ 740–760 m), Mound 12 (~ 900–1050 m), The Thumb (~ 1071–1075 m).
Distribution. Originally described from the Guaymas Basin, Gulf of California, 2004 m (
Remarks. Some CRM specimens were associated with naturally occurring or experimentally deployed wood (
Provanna pacifica (Dall, 1908)
Fig.
Mollusca: Gastropoda: Caenogastropoda and Heterobranchia, representative live images A Provanna pacifica (M16955, apertural views) B Provanna pacifica (M16955, lateral views) C Aeolidioidea stet. (M16811) D Fionoidea stet. (M11992) E Goniodorididae sp. SIO_BIC_M16185 (M16185, dorsal view) F Goniodorididae sp. SIO_BIC_M16185 (M16185, lateral view) G Eulimella lomana (in situ), Dive S0214 at Jacó Scar, 1781 m. Credit: ROV SuBastian/Schmidt Ocean Institute H Pyramidellidae stet. (M16901). Scale bars: 1 mm.
Reference.
Localities. Mound 11 (~ 1000–1100 m), Parrita Seep (~ 1300–1500 m).
Distribution. Associated with naturally occurring sunken wood and seeps, Oregon Margin to the Gulf of Panama (type locality), 1000–2750 m (
Aeolidioidea stet.
Fig.
Material examined. AD4975: M16811; AD4985: M16907.
Localities. Mound 12 (997–1002 m).
Fionoidea stet.
Fig.
Material examined. AD4504: M11992; AD4906: M16094.
Localities. Mound 11 (~ 1004–1011 m), Mound 12 (~ 997–1002 m).
Remarks. M11992 was associated with naturally occurring sunken plant material.
Goniodorididae sp. SIO_BIC_M16185
Fig.
Material examined. AD4918: M16185 (PQ449415).
Localities. Quepos Slide (394 m).
Remarks. The closest COI BLASTN results on GenBank were within Goniodorididae, e.g., Ceratodoris pilosa (Bouchet & Ortea, 1983) from Japan (MW357567.1, 88.94% identity), Okenia mediterranea (Ihering, 1886) from Italy (MK645760.1, 88.78% identity), and O. amoenula (Bergh, 1907) from South Africa (KF192606.1, 88.63% identity).
Eulimella lomana (Dall, 1908)
Fig.
Reference. Electronic supplemental table S6 of
Material examined. AD4590: M18971.
Localities. Jacó Scar (~ 1800 m).
Distribution. Known from seeps, vents (likely sedimented vents), and whale falls, 1168–2008 m, from southern California (type locality) and the Guaymas Basin, Gulf of California (
New records. The CRM specimen represents a new southern record for this species.
Remarks. Pyramidellids are thought to be exclusively parasitic, typically on mollusks or polychaetes, but a definitive host has not been identified for E. lomana (
Pyramidellidae stet.
Fig.
Material examined. AD4508: M12029; AD4912: M16125; AD4987: M16901; AD4989: M16942.
Localities. Mound 12 (1010 m), Parrita Seep (~ 1401–1419 m), Jacó Scar (1842 m).
Remarks. At least one additional morphospecies is present and distinct from E. lomana.
Parvaplustrum stet.
Fig.
Mollusca: Gastropoda: Heterobranchia, representative images. Live specimens are depicted unless otherwise specified A Parvaplustrum stet. (M17071, apertural view; scale not recorded for specimens destroyed in DNA extraction; estimated shell length 1-2 mm) B Parvaplustrum stet. (M17071, lateral view) C Architectonicidae fam. inc. (M19335, same preserved specimen in apical and umbilical view) D Lurifax gen. inc. (M19337, same preserved specimen in apical and umbilical view) E Orbitestella gen. inc. (M19136, same preserved specimen in apical and umbilical view) F Hyalogyra stet. (M18944, same preserved specimen in apical and umbilical view) G Hyalogyrina sp. SIO_BIC_M16774 (M16774, lateral view) H Hyalogyrina sp. SIO_BIC_M16774 (M16774, ventral view). Scale bars: 1 mm.
Material examined. S0219: M17071.
Localities. Rio Bongo Scar (609 m).
Remarks. Collected from a microbial mat. DNA sequences could not be obtained.
Architectonicidae fam. inc.
Fig.
Material examined. AD4505: M19335.
Localities. Mound 11 (1025 m).
Remarks. Identification is uncertain due to the corroded condition of the shell.
Lurifax gen. inc.
Fig.
Material examined. AD4504: M19337; AD4505: M19336.
Localities. Mound 11 (1009–1025 m).
Remarks. Identification is uncertain.
Orbitestella gen. inc.
Fig.
Material examined. AD4589: M19136.
Localities. Mound 12 (997 m).
Remarks. Identification is uncertain due to the corroded condition of the shell.
Hyalogyra stet.
Fig.
Material examined. AD4586: M18799; AD4587: M19010, M19087; AD4588: M19026, M19043, M19074, M19088, M19135; AD4589: M18837, M19137; AD4590: M18907, M18919, M18920, M18942, M18944, M19145, M19338.
Localities. Mound 12 (~ 1000 m), Jacó Scar (~ 1800 m).
Remarks. Two morphospecies were distinguished as “tall” and “planispiral”.
Hyalogyrina stet.
Fig.
Reference. Electronic supplemental table S6 of
Material examined. AD4510: M12043; AD4587: M13003, M13004, M18991, M18992, M19000, M19001, M19007, M19144, M19147; AD4590: M18323, M18981, M19330; AD4914: M16151 (PQ449414); AD4974: M16774; S0213: M17029 (PQ449419).
Localities. Jacó Summit (741–742 m), Mound 12 (~ 1000 m), Jacó Scar (~ 1800 m).
Remarks. Most specimens were collected from microbial mat habitats. At least two morphospecies were distinguished (
Colotrachelus stet.
Fig.
Mollusca: Gastropoda: Vetigastropoda, representative images. Live specimens are depicted unless otherwise specified A Colotrachelus stet. (M19101, separate preserved specimens in dorsal and ventral view) B Pyropelta cf. corymba (M16105) C Pyropelta cf. musaica (M19044, same preserved specimen in dorsal and ventral view) D Pyropelta cf. wakefieldi (M11966, separate specimens in dorsal and ventral view) E Pyropelta cf. wakefieldi (M11966, lateral view) F Lepetodrilus aff. shannonae (M11973, separate specimens in dorsal and ventral view) G Lepetodrilus guaymasensis (M16142, separate specimens in lateral and dorsal view) H Lepetodrilus guaymasensis (M16142, ventral view). Scale bars: 1 mm.
Material examined. AD4587: M19093, M19101, M19120, M19129.
Localities. Mound 12 (~ 1000 m).
Pyropelta cf. corymba McLean & Haszprunar, 1987
Fig.
Reference. Reported in Electronic supplemental table S6 of
Material examined. AD4501: M11968; AD4586: M18801; AD4587: M19096, M19343; AD4588: M19033, M19049, M19059, M19073, M19160, M19347; AD4589: M18322, M18830, M18841, M18851, M18863, M19078; AD4590: M18908; AD4910: M16105, M16107; AD4917: M16157; AD4978: M16874.
Localities. Mound 12 (~ 1000 m), Jacó Scar (~ 1800 m).
Remarks. Pyropelta corymba was originally described from hydrothermal vents in the Guaymas Basin, Gulf of California, 2022 m (
Pyropelta cf. musaica McLean & Haszprunar, 1987
Fig.
Material examined. AD4586: M17850, M18781, M18811, M19348; AD4587: M19008, M19090, M19109, M19113, M19122; AD4588: M19022, M19023, M19032, M19044, M19054, M19066, M19085, M19162, M19346; AD4589: M18831, M18843, M18850, M19077; AD4590: M18940, M18988; AD4591: M18324, M18883, M18900.
Localities. Mound 12 (~ 1000 m), Jacó Scar (~ 1800 m).
Remarks. Pyropelta musaica was originally described from hydrothermal vents at the Axial Seamount, Juan de Fuca Ridge, 1575 m (
Pyropelta cf. wakefieldi McLean, 1992
Fig.
Material examined. AD4501: M11966 (PQ450396); AD4586: M17849, M18797, M18803, M18808, M18810; AD4587: M19011, M19016, M19112; AD4588: M19021, M19030, M19048, M19072, M19075, M19134, M19148, M19150, M19340, M19341, M19342, M19344; AD4589: M18829, M18835, M18849, M18857, M18862, M19076; AD4590: M18956, M18959.
Localities. Mound 12 (~ 1000 m), Jacó Scar (~ 1800 m).
Remarks. Pyropelta wakefieldi was originally described from a whale fall off Point Sur, California, 940 m (
Lepetodrilus aff. shannonae Warén & Bouchet, 2009
Fig.
Reference. Electronic supplemental table S6 of
Material examined. AD4501: M11973; AD4511: M12057; AD4590: M18904, M18943, M18985, M19152; AD4591: M18875, M18879, M18891, M18898.
Localities. Mound 12 (~ 1000 m), Jacó Scar (~ 1800 m).
Remarks. The CRM specimens appear morphologically similar to L. shannonae, known only from hydrocarbon seeps off the Congo River, West Africa, 2300–3150 m (
Lepetodrilus guaymasensis McLean, 1988
Fig.
References:
Additional material examined. AD4508: M12020 (PQ450397); AD4586: M18778, M18809; AD4587: M19107, M19111, M19118; AD4588: M19018, M19028, M19058, M19069; AD4589: M18817, M18828, M18836, M18845, M18856, M18860; AD4590: M18911, M18914, M18922, M18927, M18938, M18947, M18950, M18967, M18970, M18979, M18983, M19349 to M19382; AD4591: M18872, M18878, M18890, M18897; AD4912: M16142; AD4917: M16159.
Localities. Mound 12 (~ 1000 m; this study), Parrita Seep (~ 1400 m; this study), Jacó Scar (~ 1800 m), “Mudpie” seep ~ 10 km west of Parrita Scar (8.983, -84.717; 1917 m) (
Distribution. Originally described from sedimented hydrothermal vents and seeps in the Guaymas Basin, Gulf of California, 2000–2019 m, often in association with Riftia pachyptila Jones, 1981 (
Remarks. The COI sequence of M12020 was 100.00% identical to that of L. guaymasensis from the CRM Mudpie site (EU306419.1, voucher SMNH 82443, Swedish Museum of Natural History).
Lepetodrilus stet.
Fig.
Mollusca: Gastropoda: Vetigastropoda, representative live images A Lepetodrilus stet (M11965, same specimen in dorsal and ventral view) B Anatoma stet. (M16187, same specimen in apical, lateral, and umbilical view) C Bathyxylophila stet. (M12038, separate specimens in apical and umbilical view) D Bathyxylophila stet. (M16199) E Kanoia myronfeinbergi (M16771) F Kanoia cf. myronfeinbergi (M12053) G Haplotype network of Kanoia COI sequences. Scale bars: 1 mm (A–D); 1 cm (E, F).
Material examined. AD4501: M11965.
Localities. Mound 12 (~ 984–997 m).
Remarks. Additional Lepetodrilus morphospecies may occur at the CRM. For example, an undescribed Lepetodrilus “sp. CR” has been reported from a CRM seep site at 1900 m, but it is represented by a single specimen without available DNA sequences (
Anatoma stet.
Fig.
Reference. Electronic supplemental table S6 of
Material examined. AD4591: M18899; AD4918: M16187.
Localities. Quepos Slide (~ 333–408 m), Jacó Scar (1753 m).
Bathyxylophila stet.
Fig.
Material examined. AD4508: M12028; AD4509: M12038, M12039, M18869; AD4587: M18317, M19092, M19099, M19128; AD4923: M16198, M16199; AD4976: M16797, M16798, M16801; AD4988: M16954, M16965.
Localities. Mound 12 (~ 1000 m), Mound 11 (1010 m), Parrita Seep (~ 1000–1400 m), Jacó Scar (~ 1800 m).
Remarks. Associated with naturally occurring or experimentally deployed wood falls. Likely at least two morphospecies are represented. Some of the specimens of M16199 (Fig.
Kanoia myronfeinbergi Warén & Rouse, 2016
Fig.
References.
New sequences. We provide COI sequences for the following specimens cited in
Localities. Mound 12 (~ 1000 m; type locality), Jacó Scar (~ 1800 m); additional seep sites off Costa Rica and Nicaragua (1002–1917 m) (
Distribution. Also known from seeps in the Guaymas Basin at ~ 1570 m and seeps off Del Mar, California, ~ 1020 m (
Kanoia cf. myronfeinbergi Warén & Rouse, 2016
Fig.
Reference.
New sequences. AD4510: M12053 (PQ449403); AD4587: M18315 (PQ449426; tissue from voucher SMNH 108680). In
Localities. Jacó Summit (~ 741–744 m), Mound 12 (~ 990–996 m).
Remarks. The description of K. myronfeinbergi notes the possibility of a second, cryptic species “with less distinct sculpture, more similar to Kanoia meroglypta from the Caribbean,” although detailed assessment of shell sculpture is difficult due to the corrosion on many specimens (
To investigate the genetic basis for this variation, we constructed a COI haplotype network using a subset of the specimens examined in the original description (Fig.
Xyloskenea stet.
Fig.
Mollusca: Gastropoda: Vetigastropoda and Neomphaliones, representative images. Live specimens are depicted unless otherwise specified A Xyloskenea stet. (M19013, two preserved specimens) B Escondidacantrainea panamensis (M17848, apical view) C Escondidacantrainea panamensis (M17848, umbilical view) D Dillwynella stet (M17884) E Fucaria stet. (M12068, two specimens) F Bathysciadium stet. (M19002, same preserved specimen in dorsal and lateral view) G Cocculina stet. (M19166, same preserved specimen in dorsal and ventral view) H Cocculinidae fam. inc. (M16727, same specimen in dorsal and ventral view). Scale bars: 1 mm (A, D–H); 1 cm (B, C).
Material examined. AD4509: M18870, M19159; AD4587: M19013, M19334; AD4923: M16197.
Localities. Mound 12 (~ 1000 m), Parrita Seep (~ 1100 m), Jacó Scar (~ 1800 m).
Remarks. M16197 and M18870 were associated with naturally occurring wood falls.
Escondidacantrainea panamensis (Dall, 1908)
Fig.
Material examined. AD4587: M17848, M19103.
Localities. Mound 12 (995–996 m).
Distribution. Originally described from the Gulf of Panama, 1015 m (
Remarks. M17848 and M19103 were associated with naturally occurring wood falls.
Dillwynella stet.
Fig.
Reference. Reported in Electronic supplemental table S6 of
Material examined. AD4586: M18805; AD4587: M18320, M19095, M19098, M19117, M19124, M19158; AD4588: M17884, M19052; AD4589: M18832; AD4590: M18957.
Localities. Mound 12 (~ 1000 m), Jacó Scar (~ 1800 m).
Remarks. Many specimens were associated with wood falls, either experimentally deployed (M17884, M18805, M19052) or naturally occurring (M18320, M19095, M19098, M19117, M19124, M19158). These specimens warrant comparison to Ganesa panamensis Dall, 1902, which is known only from the Gulf of Panama, 1865 m, and has been regarded as possibly belonging to the genus Dillwynella (
Fucaria stet.
Fig.
Reference. Electronic supplemental table S6 of
Material examined. AD4513: M12068; AD4591: M18880, M18887; AD4590: M18906, M18923, M18941, M18946, M18951, M18986, M19165; AD4591: M18896.
Localities. Jacó Scar (~ 1800 m).
We follow the subdivisions of Neomphaliones based on the mitogenome phylogeny in
Bathysciadium stet.
Fig.
Material examined. AD4587: M19002.
Localities. Mound 12 (~ 990–996 m).
Cocculina stet.
Fig.
Material examined. AD4503: M19166; AD4588: M18321, M19089.
Localities. Mound 12 (~ 1000 m).
Cocculinidae fam. inc.
Figs
Mollusca: Gastropoda: Neomphaliones, representative images. Live specimens are depicted unless otherwise specified A Cocculinidae fam. inc. (M16816, dorsal view) B Cocculinidae fam. inc. (M16816, ventral view) C Leptogyropsis gen. inc. (M19102, same preserved specimen in apical, umbilical, and apertural view) D Helicrenion stet. (M18909, two preserved specimens) E Neomphalidae sp. SIO_BIC_M14645 (M14645, two specimens) F Neomphalidae sp. SIO_BIC_M14645 (M14645, ventral view) G Peltospiridae stet. (M16802, dorsal view) H Peltospiridae stet. (M16802, ventral view). Scale bars: 1 mm.
Material examined. AD4972: M16726, M16727, M16728; AD4974: M16789, M16790; AD4976: M16816, M16817.
Localities. Mound 12 (~ 1000 m), Jacó Scar (~ 1800 m).
Remarks. Associated with experimentally deployed wood. Under morphological and genetic investigation (
Leptogyropsis gen. inc.
Fig.
Material examined. AD4587: M19102, M19146.
Localities. Mound 12 (996 m).
Remarks. Associated with a naturally occurring wood fall.
Helicrenion stet.
Fig.
Material examined. AD4508: M12027; AD4586: M18782; AD4587: M18993, M18999, M19004; AD4589: M18818; AD4590: M18909; AD4988: M16962.
Localities. Mound 11 (1009 m), Mound 12 (~ 1000 m), Parrita Seep (~ 1400 m), Jacó Scar (~ 1800 m).
Remarks. Possibly an undescribed species. Several specimens (M16962, M18993, M18999, and M19004) were collected from microbial mat habitats.
Neomphalidae sp. SIO_BIC_M14645
Fig.
Material examined. AD4910: M14645; AD4917: M14646 (PQ449412).
Localities. Mound 12 (~ 1000 m).
Remarks. An undescribed genus and species.
Peltospiridae stet.
Fig.
Material examined. AD4976: M16802.
Localities. Jacó Scar (1887 m).
Remarks. Associated with experimentally deployed wood.
Gadilida stet.
Fig.
Mollusca: Scaphopoda, Cephalopoda, and Aplacophora: Caudofoveata, representative live and SEM images A Siphonodentalium gen. inc. (M12048) B Gadilida stet. (M12049) C Octopodoidea stet. (M17037, dorsal view) D Octopodoidea stet. (M17037, detail) E Planctoteuthis danae (M17039) F Chaetoderma stet. (M16155, incomplete specimen, cuticle missing from part of the body) G Chaetodermatidae sp. SIO_BIC_M12018 (M12018) H Chaetodermatidae sp. SIO_BIC_M12018 (M12019, SEM). Scale bars: 1 mm (A, B, G); 1 cm (C, E, F); 0.3 mm (H).
Material examined. AD4510: M12049.
Localities. Jacó Summit (744 m).
Siphonodentalium gen. inc.
Fig.
Material examined. AD4510: M12048; AD4511: M12056.
Localities. Jacó Summit (742 m), Mound 12 (~ 988–997 m).
We thank Michael Vecchione (National Marine Fisheries Service National Systematics Laboratory, U.S. National Museum of Natural History) for assistance with these identifications.
Octopodoidea sp. SIO_BIC_ M17037
Fig.
Material examined. S0216: M17037.
Localities. Quepos Slide (317 m) .
Remarks. Likely an undescribed species, possibly an undescribed genus. The animal was observed releasing ink (potentially a diagnostic character).
Planctoteuthis danae (Joubin, 1931)
Fig.
Material examined. S0215: M17039.
Localities. Mound 12 (1016 m depth, 2–3 m above the seafloor).
Distribution. Originally described from the Gulf of Panama and considered cosmopolitan in tropical and temperate waters worldwide (
We use the clade-based high-level taxonomic names in
Chaetoderma stet.
Fig.
Material examined. AD4917: M16155; AD4977: M16809.
Localities. Jacó Scar (1783–1791 m).
Chaetodermatidae sp. SIO_BIC_M12018
Fig.
Material examined. AD4508: M12018 (PQ449402), M12019; AD4972: BI1338 (PQ449340).
Localities. Parrita Seep (~ 1401–1419 m), Jacó Scar (1746 m).
Remarks. The closest COI BLASTN result on GenBank was the holotype of Chaetoderma felderi Ivanov & Scheltema, 2007 (AM922259.1; 93.33% identity to M12018, 93.18% identity to BI1338). Based on COI, these specimens belong within Chaetodermatidae and may belong to Chaetoderma or Falcidens, but these genera are not reciprocally monophyletic (
Chaetodermatidae sp. SIO_BIC_M16812
Material examined. AD4975: M16812 (PQ449416; no image available).
Localities. Mound 12 (1000 m).
Remarks. The closest COI BLASTN result on GenBank was the holotype of Chaetoderma felderi (AM922259.1; 90.21% identity). As above, this specimen may belong to Chaetoderma or Falcidens.
Chaetodermatidae sp. SIO_BIC_M16891
Fig.
Mollusca: Aplacophora: Caudofoveata and Solenogastres, representative live and SEM images A Chaetodermatidae sp. SIO_BIC_M16891 (M16891, SEM) B Neomenia gen. inc. (M18409) C Gymnomeniidae stet. (M16924) D Gymnomeniidae stet. (M16924, SEM) E Wirenia sp. SIO_BIC_M17072 (M17072) F Wirenia sp. SIO_BIC_M17072 (M17072, SEM) G Pholidoskepia stet. (M16923) H Pholidoskepia stet. (M16923, SEM). Scale bars: 0.3 mm (A); 1 mm (B, C, E, G); 0.02 mm (D, F, H).
Material examined. AD4979: M16891 (PQ435556).
Localities. Quepos Slide (397 m).
Remarks. The closest COI BLASTN result on GenBank was an undescribed species of Falcidens (MG855756.1; 93.93% identity). As above, this specimen may belong to Chaetoderma or Falcidens.
We use the clade-based high-level taxonomic names in
Neomenia gen. inc.
Fig.
Material examined. S0219: M18409.
Localities. Rio Bongo Scar (606 m).
Gymnomeniidae stet.
Fig.
Material examined. AD4990: M16924 (PQ435558; 16S: PQ304664).
Localities. Parrita Seep (1401 m).
Wirenia sp. SIO_BIC_M17072
Fig.
Material examined. S0219: M17072 (PQ435553; 16S: PQ304665).
Localities. Rio Bongo Scar (606 m).
Remarks. This undescribed species has keeled, leaf-like sclerites typical of Wirenia, but it is easily distinguished from all described species by the extremely small size (< 200 µm) of the sclerites.
Pholidoskepia stet.
Fig.
Material examined. AD4990: M16923 (PQ435557; 16S: PQ304663).
Localities. Parrita Seep (1401 m).
Remarks. Genetic data place this specimen within Pholidoskepia sensu
Amphimeniidae stet.
Fig.
Mollusca: Aplacophora: Solenogastres and Polyplacophora, representative live and SEM images A Amphimeniidae stet. (M12292) B Dorymenia stet. (M11997) C Dorymenia stet. (M16156, SEM) D Pruvotinidae stet. (M16880) E Pruvotinidae stet. (M16885, SEM) F Stenosemus sp. SIO_BIC_M12017 (M12017) G Stenosemus sp. SIO_BIC_M17044 (M17044) H Tripoplax balaenophila (M16186). Scale bars: 1 mm (A, B, D, F–H); 0.1 mm (C); 0.02 mm (E).
Material examined. AD4587: M12292 (PQ449404).
Localities. Mound 12 (996 m).
Pruvotinidae stet.
Fig.
Material examined. AD4978: M16880, M16885 (PQ435555).
Localities. Mound 12 (997 m).
Remarks. M16880 was associated with a hydroid (Co3639).
Stenosemus sp. SIO_BIC_M12017
Fig.
Material examined. AD4508: M12017 (16S: PQ304661).
Localities. Parrita Seep (1402 m).
Remarks. An undescribed species.
Stenosemus sp. SIO_BIC_M17044
Fig.
Material examined. S0218: M17044 (PQ449420).
Localities. Parrita Scar (1364 m).
Remarks. An undescribed species.
Tripoplax balaenophila (Schwabe & Sellanes, 2004)
Fig.
Material examined. AD4512: M12064 (PQ450384; 16S: PQ304667); AD4918: M16186.
Localities. Quepos Slide (338 m and ~ 344–411 m).
Distribution. Originally described from whale bones at 240 m, within the oxygen minimum zone, off Concepción, central Chile (36°29.9'S, 73°40.8'W) (
New records. Pending confirmation of the specimens from Mexico, our CRM specimens represent new northern records, new seep records, and a new maximum depth record for this species (specimen M12064, using 344 m as the most conservative value).
Remarks. Consistent with the previous reports of this species in hypoxic conditions, the CRM seep specimens were also collected within the oxygen minimum zone, although not in association with organic falls.
Leptochiton is paraphyletic and molecular taxonomic revision is needed (
Belknapchiton halistreptus (Dall, 1902)
Fig.
Mollusca: Polyplacophora, Bryozoa, and Entoprocta, representative live images A Belknapchiton halistreptus (M17045) B Hanleyella sp. SIO_BIC_M11969 (M11969) C Leptochiton cf. americanus (M12016) D Leptochiton cf. incongruus (M17067) E Leptochiton sp. SIO_BIC_M17068 (M17068; specimen length estimated < 3 mm, maximum 6 mm) F Bryozoa stet. (Ep220) G Entoprocta stet. (BI1162) H Entoprocta stet. (BI1166, detail). Scale bars: 1 mm.
Material examined. S0219: M17045 (PQ449421).
Localities. Rio Bongo Scar (609 m).
Distribution. Known only from the type locality off Acapulco, Mexico, 902–3436 m (
New records. The CRM specimen represents a new southern record and a new minimum depth record for this species.
Remarks. B. halistreptus is a member of the recently described genus Belknapchiton Sirenko, Saito & Schwabe, 2022. This genus of 22 species includes many of the worldwide chiton specimens obtained from deep water that were formally assigned to Leptochiton, and these generally require SEM observations to identify to species. The type species, B. belknapi (Dall, 1878), was described from 1840 m off the western Aleutian Islands and is widespread at depths of 100–3724 m in the Pacific, from the Izu-Ogasawara Trench through the Bering Sea and eastern Pacific as far south as central Chile (
Hanleyella sp. SIO_BIC_M11969
Fig.
Material examined. AD4501: M11969 (16S: PQ304660); AD4508: M12015; AD4588: M12131; AD4974: M16766, M16767; AD4978: M16841, M16842, M16883, M16884; AD4987: M16905.
Localities. Mound 12 (~ 1000 m), Parrita Seep (1402 m).
Remarks. These specimens represent an undescribed species with morphological and genetic similarities to H. oldroydi (Dall, 1919), which is found from Alaska to Baja California at depths of 18–455 m (
Leptochiton cf. americanus Kaas & Van Belle, 1985
Fig.
Material examined. AD4508: M12016; AD4973: M16725; AD4976: M16814; S0230: M17101, M17104, M17107 (PQ449425).
Localities. Parrita Seep (1419 m), Jacó Scar (1887 m), Mound Jaguar (1896–2000 m).
Remarks. All specimens except M16725 were associated with naturally occurring or experimentally deployed wood. These specimens may represent an undescribed species or new depth records of L. americanus, which was originally described from the Gulf of Panama, 1188 m, and is known from Oregon to Chile, 311–1400 m (
Leptochiton cf. incongruus (Dall, 1908)
Fig.
Material examined. S0219: M17067 (PQ449422).
Localities. Rio Bongo Scar (661 m).
Remarks. Associated with a naturally occurring wood fall. Possibly an undescribed species or a juvenile of L. incongruus, which was described from the Gulf of Panama, 589 m (
Leptochiton sp. SIO_BIC_M17068
Fig.
Material examined. S0219: M17068 (PQ449423; no voucher remaining after DNA extraction).
Localities. Rio Bongo Scar (661 m).
Remarks. An undescribed species associated with a naturally occurring wood fall.
Bryozoa stet.
Fig.
Material examined. AD4591: Ep245; AD4924: Ep220.
Localities. Parrita Seep (~ 1400–1410 m), Jacó Scar (~ 1752–1795 m).
Remarks. Encrusting on vesicomyid clams.
Entoprocta stet.
Fig.
Material examined. AD4919: BI1162; AD4921: BI1166.
Localities. Quepos Slide (~ 345–397 m).
Remarks. BI1162 was associated with the tube of a sabellid worm, Pseudopotamilla stet. (A8390). BI1166 was associated with a naturally occurring wood fall.
Fecampiida stet.
Fig.
Platyhelminthes, Chaetognatha, Nematoda, and Arthropoda: Pycnogonida, representative live images A Fecampiida stet. (Pt64, egg cocoon) B Fecampiida stet. (Pt64, detail of eggs) C Rhabditophora stet. (Pt72) D Chaetognatha stet. (BI1347) E Nematoda stet. (Nto35) F Colossendeis macerrima (C12792, wide view) G Colossendeis macerrima (C11151, detail) H Colossendeis stet. (C13919, wide view). Scale bars: 1 cm (A, H); 0.1 mm (B); 1 mm (C–E, G); 10 cm (F).
Material examined. AD4916: Pt64.
Localities. Jacó Scar (1854 m).
Remarks. This coiled cocoon of egg capsules was found on soft sediment. Fecampiid cocoons have been previously reported in association with gorgonians in the western Pacific, 92–295 m (
Rhabditophora stet.
Fig.
Material examined. AD4978: Pt66; AD4985: Pt68; AD4989: Pt72, Pt73.
Localities. Mound 12 (~ 995–1002 m), Jacó Scar (1768 m).
Remarks. Pt72 and Pt73 were associated with a tubeworm bush.
Chaetognatha stet.
Fig.
Material examined. AD4985: BI1347.
Localities. Mound 12 (991 m).
Nematoda stet.
Fig.
Material examined. AD4918: Nto35; AD4979: Nto64, Nto65, Nto66, Nto67; S0216: Nto68.
Localities. Quepos Slide (~ 275–400 m).
We list the major arthropod clades according to the phylogenetic relationships in
Many of the copepod, barnacle, and peracarid morphospecies in this study were represented by small single specimens and may represent undescribed species. To minimize the destruction of diagnostic features, we did not attempt extensive genetic investigation. Specimens are available for loan for future examination.
We list entries following the phylogeny in
Colossendeis macerrima Wilson, 1881
Fig.
Material examined. AD4509: C11151; AD4914: C12792 (PQ449344).
Localities. Jacó Scar (~ 974–1856 m).
Distribution. Considered cosmopolitan (Munilla and Soler Membrives 2009), originally described from the United States mid-Atlantic coast, 1686 m (
Remarks. The COI sequence of C12792 was 93.19–95.94% identical to sequences of Colossendeis macerrima (KF603929.1, KF603928.1, JN018213.1, FJ862873.1), with the closest BLASTN matches corresponding to specimens from southern Chile, 510 m (
Colossendeis stet.
Figs
Arthropoda: Pycnogonida and Copepoda, representative live images A Colossendeis stet. (C13919, detail) B Sericosura sp. SIO_BIC_C13774 (C13774) C Sericosura sp. SIO_BIC_C13775 (C13775) D Anoplodactylus gen. inc. (C13825, wide view) E Anoplodactylus gen. inc. (C13825, detail) F Bradophilidae stet. (A1451) G Cyclopoida sp. SIO_BIC_C12780 (C12780, dorsal view) H Cyclopoida sp. SIO_BIC_C12780 (C12780, ventral view). Scale bars: 1 cm (A); 1 mm (B–H).
Material examined. S0218: C13919 (PQ449356).
Localities. Parrita Scar (1153 m).
Remarks. An amphipod, Mesopleustes abyssorum (C13920), was attached to the palp of this specimen. The closest COI BLASTN results on GenBank were several species of Colossendeis with ~ 88% identity, e.g., C. colossea Wilson, 1881 (FJ716626.1, formerly C. gigas Hoek, 1881), C. australis Hodgson, 1907 (GQ387003.1), C. tortipalpis Gordon, 1932 (KT202204.1), and C. macerrima (JN018213.1). This level of COI divergence falls between the intraspecific (<10.4%) and interspecific (>13.36%) divergences reported for other pycnogonids (
Sericosura sp. SIO_BIC_C13774
Fig.
Material examined. AD4972: C13774 (PQ449350).
Localities. Jacó Scar (1795 m).
Remarks. An undescribed species.
Sericosura sp. SIO_BIC_C13775
Fig.
Material examined. AD4972: C13775 (PQ449351); AD4989: C13865.
Localities. Jacó Scar (1785–1795 m).
Remarks. An undescribed species.
Anoplodactylus gen. inc.
Fig.
Material examined. AD4978: C13793 (PQ449353); AD4985: C13825.
Localities. Mound 12 (~ 996–1002 m).
Remarks. Most likely Anoplodactylus, perhaps an undescribed species (Claudia Arango, pers. comm. 24 July 2022).
We thank Linsey Sala (Scripps Institution of Oceanography Pelagic Invertebrate Collection) for assistance with these identifications.
Bradophilidae stet.
Fig.
Material examined. AD4511: C14958 (no material remaining); AD4987: C14494.
Localities. Mound 12 (~ 988–1012 m).
Remarks. Egg masses were attached to the flabelligerid Bradabyssa cf. pilosa: C14958 on host A1451 and C14494 on host A9840.
Cyclopoida sp. SIO_BIC_C12780
Fig.
Material examined. AD4503: C11138; AD4587: C11184; AD4910: C12780 (PQ449343).
Localities. Mound 12 (~ 1000 m).
Remarks. Found in the mantle cavity of the solemyid clam Acharax cf. johnsoni: C11138 with clam M11980, C12780 with clam M15768.
Cyclopoida sp. SIO_BIC_C12807
Fig.
Arthropoda: Copepoda and Cirripedia, representative live images A Cyclopoida sp. SIO_BIC_C12807 (C12807) B Harpacticoida stet. (C13870) C Rhizocephala sp. SIO_BIC_C13776 (C13776) D Rhizocephala sp. SIO_BIC_C13875 (C13875) E Litoscalpellum sp. SIO_BIC_C11143 (C11143) F Litoscalpellum sp. SIO_BIC_C12782 (C12782) G Scalpellidae sp. SIO_BIC_C13851 (C13851) H Metaverruca gen. inc. (C11148). Scale bars: 1 mm (A, B, D, E, G, H); 1 cm (C, F).
Material examined. AD4918: C12807.
Localities. Quepos Slide (~ 333–408 m).
Harpacticoida stet.
Fig.
Material examined. AD4988: C13870.
Localities. Mound 11 (~ 1005–1025 m).
Caligus stet.
Material examined. AD4503:
Localities. Mound 11 (~ 1020 m), Mound 12 (~ 1000 m).
We list entries following the phylogeny in
Rhizocephala sp. SIO_BIC_C13776
Fig.
Material examined. AD4975: C13776 (PQ448998).
Localities. Mound 12 (1000 m).
Remarks. Parasite of a lithodid crab, Lithodes panamensis (C13787). The closest COI BLASTN results on GenBank were within Peltogastridae: Briarosaccus sp. (OR466125.1, 84.23% identity), Peltogaster boschmai Reinhard, 1944 from the San Juan Islands, Washington, USA (MN138416.1, 80.00% identity), and several sequences of P. lineata Shiino, 1943 from Korea and Japan (e.g., MK604142.1, 78.82% identity).
Rhizocephala sp. SIO_BIC_C13875
Fig.
Material examined. AD4989: C13875 (PQ449355).
Localities. Jacó Scar (1762 m).
Remarks. Parasite of a squat lobster, Munidopsis alvisca (C13876). The closest COI BLASTN results on GenBank were several species of Lernaeodiscus (Peltogastridae), e.g., L. ingolfi Boschma, 1928 from Norway (MN605966.1, 80.62% identity) and L. rybakovi Korn, Golubinskaya, Rees, Glenner & Høeg, 2020 from Vostok Bay, Russia (MN605964.1, 78.81% identity).
Litoscalpellum sp. SIO_BIC_C11143
Fig.
Material examined. AD4504: C11143.
Localities. Mound 11 (~ 1004–1011 m).
Remarks. Attached to a vestimentiferan tubeworm. Litoscalpellum is polyphyletic and revision is required (
Litoscalpellum sp. SIO_BIC_C12782
Fig.
Material examined. AD4913: C12782.
Localities. Jacó Scar (1885 m).
Scalpellidae sp. SIO_BIC_C13851
Fig.
Material examined. AD4990: C13851.
Localities. Parrita Seep (1401 m).
Metaverruca gen. inc.
Fig.
Material examined. AD4508: C11148.
Localities. Parrita Seep (~ 1401–1419 m).
Remarks. Likely Metaverruca. Attached to a tubeworm, Lamellibrachia barhami.
Newmaniverruca gen. inc.
Fig.
Arthropoda: Cirripedia, Stomatopoda, and Amphipoda, representative images. Live specimens are depicted unless otherwise specified A Newmaniverruca gen. inc. (C12794) B Verrucidae sp. SIO_BIC_C11144 (C11144) C Pyrgomatidae stet. (C12815) D Squilla biformis (C13807, dorsal view) E Squilla biformis (C13807, ventral view) F Hyperiidea stet. (C15409, preserved specimen) G Lycaea pulex (C14397) H Mesopleustes abyssorum (C13920). Scale bars: 1 mm (A–C, F, G); 1 cm (D, E, H).
Material examined. AD4916: C12794.
Localities. Jacó Scar (1611 m).
Remarks. Likely Newmaniverruca.
Verrucidae sp. SIO_BIC_C11144
Fig.
Material examined. AD4506: C11144.
Localities. Parrita Seep (~ 1030–1179 m).
Remarks. Likely Altiverruca or Newmaniverruca.
Pyrgomatidae stet.
Fig.
Material examined. AD4923: C12815.
Localities. Parrita Seep (~ 1041–1094 m).
Remarks. Associated with a coralliid (Co2947).
Squilla biformis Bigelow, 1891
Fig.
Reference.
Material examined. AD4979: C13807 (PQ449354), C13808 (MW867305); AD4986:
Localities. Quepos Slide (~ 380–395 m).
Distribution. Originally described from La Paz, Gulf of California, at 205 m (
Remarks. Telson morphology indicates that both specimens are female. To our knowledge this study is the first report of this well-known local species in the vicinity of seeps, notably within the oxygen minimum zone as characterized by
Several available checklists of eastern Pacific deep-sea peracarids (
Eucopia sculpticauda Faxon, 1893
Material examined. AD4513:
Localities. Jacó Scar (~ 1800 m).
Distribution. Originally described from several stations in the Gulf of Panama and off the Galápagos Islands, 1618–2487 m (
We list entries following the World Amphipoda Database (
We thank Linsey Sala for these identifications.
Hyperiidea stet.
Fig.
Material examined. AT15-59 Plankton Tow 6: C15409.
Localities. Jacó Summit (~ 350 m depth, ~ 400 m above the seafloor).
Lycaea pulex Marion, 1874
Fig.
Material examined. AT15-59 Plankton Tow 6: C14397.
Localities. Jacó Summit (~ 350 m depth, ~ 400 m above the seafloor).
Distribution. Considered common and widespread in tropical to warm-temperate oceans worldwide, typically 0–500 m depth (
Mesopleustes abyssorum (Stebbing, 1888)
Fig.
Material examined. S0218: C13920.
Localities. Parrita Scar (1153 m).
Distribution. Originally described from the subantarctic Indian Ocean off South Africa, 2926 m (
Remarks. Observed in situ attached to the palp of a pycnogonid, Colossendeis macerrima (C13919) and remained attached after collection.
Stenopleustes gen. inc.
Fig.
Arthropoda: Amphipoda, representative images. Live specimens are depicted unless otherwise specified A Stenopleustes gen. inc. (C12811) B Seba stet. (C13970) C Stenothoe sp. SIO_BIC_C13857 (C13857) D Stenothoe sp. SIO_BIC_C13867 (C13867) E Stenula stet. (C13784, preserved specimen) F Rhachotropis stet. (C13798) G Idunella gen. inc. (C13856) H Monoculodes stet. (C12801, preserved specimen). Scale bars: 1 mm.
Material examined. AD4507: C11146 (PQ450405), C14496; AD4916: C12788; AD4922: C12811.
Localities. Mound 12 (~ 967 m), Jacó Scar (~ 1852–1855 m), Parrita Scar (~ 1659–1667 m).
Remarks. C12811 was associated with an antipatharian coral (specific host not recorded). This morphospecies was identified as most likely Stenopleustes (Pleustidae), but an alternative identification is Stenothoidae. More detailed morphological examination of vouchers is needed.
Seba stet.
Fig.
Material examined. S0230: C13970.
Localities. Mound Jaguar (1896 m).
Remarks. Associated with a naturally occurring wood fall.
Stenothoe sp. SIO_BIC_C13857
Fig.
Material examined. AD4985: C13857.
Localities. Mound 12 (991 m).
Remarks. This morphospecies lacks eyes.
Stenothoe sp. SIO_BIC_C13867
Fig.
Material examined. AD4987: C13867.
Localities. Mound 12 (999 m).
Remarks. This morphospecies has eyes.
Stenula stet.
Fig.
Material examined. AD4974: C13784.
Localities. Mound 12 (992 m).
Remarks. Associated with experimental deployments of bone and wood.
Rhachotropis stet.
Fig.
Material examined. AD4507: C14497; AD4976: C13798.
Localities. Jacó Scar (1887 m), Parrita Scar (~ 1659–1667 m).
Remarks. Specimen C13798 may have been associated with experimentally deployed wood.
Idunella gen. inc.
Fig.
Material examined. AD4985: C13856.
Localities. Mound 12 (991 m).
Remarks. This morphospecies has eyes. It is most likely Idunella (Liljeborgiidae), but an alternative identification is Stenopleustes (Pleustidae). Further morphological examination is needed.
Monoculodes stet.
Fig.
Material examined. AD4507: C14495; AD4589: C11188 (PQ449341); AD4917: C12785; AD4922: C12801.
Localities. Mound 12 (965–997 m), Parrita Scar (~ 1659–1667 m).
Remarks. C12785 was associated with the antipatharian coral Lillipathes ritamariae. C12801 was associated with a basket star, Gorgonocephalus stet. (E7064).
Phoxocephalinae subfam. inc.
Fig.
Arthropoda: Amphipoda, representative images. Live specimens are depicted unless otherwise specified A Phoxocephalinae subfam. inc. (C13858) B Ambasiella stet. (C13917, preserved specimen) C Orchomene stet. (C13972) D Tryphosidae stet. (C13854) E Ambasiopsis stet. (C13790, preserved specimen) F Stegocephalidae stet. (C13976, preserved specimen) G Lepechinella stet. (C13929, preserved specimen) H Pardalisca stet. (C13928, preserved specimen). Scale bars: 1 mm.
Material examined. AD4984: C13858.
Localities. Mound 12 (998 m).
Ambasiella stet.
Fig.
Material examined. S0218: C13917.
Localities. Parrita Scar (1988 m).
Remarks. Associated with a xenophyophore.
Orchomene stet.
Fig.
Material examined. S0230: C13972, C13977.
Localities. Mound Jaguar (1895–1909 m).
Tryphosidae stet.
Fig.
Material examined. AD4974: C13785; AD4985: C13854.
Localities. Mound 12 (992–1002 m).
Remarks. C13785 was associated with experimental deployments of bone and wood.
Ambasiopsis stet.
Fig.
Material examined. AD4972: C13789, C13790.
Localities. Jacó Scar (1845 m).
Remarks. Associated with experimentally deployed pig bones.
Stegocephalidae stet.
Fig.
Material examined. S0230: C13976, C13978.
Localities. Mound Jaguar (1895–1908 m).
Lepechinella stet.
Fig.
Material examined. S0219: C13929.
Localities. Rio Bongo Scar (~ 480–650 m).
Pardalisca stet.
Fig.
Material examined. S0219: C13928.
Localities. Rio Bongo Scar (661 m).
Remarks. Associated with a naturally occurring wood fall.
Argissa sp. SIO_BIC_C13930
Fig.
Arthropoda: Amphipoda, representative images. Live specimens are depicted unless otherwise specified A Argissa sp. SIO_BIC_C13930 (C13930, preserved specimen) B Bonnierella stet. (C13797) C Gammaropsis gen. inc. (C13963, preserved specimen) D Bemlos gen. inc. (C13931, preserved specimen) E Protomedeiinae stet. (C14396) F Oradarea stet. (C13796) G Abludomelita gen. inc. (C11141) H Abludomelita stet. (C13896). Scale bars: 1 mm (A–G); 1 cm (H).
Material examined. S0219: C13930.
Localities. Rio Bongo Scar (~ 480–650 m).
Remarks. Possibly an undescribed species, requiring further comparison. Argissa is currently accepted as monotypic, with Argissa hamatipes (Norman, 1869) reportedly occurring across the northern hemisphere at depths of 4–1096 m (