Research Article |
|
Corresponding author: Johannes Bergsten ( johannes.bergsten@nrm.se ) Academic editor: Mariano Michat
© 2017 Johannes Bergsten, Elisabeth Weingartner, Jiří Hájek.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Bergsten J, Weingartner E, Hájek J (2017) Species delimitation of the Hyphydrus ovatus complex in western Palaearctic with an update of species distributions (Coleoptera, Dytiscidae). ZooKeys 678: 73-96. https://doi.org/10.3897/zookeys.678.12886
|
The species status of Hyphydrus anatolicus Guignot, 1957 and H. sanctus Sharp, 1882, previously often confused with the widespread H. ovatus (Linnaeus, 1760), are tested with molecular and morphological characters. Cytochrome c oxidase subunit 1 (CO1) was sequenced for 32 specimens of all three species. Gene-trees were inferred with parsimony, time-free bayesian and strict clock bayesian analyses. The GMYC model was used to estimate species limits. All three species were reciprocally monophyletic with CO1 and highly supported. The GMYC species delimitation analysis unequivocally delimited the three species with no other than the three species solution included in the confidence interval. A likelihood ratio test rejected the one-species null model. Important morphological characters distinguishing the species are provided and illustrated. New distributional data are given for the following species: Hyphydrus anatolicus from Slovakia and Ukraine, and H. aubei Ganglbauer, 1891, and H. sanctus from Turkey.
Dytiscidae , Hyphydrus , new records, Palaearctic region, Slovakia, Turkey, Ukraine, GMYC, species delimitation, reciprocal monophyly
The genus Hyphydrus Illiger, 1802 represents a well-defined group of medium sized, globular shaped Dytiscidae. Altogether 139 species occur in all regions of the Old World, with most species distributed in tropical Africa (
Only three Hyphydrus species occur in Europe (cf.
With the advance of DNA Barcoding, extraction and amplification techniques have moved forwards in two directions. First towards high-throughput low-cost facilities racing from specimens to barcodes (
In this study, one of the three focal species is very rarely collected hence we attempt to amplify a >800bp segment of cytochrome c oxidase subunit 1 (CO1), from 19–25 years old dry-mounted specimens. We do this by using additives to standard DNA extraction lysis solutions and designing a number of internal primers to amplify the target segment in six short but overlapping fragments. Extractions are done on whole body but completely non-destructive, an important requirement for invaluable museum specimens.
We also use the general mixed Yule coalescence model (
To clarify the status and distribution of Hyphydrus anatolicus and H. sanctus, we provide a basal differential diagnosis of both species and related H. ovatus. We confirm the specific status of all taxa with molecular analysis. In addition, we review published records and add new faunistic data for H. anatolicus and H. sanctus, as well as the first record of H. aubei from Turkey.
Hyphydrus ovatus was sampled throughout Europe. We acquired fresh material of H. anatolicus from Russia and dry-mounted specimens from Turkey, Greece and Slovakia. Hyphydrus sanctus was available only as dry-mounted specimens from Israel and Turkey for molecular analysis; H. aubei was used as an outgroup in the parsimony and non-clock analyses. The specimens included in this study are deposited in the following institutional collections; for specimens included in molecular analysis, see Table
Data on extracted specimens, depository, catalogue number and genbank accession number for the CO1 fragment.
| Cat. ID | Species | Country | Region | Place | Date | Lat / Lon | Collector | Depository | CO1bp | Acc. No. | |
|---|---|---|---|---|---|---|---|---|---|---|---|
| 704819 | Hyphydrus ovatus | UK:Scotland | Carrick | Kirkcudbrightshire, Syllodioch | 25:VI:2005 | 55.215N, -4.499W | G.N. Foster | NHM: |
825 | FN998871 | |
| 721926 | Hyphydrus aubei | Spain | Tarragona | riu Algars, Horta de San Joan | 26:V:2005 | 40.991N, 0.277E | I. Ribera | NHM: |
825 | FN998872 | |
| 722129 | Hyphydrus ovatus | UK:England | Norfolk | East Harling Common | 10:VII:2005 | 52.451N, 0.942E | G. Nobes | NHM: |
825 | FN998873 | |
| 722301 | Hyphydrus ovatus | UK:Scotland | Carrick | Boreland of Girthon, Kirkcudbrightshire | 02:VII:2005 | 55.215N, -4.499W | G.N. Foster | NHM: |
788 | FN998874 | |
| 722447 | Hyphydrus ovatus | UK:England | Norfolk | Thompson Common | 03:VII:2005 | 52.532N, 0.855E | G. Nobes | NHM: |
689 | FN998875 | |
| 724810 | Hyphydrus ovatus | UK:England | Norfolk | Thompson Common | 25:IX:2005 | 52.529N, 0.854E | G. Nobes | NHM: |
731 | FN998876 | |
| 749803 | Hyphydrus ovatus | Sweden | Ångermanland | Torrböle | 12:VI:2005 | 63.716N, 19.558E | AN. Nilsson | NHM: |
751 | FN998877 | |
| 729468 | Hyphydrus ovatus | Sweden | Öland | Borgholm, Langlöt | 20:VI:2005 | 56.747N, 16.685E | J. Geijer | NHM: |
702 | FN998878 | |
| 729591 | Hyphydrus ovatus | Sweden | Öland | Borgholm, Högsrum | 19:VII:2005 | 56.795N, 16.598E | J. Geijer | NHM: |
825 | FN998879 | |
| 729653 | Hyphydrus ovatus | Latvia | Riga district | Gaujus National Park, Sigulda, Maza velnala | 10:VI:2005 | 57.152N, 24.865E | L. Hendrich | NHM: |
825 | FN998880 | |
| 729731 | Hyphydrus ovatus | Latvia | Cesis district | Gaujas National Park, Klamani village | 11:VI:2005 | 57.3N, 25.25E | L. Hendrich | NHM: |
825 | FN998881 | |
| 743243 | Hyphydrus ovatus | Germany | Bavaria | Eitting, Eittinger Moos | 19:VI:2005 | 48.3N, 11.933E | M. Balke | NHM: |
825 | FN998882 | |
| 743298 | Hyphydrus ovatus | Germany | Brandenburg | 1.5 km N Fresdorf | 18:X:2005 | 52.267N, 13.083E | L. Hendrich | NHM: |
750 | FN998883 | |
| 743957 | Hyphydrus ovatus | Germany | Bavaria | Murnauer Moos, Rollisch See | 06:IX:2005 | 47.683N, 11.2E | M. Balke | NHM: |
825 | FN998884 | |
| 743962 | Hyphydrus ovatus | Sweden | Öland | Borgolm, Vanserum | 16:VIII:2005 | 56.691N, 16.641E | J. Geijer | NHM: |
825 | FN998885 | |
| 743968 | Hyphydrus ovatus | Sweden | Öland | Borgolm, Runsten | 07:VII:2005 | 56.716N, 16.633E | J. Geijer | NHM: |
825 | FN998886 | |
| 743973 | Hyphydrus ovatus | Sweden | Öland | Mörbylånga, Algustrum | 27:VIII:2005 | 56.687N, 16.598E | J. Geijer | NHM: |
825 | FN998887 | |
| 800099 | Hyphydrus ovatus | Russia | Volgograd Obl | between Lisov & Polodin | 29:IV:2002 | 48.617N, 43.169E | J. Bergsten | NRM: |
825 | FN998888 | |
| 800100 | Hyphydrus anatolicus | Russia | Volgograd Obl | between Lisov & Polodin | 29:IV:2002 | 48.617N, 43.169 | J. Bergsten | NRM: |
825 | FN998889 | |
| 800104 | Hyphydrus anatolicus | Russia | Volgograd Obl | between Lisov & Polodin | 30:IV:2002 | 48.617N, 43.169E | J. Bergsten | NRM: |
825 | FN998890 | |
| 800105 | Hyphydrus anatolicus | Russia | Volgograd Obl | Artyedinsko Donskie Peski | 03:V:2002 | 49.686N, 43.333E | J. Bergsten | NRM: |
825 | FN998891 | |
| 800108 | Hyphydrus ovatus | Russia | Volgograd Obl | Krasnoslobodsk N.P. | 4-5:V:2002 | 48.7N, 44.6E | J. Bergsten | NRM: |
825 | FN998892 | |
| 800109 | Hyphydrus anatolicus | Russia | Volgograd Obl | Kretskiy | 05:V:2002 | 48.608N, 44.706E | J. Bergsten | NRM: |
825 | FN998893 | |
| 800115 | Hyphydrus ovatus | Russia | Volgograd Obl | Baybaev, river Don | 8-11:V:2002 | 49.175N, 44.007E | J. Bergsten | NRM: |
825 | FN998894 | |
| 824863 | Hyphydrus ovatus | UK:England | Cornwall | The Lizard Hayle Kimbro pool | 01:VII:2005 | 50.255N, -5.242W | D. Bilton | NHM: |
825 | FN998895 | |
| JLKB241 | Hyphydrus sanctus | Israel | Hula reserve | 21:III:1985 | 33.103N, 35.609E | M. Jäch |
|
825 | FN998896 | ||
| JLKB242 | Hyphydrus sanctus | Israel | Talme Elazar | 21:IV:1986 | 32.445N, 34.978E | M. Jäch |
|
825 | FN998897 | ||
| JLKB243 | Hyphydrus sanctus | Turkey | Mugla | Köycegiz | 27:V:1991 | 36.973N, 28.686E | M. Jäch |
|
147 | FN998898 | |
| JLKB244 | Hyphydrus sanctus | Turkey | Mugla | Köycegiz | 27:V:1991 | 36.973N, 28.686E | Schödl |
|
665 | FN998899 | |
| JLKB518 | Hyphydrus anatolicus | Turkey | Mugla | Köycegiz | 27:V:1991 | 36.973N, 28.686E | Schödl |
|
825 | JX221701 | |
| JLKB519 | Hyphydrus anatolicus | Slovakia | Slov. Mer. | Tvrdosovce, 1 km N of Tvrdosovce | 24:IV:2000 | 48.147N, 18.065E | T. Kopecky |
|
825 | JX221702 | |
| JLKB520 | Hyphydrus anatolicus | Greece | Chalkidiki | Sithonia, 2 km S Kalamitsi | 12:VIII:2000 | 39.97N, 23.988E | J. Hotovy |
|
825 | JX221703 |
HFCB Hans Fery collection, Berlin, Germany (property of
The extraction protocol was different for the fresh alcohol-material of H. ovatus and H. anatolicus (from Russia) versus the dry-mounted older material of H. anatolicus and H. sanctus. The former was extracted in 96-well Wizard SV plates following the manufacturers instructions (Promega). The 3’ end of cytochrome c oxidase subunit 1 (CO1) was amplified with the primers PatDyt or RonDyt (
Newly designed primers (apart from Jerry and PatDyt) used to amplify 825bp of CO1 in 6 overlapping fragments from 11-25 years old, dry-pinned, Hyphydrus specimens.
| Primer | 5’ à 3’ | Pair | Length |
|---|---|---|---|
| Jerry | CAACATTTATTTTGATTTTTTGG | 1 | 178bp |
| Hyp178rw | AATATGCTCGAGTATCAAC | 1 | |
| Hyp161fw | GTTGTATGAGCTCATCATATA | 2 | 189bp |
| Hyp349rw | TAGATGAATTTGCAAGGACTAC | 2 | |
| Hyp276fw | AGCTACCCTTCACGGATCTC | 3 | 125bp |
| Hyp400rw | CATAATGAAAGTGAGCCACTAC | 3 | |
| Hyp371fw | GTAGTCCTTGCAAATTCATCT | 4 | 228bp |
| Hyp598rw | CAGGATAGTCTGAGTAACG | 4 | |
| Hyp507fw | TTACAGGACTATCATTAAATTCTA | 5 | 147bp |
| Hyp653rw | CTCCAATAAATGATATAGTAGATC | 5 | |
| Hyp616fw | CTCGACGTTATTCAGACTATCC | 6 | 210bp |
| Patdyt | TCATTGCACTAATCTGCCATATTAG | 6 |
Sequences were assembled and edited in Sequencher 4.8 (Gene Codes Corporation) and aligned in ClustalX 2.0 (
The specimens were examined using an Olympus SZX12 stereomicroscope. Measurements were taken with an ocular graticule. Habitus photographs were taken using a Canon MP-E 65mm f/2.8 macro lens with 5:1 optical magnification on bellows attached to a Canon EOS 550D camera. Drawings were made based on photographs taken using an Olympus SZX12 microscope equipped with a Canon EOS 1100D digital camera. Images of the same specimen/structure at different focal planes were combined using Helicon Focus 5.1.19 software. To avoid artefacts due to desiccation of poorly sclerotised parts, the genitalia were illustrated mounted in dimethyl hydantoin formaldehyde resin (DMHF) on the same card as the beetle.
Amplification was highly successful with the short fragment PCRs of old dry-mounted material (Table
| Species | GUID |
Country | Specimen state | Age (years) | Bp | Ambiguous base calls |
|---|---|---|---|---|---|---|
| Hyphydrus anatolicus | JLKB000000518 | Turkey | Dry-mounted | 20 | 825 | 0 |
| Hyphydrus anatolicus | JLKB000000519 | Slovakia | Dry-mounted | 11 | 825 | 0 |
| Hyphydrus anatolicus | JLKB000000520 | Greece | Dry-mounted | 11 | 825 | 0 |
| Hyphydrus sanctus | JLKB000000244 | Turkey | Dry-mounted | 20 | 665 | 0 |
| Hyphydrus sanctus | JLKB000000241 | Israel | Dry-mounted | 25 | 825 | 0 |
| Hyphydrus sanctus | JLKB000000242 | Israel | Dry-mounted | 24 | 825 | 0 |
| Hyphydrus sanctus | JLKB000000243 | Turkey | Dry-mounted | 20 | 147 | 3 |
Genetic distances between the three presumed species in the ovatus-complex turned out to be large (Table
Majority-rule consensus tree from the non-clock Bayesian analysis. Posterior probability clade support values >0.9 shown. Country abbreviations: SW=Sweden, GE=Germany, UK=United Kingdom, La=Latvia, RU=Russia, TU=Turkey, IS=Israel, GR=Greece, SL=Slovakia. Rooted (midpoint) with Hyphydrus aubei.
One of 14 most parsimonious trees (L=203, zero-length branches hard-collapsed) with unambiguous characters optimized. Black dots=non-homoplasious characters, white dots=homoplasious characters. Numbers refer to the character’s position in the alignment from 1-825. The other 13 cladograms only differed in within-species internal organizations. Rooted with Hyphydrus aubei. Country abbreviations as in Figure
Clock-rooted ultrametric tree from Bayesian analysis with branches coloured according to the GMYC species delimitation analysis. Posterior probability clade support values >0.9 shown. Black branches=speciation events, red braches=within species coalescence events. Country abbreviations as in Figure
Genetic distances between species calculated with Kimura 2-parameter model. Pairwise deletion of missing data was used, and the shortest fragment of H. sanctus (147bp) was deleted from comparison.
| H. ovatus | H. anatolicus | H. sanctus | H. aubei | |
|---|---|---|---|---|
| H. ovatus | 0.000–0.014 | / | / | / |
| H. anatolicus | 0.102–0.114 | 0.001–0.002 | / | / |
| H. sanctus | 0.094–0.107 | 0.067–0.071 | 0.001–0.008 | / |
| H. aubei | 0.119–0.126 | 0.125–0.128 | 0.132–0.138 | - |
All mentioned species belong to the Hyphydrus ovatus species group sensu
Due to rather weak sclerotisation of external genitalia, the genital characters have only limited use for identification of species in this complex. Therefore, we focused more on habitus, punctuation and structure characters of the species. The most diagnostic character is probably the shape of the longer metatibial spur on males (see Fig.
Hyphydrus anatolicus Guignot, 1957: 91 (orig. descr.; type locality: “Angora” [Ankara, Turkey]).
Hyphydrus
carrarai
Sanfilippo, 1963: 77 (orig. descr.; type locality: “Macchia di Migliarino, Torre del Lago (Toscana)” [Italy]); synonymy by
Hyphydrus
sanctus
:
Bosnia and Hercegovina:
Greece: 2♂♂, Ionian Islands, Kerkyra, Chalikiopoulos [lagoon], 22.iv.1935 (
Habitus as depicted in Figs
Male. Longer metatibial spur long, nearly as long as metatarsomere I-II combined (Fig.
Female. Both shiny and matt forms known of females of H. anatolicus. Shiny form agreeing well with male; matt form with whole surface densely reticulated, meshes somewhat elongate on elytra. Large punctures well visible, small punctures indistinct among reticulation. Longer tibial spur shorter than in male; broad and with serration in basal two thirds, narrowed, slightly curved and without serration in apical third. Female genitalia as in Fig.
The species inhabits various types of standing water, predominantly densely vegetated pools, ditches and small ponds. H. anatolicus tolerates also saline habitats.
The species is distributed in the Eastern Mediterranean and in south-eastern Europe. It occurs in Italy, southernmost Slovakia, Hungary, the Balkan Peninsula, Turkey, southern Ukraine and Russia up to latitude 55° and east to the Ural Mountains (Fig.
Hyphydrus male and female genitalia. a, h, o median lobe of aedeagus in ventral view b, i, p supplementary drawing of apex of median lobe c, j, q median lobe of aedeagus in lateral view d, k, r paramere e, l, s gonocoxa f, m, t gonocoxosternite g, n, u spermatheca. a–g H. anatolicus h–n H. ovatus o–u H. sanctus. Scale bar 0.5 mm.
Dytiscus ovatus Linnaeus, 1760: 547 (type locality: Svecia [Sweden]). For full list of synonymy, see Nilsson & Hájek (2017a: 199).
We have examined more than 600 specimens from the Czech Republic, Finland, France, Germany, Great Britain, Russia, Slovakia, Sweden, and Ukraine, deposited in
Habitus as depicted in Figs
Male. Longer metatibial spur short, only slightly longer than metatarsomere I (Fig.
Female. Both shiny and matt forms are known for females of H. ovatus. Shiny form agreeing well with male; matt form with whole surface densely reticulated, meshes distinctly elongate on elytra. Large punctures well visible, small punctures indistinct among reticulation. Longer tibial spur similar to that of male. Female genitalia as in Fig.
The species inhabits various types of standing and slowly flowing water bodies with at least some vegetation. The typical habitats represent (frequently eutrophic) ponds, densely vegetated pools, ditches, oxbows or open swamps.
Widely distributed Palaearctic species. With the exception of the Iberian Peninsula, it occurs in most of territory of Europe and temperate Asia east to the Baikal Lake (east Siberia).
Hyphydrus sanctus Sharp, 1882: 380.
Israel:
Israel: 2♂♂, 1♀, Hula reserve, 21.iii.1985; 4♂♂, 8♀♀, same locality, but 13.iv.1986; 1♂, 3♀♀, Talme Elazar, 21.iv.1986; 1♂, 6♀♀, Magan Michael, 21.iv.1986, all M. Jäch leg. (
Habitus as depicted in Figs
Male. Longer metatibial spur long, nearly as long as metatarsomere I-II combined (Fig.
Female. Only matt females of H. sanctus are known so far. Whole surface densely reticulated, meshes on elytra somewhat elongate. Large punctures well visible, small punctures indistinct among reticulation. Longer tibial spur similar to that of male, but almost straight in apical third. Female genitalia as in Fig.
Similarly to the other two species, H. sanctus inhabits various types of standing and slowly flowing water bodies with at least some vegetation.
A species distributed in the Levant region of the Near East. So far recorded from several localities in Israel, Jordan and Syria (Fig.
Hyphydrus aubei is the fourth European species in the Hyphydrus ovatus species group sensu
Turkey: 1♂, 2♀♀, Muğla vil. [=province], Köyçeğiz, 27.v.1991, S. Schödl leg. (
Predominantly a Mediterranean species. First record from Turkey.
Key to western Palearctic species of the Hyphydrus ovatus species group
| 1 | Elytra with distinct black maculate colour pattern on elytra; head bicoloured, testaceous anteriorly but distinct black areas posteriorly (Figs |
Hyphydrus aubei |
| – | Elytra unicoloured, dark ferrugineous to ferrugineous, or with vaguely delimited lighter macula basally and laterally on elytra; head unicoloured, testaceous to dark ferrugineous (Figs |
2 |
| 2 | Punctation of pronotum and elytra (males and shiny females) very coarse; distance between larger punctures smaller than their diameter. Longer male metatibial spur only little longer than metatarsomere I; straight and with distinct serration (Fig. |
Hyphydrus ovatus |
| – | Punctation of pronotum and elytra (males and shiny females) finer; distance between larger punctures larger than their diameter. Longer male metatibial spur almost as long as metatarsomeres I-II combined; spur not straight, bisinuate or apically curved; serration of spur small to indistinct (Fig. |
3 |
| 3 | Clypeus with anterior margin medially nearly straight; exterior side of metatibia almost straight; longer male metatibial spur straight basally but curved apically and with serration small but visible (Fig. |
Hyphydrus sanctus |
| – | Clypeus with anterior margin rounded; exterior side of metatibia somewhat sinuous; longer male metatibial spur bisinuate and with indistinct serration basally (Fig. |
Hyphydrus anatolicus |
Our findings from molecular and morphological data unambiguously support the presence of three species of the Hyphydrus ovatus complex in the western Palaearctic and the names H. ovatus, H. anatolicus and H. sanctus are the oldest available names for these three species. The additional distributional findings of H. anatolicus and H. sanctus indicate, that the distribution of the H. ovatus complex is more complex in the eastern part of its range than previously thought. A revision of all previous records of H. ovatus from the Balkan Peninsula and further east is needed. It is highly probable that many records may refer to the other two species, but whether H. ovatus is replaced by, or sympatric with, these remain to be investigated for many areas.
We are obliged to all colleagues mentioned in the list of collections for putting specimens at our disposal. Special thanks goes to Hans Fery (Berlin, Germany) who provided us with the specimens of H. anatolicus from Peloponnesus and reviewed the manuscript. The work of J. Hájek was supported by the Ministry of Culture of the Czech Republic (DKRVO 2017/14, National Museum, 00023272) and by the SYNTHESYS project (SE-TAF 386).