Research Article
Print
Research Article
Galkinius Perreault, 2014 or Darwiniella (Anderson, 1992)? A new coral-associated barnacle sharing characteristics of these two genera in Pacific waters (Crustacea, Cirripedia, Thoracica, Pyrgomatidae)
expand article infoBenny Kwok Kan Chan‡, Jennie Chien Wen Liu§
‡ Biodiversity Research Center, Taipei, Taiwan
§ National Taiwan University, Taipei, Taiwan

Corresponding author: Benny Kwok Kan Chan ( chankk@gate.sinica.edu.tw )

Academic editor: Danielle Defaye
© 2017 Benny Kwok Kan Chan, Jennie Chien Wen Liu.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Chan BKK, Liu JCW (2017) Galkinius Perreault, 2014 or Darwiniella (Anderson, 1992)? A new coral-associated barnacle sharing characteristics of these two genera in Pacific waters (Crustacea, Cirripedia, Thoracica, Pyrgomatidae). ZooKeys 719: 1-22. https://doi.org/10.3897/zookeys.719.12471
ZooBank: urn:lsid:zoobank.org:pub:E29D8657-F8B2-4BD3-B372-EA634962396E
Open Access

Abstract

A new species of coral associated barnacle (Balanomorpha: Pyrgomatidae) sharing morphological features of Darwiniella (Anderson, 1992) and Galkinius Perreault, 2014 is described. It has a fused shell and opercular plates, characteristic of Darwiniella. However, the morphology of the tergum and somatic body are closer to Galkinius. Sequence divergence of mitochondrial DNA 12S rDNA and COI reveals this new species clusters with the Galkinius clade. Therefore this new form is assigned to the genus Galkinius, as G. maculosus sp. n. Concomitantly the diagnosis of Galkinius is emended to include species with fused or four- plated shells and fused opercular plates. The new species is distinct from all Galkinius species in having a fused shell. It inhabits the corals Lobophyllia spp. and is distributed from the Dongsha Atoll in the South China Sea, Orchid Island of Taiwan in the Pacific Ocean, to Madang in Papua New Guinea waters.

Keywords

Barnacles, corals, Pyrgomatidae , host specificity

Introduction

Barnacles in genus Galkinius Perreault, 2014 are coral associated species of the family Pyrgomatidae. Species of Galkinius were originally grouped under the genus Creusia Leach, 1817 by Darwin (1854). Ross and Newman (1973) revised the taxonomy of pyrgomatid barnacles and redefined Creusia as having a 4-plated shell but a fused scutum and tergum. Galkin (1986) established a new genus Utinomia Galkin, 1986 to accommodate Creusia species which had a broad adductor plate and a rostral tooth in the scutum. However, the generic name Utinomia is preoccupied by Utinomia Tomlinson, 1963 for an acrothoracican barnacle (Tomlinson 1963). Ross and Newman (1995) renamed Utinomia as Galkinia, and designated G. indicum (Annandale, 1924) as the type species. Perreault (2014) pointed out the generic name Galkinia Ross & Newman, 1995 was preoccupied by a genus of fossil fish, Galkinia Ghekker, 1948 (Actinopterygii: Pholidophoriformes). He therefore renamed Galkinia as Galkinius Perreault, 2014, thereby continuing to recognize Galkin’s contribution to cirripede taxonomy.

According to Ross and Newman (1973) and Ogawa (2000), there were three Galkinius species including G. decima (Ross & Newman, 1973), G. indica (Annandale, 1924), and G. supraspinulosa Ogawa, 2000. Chan et al. (2013) subsequently identified five new species of Galkinius in Taiwan waters (also see Tsang et al. 2014). Simon-Blecher et al. 2016 revealed there is geographical variation in the opercular plate morphology of Galkinius in the Indo-Pacific waters, and that there were four additional un-named cryptic species in the region suggesting there was considerably more diversity to be explored in the Pacific.

In this study, 39 specimens of a new pyrgomatid barnacle were collected in the Pacific region (Dongsha Atoll, Orchid Island in Taiwan waters and Madang in Papua New Guinea). This undescribed species has four plated shells and a fused operculum plate, which are characteristics of Darwiniella (Anderson, 1992). However, the somatic body and the shape of tergum is very similar to Galkinius. From sequence divergence in mitochondrial 12S rDNA (12S) and cytochrome c oxidase subunit I (COI) gene, this new species is closer to Galkinius than it is to Darwiniella. Therefore it was decided to classify it in the genus Galkinius. The diagnosis of Galkinius is emended to accommodate this new species of Galkinius which shares many characters with Darwiniella.

Materials and methods

Specimen sampling and morphological analysis

The undescribed Galkinius species was sampled in Pacific waters, including the outlying islands of Taiwan waters (Dongsha Atoll in the South China Sea, Orchid Island in the Pacific Ocean) and Madang in the waters of Papua New Guinea (Fig. 1). Barnacles were collected with small pieces of their coral host using hammers and chisels when SCUBA diving and then fixed in 95% EtOH. Holotype and paratype specimens are stored in the Biodiversity Museum of the Academia Sinica, Taipei, Taiwan (ASIZCR), and the National Museum of Natural History, Paris, France (NMNH). Additional specimens are stored in the Coastal Ecology Laboratory, Academia Sinica, Taiwan (CEL). After barnacle specimens were removed from the host coral with forceps, they were examined under light microscopes (LM; Zeiss Scope A1) and scanning electron microscopes (SEM; FEI Quanta 200) to further describe their morphological characters, including hard parts (shell and opercular valves) and the somatic body (cirri, penis and mouth parts). To determine the structure and articulations between individual shell parts, all the barnacle tissue, coral tissue and other organic debris adhering to the shell and the opercular valves were carefully removed by forceps, and then 1.5% bleach was used to digest the remaining tissue. After immersion in bleach for approximately three hours, the remaining organic tissue could then be torn off easily by forceps. The cleaned shells were rinsed with water for approximately 30 minutes and air-dried. The shell and opercular valves were coated with gold and then observed under SEM following the methods of Chan et al. (2013). The somatic body, including the six pairs of cirri, the penis, and the mouth parts were dissected out and observed under LM. Setal descriptions are based on Chan et al (2008).

Figure 1. 

Collection sites of the Galkinius maculosus sp. n. in the Pacific waters.

Molecular analysis

Total genomic DNA was extracted from soft tissue of individual specimens using a Qiagen (Chatsworth, CA) QIAquick Tissue Kit following the manufacturer’s instructions. Partial sequences of mitochondrial genes 12S rDNA (12S) and cytochrome c oxidase subunit I (COI) were amplified by polymerase chain reaction (PCR) with primer 12S-FB and 12S-R2 (Tsang et al. 2009), and COI-F5 5’ AAACCTATAGCCTTCAAAGCT 3’ and COI-R4 5’ GTATCHACRTCYATWCCTACHG 3’, respectively. The PCR solution contained 40 ng of template DNA, 5 μl Taq DNA Polymerase Master Mix (1.5 mM MgCl2; Ampliqon, Denmark), 1 μM of each primer, and ddH2O with a final volume of 10 μl. The PCR reaction was conducted under the following conditions: 2 min at 95 °C for initial denaturing, 35 cycles of 30 sec at 95 °C, 1 min at 48 °C, 1 min at 72 °C with a final extension for 5 min at 72 °C. The PCR products were then purified using the DNA Gel purification kit (Tri-I Biotech, Taipei, Taiwan). Direct sequencing of the purified PCR products was performed on an ABI 3730XL Genetic Analyzer with BigDye terminator cycle sequencing reagents (Applied Biosystems, Foster City, California, USA). Sequences were then aligned with BioEdit Sequence Alignment Editor V7.2.5 (Hall et al. 2013) using default settings and adjusted by eye.

The genealogical relationships of specimens based on 12S were inferred using both Maximum Composite Likelihood model, 1000-replicate Neighbor-Joining (NJ) method and T92 model, 1000-replicate Maximum Likelihood (ML) method implemented in MEGA v7.0.14 (Kumar et al. 2016). We reconstructed the relationship between three species of Darwiniella (Darwiniella angularis, D. conjugatum, and D. maculosus sp. n.) and eight Galkinius Perreault, 2014 species (Galkinius adamanteus Chan, Chen & Lin, 2013, G. equus Chan, Chen & Lin, 2013, G. decima (Ross & Newman, 1973), G. tabulatus Chan, Chen & Lin, 2013, G. depressa Chan, Chen & Lin, 2013, G. altiapiculus Chan, Chen & Lin, 2013, G. trimegadonta Chan, Chen & Lin, 2013, and G. indica (Annandale, 1924). Additionally, five specimens of the coral barnacle Nobia grandis Sowerby, 1839 were used as the outgroup. Additionally, three sequences of Darwiniella spp. and four sequences of Galkinius species form Malay and Michonneau 2014 were downloaded from EMBL and added into the analysis. The evolutionary distance (number of base differences per site) between sequence pairs was calculated with uncorrected p-distance and Tamura 3-parameter model (T92) models by MEGA.

Results

Systematics

Suborder Balanomorpha Pilsbry, 1916

Family Pyrgomatidae Gray, 1825

Subfamily Pyrgomatinae Gray, 1825

Galkinius Perreault, 2014

Diagnosis (emended)

Shell wall fused or four plated, flat, with high radial ridges at the junction with coral skeleton. Scutum and tergum fused, the two parts being approximately subequal. Adductor ridge and lateral depressor muscle scars absent, adductor plate and rostral tooth present. Tergal spur well developed and wide. Apertural frill coloured and spotted. Maxilla and cirri with numerous dark spots and bands.

Type species

Galkinius indica (Annandale, 1924).

Remarks

In the original diagnosis of Galkinius, the shell consisted of four separated plates and the fused scutum and tergum, which differs from Darwiniella which has a fused shell as well as a fused scutum and tergum. In the present study, a new species of Galkinius was identified as having a fused shell wall. Therefore it is necessary to emend the diagnosis of Galkiniusto accommodate this species (see discussion below). Galkinius differs from Darwiniella in having much wider tergal spur and tergal furrow. Height of the adductor ridge of the scutum in Darwiniella is much greater than in species of Galkinius. In Darwiniella, the height of adductor ridge is approximately 2/3 to 1/2 total height of scutum. In Galkinius, height of adductor plate is often approximately 1/3 of the total height of scutum. Maxilla of Galkinius and cirri with large number of coloured spots and bands, when compared to Darwiniella. The apertural frills of Darwniella angularis and D. conjugatum are white, while Galkinius has a coloured or spotted aperture frill.

Galkinius maculosus sp. n.

http://zoobank.org/E4DA73E3-3E73-4F6C-B238-704943136D65

Material examined

HOLOTYPE. ASIZCR000343, SE of Dongsha outer atoll, Taiwan (20°36.937'N, 116°53.143'E), June 2015, coll. Pei-Chen Tsai,Yao-Fong Tsao, and Yen-Wei Chang, on coral host Lobophyllia de Blainville, 1830 sp. PARATYPES. ASIZCR000344, NW of Dongsha Atoll, Taiwan (20°36.173'N, 116°52.110'E), May 2015, coll. Pei-Chen Tsai,Yao-Fong Tsao, and Yen-Wei Chang, on coral host Lobophyllia sp. ASIZCR000345, NE of Dongsha Atoll, Taiwan (20°46.616'N, 116°47.203'E), May 2015, coll. Pei-Chen Tsai,Yao-Fong Tsao, and Yen-Wei Chang, on coral host Lobophyllia sp., ASIZCR000346, Dongsha wreck (20°42.282'N, 116°42.097'E), May 2014, coll. Chen Hsi-Nien, and Pei-Chen Tsai, on coral host Lobophyllia agaricia (Milne Edwards & Haime, 1849). MNHN-IU-2016-8720, PKK2, Madang, Papua New Guinea, November 2012, coll. B.K.K. Chan, on coral host Lobophyllia radians (Milne Edwards & Haime, 1849) Edwards & Haime, 1849. ADDITIONAL SPECIMENS. CEL-LAN-075-09, Rock Yunuyen, Orchid Island, Taiwan (22°08.111'N, 121°52.000'E), October 2007, coll. B.K.K. Chan, coral host unknown. CEL-DSA-012-1-9, Dongsha wreck, Taiwan (20°42.282'N, 116°42.097'E), May 2014, coll. Pei-Chen Tsai, on coral host Lobophyllia agaricia. CEL-DSA-075, Dongsha wreck, Taiwan (20°46.767'N, 116°48.402'E), August 2015, coll. Pei-Chen Tsai, Yao-Fong Tsao, and Yen-Wei Chang, on coral host Lobophyllia sp., CEL-DSA-084-1, 2, 4, 5, data same as paratype ASIZCR000344. CEL-DSA-097-1, 2, data same as paratype ASIZCR000345. CEL-DSA-117-1-5, data same as holotype. CEL-DSA-131-3, Dongsha wreck, Taiwan (20°42.380'N, 116°42.088'E), May 2015, coll. Pei-Chen Tsai, on coral host Lobophyllia sp., CEL-DSA-201, SE of Dongsha outer atoll, Taiwan (20°36.825'N, 116°53.012'E), May 2016, coll. Pei-Chen Tsai, Yao-Fong Tsao, and Yen-Wei Chang, on coral host Lobophyllia sp., PNG-020-01, 02, data same as paratype MNHN-IU-2016-8720.

Diagnosis

Galkinius with fused shell wall, spotted aperture frill; cirri, maxilla, and penis with dark spots, scutum with relatively narrow adductor plate, tergum with wide spur.

Description

(Description based on holotype: basal diameter 12 mm, rostro-carinal orifice diameter 9 mm). From in-situ observation, shell of barnacles covered by thick coral tissue, aperture frill black with white spots (Fig. 2), colouration did not changing after preservation in 95% EtOH. Shell oval, plates fully fused, pink externally after bleach treatment, external surface smooth (Fig. 3A, B). Base of shell with 30–40 internal rids radiating from rim of inner operculum (Fig. 3C). Orifice oval, long, narrow, about 1/3 length of rostro-carinal diameter.

Figure 2. 

In-situ underwater photo of Galkinius maculosus sp. n. A Additional specimen CEL-DSA-117 (white arrow), on coral Lobophyllia sp., NE of Dongsha Atoll, Taiwan B Magnified photo of the barnacle (CEL-DSA-117) showing the spotted aperture frill C Additional specimen CEL-DSA-075 (white arrow), on coral Lobophyllia sp., SE of Dongsha Atoll, Taiwan D Magnified photo of the barnacle (CEL-DSA-075) E Additional specimen CEL-DSA-097 (white arrow), on coral Lobophyllia sp., NE of Dongsha Atoll, Taiwan F Magnified photo of the barnacle (CEL-DSA-097) G Additional specimen CEL-DSA-201 (white arrow), on coral Lobophyllia sp., Northeast of Dongsha Atoll, Taiwan H Magnified photo of the barnacle (CEL-DSA-201) showing spotted aperture frill. (AF: aperture frill).

Figure 3. 

Shell and opercular plates of Galkinius maculosus sp. n. A (LM) and B (SEM) of dorsal view of fused shell (Holotype, ASIZCR000343) C Ventral view of shell (SEM) with internal rids radiating from rim of inner operculum (CEL-LAN-075-09) D Dorsal view and E Ventral view of fused scutum and tergum (ASIZCR000343) F Dorsal view (CEL-DSA-012-9) and G Ventral view (CEL-DSA-012-9) of fused scutum and tergum under Scanning Electron microscope H Horizontal striations on external surface of scutum I Horizontal striations on external surface of tergum. Scale bars in µm. Abbreviations: AP: adductor plate, S: scutum, T: tergum, MF: medial spur furrow, RT: rostral tooth, AD: adductor muscle scar, SP: spur.

Scutum and tergum white, plates fused without junctions (Fig. 3D–G). Width of scutum similar to width of tergum. Scutum triangular, transversely elongated, width two times longer than height. Occludent margin straight, with 6–8 rostral teeth basally along ventral surface of occludent margin, teeth gradually increasing in size from apex to base (Fig. 3D–G). Ventral view with oval-shaped adductor muscle scar. Dorsal view with horizontal striations, each bearing rows of small pores (Fig. 3H). Adductor plate convex, extending below basal margin half height of scutum (Fig. 3D, F). Tergum trapezoid, three times higher than scutum. Tergum apex pronounced, lateral depressor muscle crests not apparent. Spur wide, reaching one third width of basal margin of tergum, base convex, height of scutal side of spur three times longer than carinal side, height of spur about one third height of tergum. Dorsal surface with middle spur furrow, curving slightly from the basal margin towards carinal margin (Fig. 3D). Dorsal surface with horizontal striations, each bearing rows of small pores (Fig. 3I).

Maxilla oval, with dark spots (Fig. 4A), serrulate setae distally (Fig. 4B, C) and along inferior margin (Fig. 4D). Maxillule cutting edge straight without notch, bearing row of 9–12 large setae (inconsistent, withtwo specimens with 12 and 9 large setae, Fig. 4E, F, respectively). Region close to cutting edge with fine simple setae (Fig. 4H). Mandible with four teeth (Fig. 5A). First teeth largest and sharp (Fig. 5C). Second, third, and fourth teeth bidentate (Fig. 5C, E). First and second teeth well separated than remainder, third to fifth teeth smaller than first and second teeth. First three teeth occupying 3/4 length of cutting edge. Lower margin short, about 1/16 length of total length of mandible. Lateral side and lower margin of mandible bearing simple setae (Fig. 5D–H). Mandibular palp rectangular, elongated (Fig. 6A), bearing serrated setae distally (Fig. 6B) and along interior margin (Fig. 6C). Labrum bilobed, V-shaped notch between two lobes, one sharp tooth on each side of notch (Fig. 6D–G) (consistent in two specimens, Fig. 6D, H).

Figure 4. 

Maxilla and maxillule of Galkinius maculosus sp. n. A Maxilla oval, with dark spots (ASIZCR000343) B–D Serrated setae on margin E Maxillule (ASIZCR000343) F Maxillule (CEL-DSA-012-6) G Large simple setae on straight cutting edge H Simple setae on lateral margin. Scale bars in µm.

Figure 5. 

Mandible of Galkinius maculosus sp. n. A Mandible (ASIZCR000343) B First teeth of mandible C Bidentate second tooth D Lower margin and inferior angle with simple setae E Bidentate third and fourth teeth F simple setae on lateral margin G Inferior angle with simple setae H Lower margin with simple setae. Scale bars in µm.

Figure 6. 

Mandibular palp and labrum of Galkinius maculosus sp. n. A Mandibular palp showing black spots (ASIZCR000343) B Serrulate setae distally C Serrulate setae on interior margin D Bilobed labrum with V-shaped notch between two lobes (ASIZCR000343) E Tooth on labrum F Tooth on labrum G Surface of labrum with simple setae H Bilobed labrum (CEL-DSA-012-6). Scale bars in µm.

Cirrus I with rami unequal. Dark spots and stripes on each segment of anterior and posterior rami (Fig. 7A). Posterior ramus short (nine segments), bearing serrate setae (Fig. 7B), the anterior edges of the rami carry simple and serrulate setae (Fig. 7C). Anterior ramus long (17 segments), slender, anterior edges of the segments bearing simple and bidentate serrulate setae (Fig. 7D). Cirrus II rami sub-equal. Dark spots and stripes on each segment of anterior and posterior rami (Fig. 7E) Anterior ramus (nine segments) and posterior ramus (seven segments), bearing serrulate setae. Anterior edges of both anterior and posterior rami with both simple and bidentate serrulate setae (Fig. 7F). Fan-shaped denticles present at the margins of middle segments (Fig. 7G) and conical spines present at the margin of distal two to three segments (Fig. 7H). Cirrus III rami subequal (Fig. 8A), dark spots and stripes exist on each segment of anterior and posterior rami. Anterior ramus (12 segments) and posterior ramus (10 segments), with simple and serrulate setae. Fan-shaped denticles (Fig. 8B) present at the surface of basal segments of posterior ramus Conical spines present at the margin of the distal three up to eight segments at both anterior and posterior rami (Fig. 8C). Anterior sides of both anterior and posterior rami with bidentate serrulate setae (Fig. 8D). Cirrus IV-VI long, slender, with equal rami length. Number of segments on Cirrus IV (22, 20) (Fig. 8E), Cirrus V (24, 24) (Fig. 9A), Cirrus VI (23, 23) (Fig. 9D). Stripes exist on each segment of the ramus (Figs 8E, 9A, 9D). Intermediate segments of Cirrus IV-VI has four pairs of serrulate setae (Figs 8F, 9B, C, E, F), distal pair longest, proximal pair shortest. Penis long (about one and a half times length of Cirrus VI), annulated, with scattered irregular dark spots (Fig. 9G). Pedicel with basidorsal point (Fig. 9G, H), apex of penis with short, simple setae (Fig. 9I).

Figure 7. 

Cirrus I, II of Galkinius maculosus sp. n. A Cirrus I with dark spots, posterior ramus shorter than anterior one (ASIZCR000343) B Serrulate setae on anterior ramus C Simple and serrulate setae on the distal segment of posterior ramus D Simple and bidentate serrulate setae on the distal segment of anterior ramus E Cirrus II with dark spots and stripes on each segment, rami almost equal length (ASIZCR000343) F Simple and bidentate serrulate setae on the distal segment of anterior ramus G Fan-shaped denticles at the margins of middle segment (indicated by arrows) H Series of conical spines at the margin of distal segments (indicated by arrows). Scale bars in µm.

Figure 8. 

Cirrus III, IV of Galkinius maculosus sp. n. A Cirrus III with dark spots and stripes on each segment, rami almost equal length (ASIZCR000343) B Fan-shaped denticles on the surface of basal segments of posterior ramus (indicated by arrows) C Series of conical spines at the margin of distal segments of posterior ramus (indicated by arrows) D Simple and serrulate setae on the distal segment of posterior ramus E Cirrus IV, with stripes on each segment, rami almost equal length (ASIZCR000343) F simple and serrulate setae on intermediate segment G Simple and serrulate setae on the distal segment of posterior ramus H Simple and serrulate setae on the distal segment of anterior ramus. Scale bars in µm.

Figure 9. 

Cirrus V, VI and penis of Galkinius maculosus sp. n. A Cirrus V, with stripes on each segment, rami almost equal length (ASIZCR000343) B Intermediate segment with 4 pairs of serrulate setae C Serrulate setae on the distal segment of anterior ramus D Cirrus VI, with stripes on each segment, rami almost equal length (ASIZCR000343) E Intermediate segment with 4 pairs of serrulate seta F Serrulate setae on the distal segment of posterior ramus G Penis with dark spots (ASIZCR000343) H Basi-dorsal point of penis I Apex of penis with short simple setae. Scale bars in µm.

Etymology

The name maculosus means dappled or mottled, and therefore denotes the spots scattered around the aperture frill, maxilla, palp, Cirrus I-VI, and penis of this species.

Distribution

Taiwan waters (Dongsha Atoll in the South China Sea, Orchid Island in the Pacific Ocean), Madang, Papua New Guinea.

Molecular analysis

After trimming and aligning the sequences, 624bp of 12S and COI rDNA were obtained from 23 Darwiniella specimens and 39 Galkinius specimens without indels, respectively (Fig. 10, 11, Table 1: sequence data). Evolutionary distances based on p-distance/T92-distance were 0.009/0.009, 0.008/0.008 and 0.005/0.005 within D. angularis, D. conjugatum, and G. maculosus sp. n., respectively, and 0.109/0.119 between D. angularis and D. conjugatum, 0.124/0.136 between D. angularis and D. maculosus sp. n., 0.112/0.122 between G. maculosus sp. n. and D. conjugatum. Sequence UF11796 (Malay and Michonneau 2014) was clustered in the D. conjugatum clade and with between group evolution distance p-distance/T92-distance equaled to 0.005/0.005 which indicated this sequence should be D. conjugatum. Other two sequences UF8661 and UF7460 did not include in any identified Darwiniella clades and the evolutionary distances based on p-distance/T92-distance were 0.099/0.107 between UF8661 and D. conjugatum, 0.036/0.037 between UF8661 and D. angularis, 0.116/0.126 between UF8661 and G. maculosus sp. n, 0.095/0.103 between UF7460 and D. conjugatum, 0102/0.110 between UF7460 and D. angularis, 0.102/0.111 between UF7460 and G. maculosus sp. n. Therefore, these two sequences may represent two additional undescribed Darwiniella species.

Figure 10. 

Maximum Likelihood (ML) method inferred genealogical relationships of Darwiniella and Galkinius specimens based on 624bp 12S and COI with Nobia grandis as the outgroup. Numbers above the major nodes are bootstrap values of 1000 replicates.

Figure 11. 

Neighbour-Joining (NJ) method inferred genealogical relationships of Darwiniella and Galkinius specimens based on 624bp 12S and COI with Nobia grandis as the outgroup. Numbers above the major nodes are bootstrap values of 1000 replicates.

Table 1.
Download as
CSV
XLSX

Reporting table of ranking sequence reliability and accession numbers of GenBank submission.

Specimen catalog Species name Reliability ranking Source materials GenBank
12S COI
ASIZCR000343 Galkinius maculosus sp. n. 1st Holotype KY575518 KY575512
ASIZCR000346 Galkinius maculosus sp. n. 2nd Paratype KY575514 KY575509
ASIZCR000344 Galkinius maculosus sp. n. 2nd Paratype KY575516 KY575510
ASIZCR000345 Galkinius maculosus sp. n. 2nd Paratype KY575517 KY575511
MNHN-IU-2016-8720 Galkinius maculosus sp. n. 2nd Paratype KY575515 KY575513
DSA_12_1 Galkinius maculosus sp. n. 4th Non-type additional specimen KY419721 KY419776
DSA_201_03 Galkinius maculosus sp. n. 4th Non-type additional specimen KY419722 KY419777
DSA_201_04 Galkinius maculosus sp. n. 4th Non-type additional specimen KY419723 KY419778
PNG_20_1 Galkinius maculosus sp. n. 4th Non-type additional specimen KY419724 KY419779
PNG_20_2 Galkinius maculosus sp. n. 4th Non-type additional specimen KY419725 KY419780
HK_45_4 Darwiniella angularis 4th Non-type additional specimen KY419711 KY419766
HK_49_20 Darwiniella angularis 4th Non-type additional specimen KY419712 KY419767
KC_4_28 Darwiniella angularis 4th Non-type additional specimen KY419713 KY419768
KC_39_9 Darwiniella angularis 4th Non-type additional specimen KY419714 KY419769
TI_1_7_CypCha Darwiniella angularis 4th Non-type additional specimen KY419715 KY419770
KT_15_4_CypMi Darwiniella conjugatum 4th Non-type additional specimen KY419716 KY419771
KT_15_10_CypMic Darwiniella conjugatum 4th Non-type additional specimen KY419717 KY419772
RYU_130_1_CypSer Darwiniella conjugatum 4th Non-type additional specimen KY419718 KY419773
RYU_170_1_CypJap Darwiniella conjugatum 4th Non-type additional specimen KY419719 KY419774
TI_1_6_CypCha Darwiniella conjugatum 4rd Non-type additional specimen KY419720 KY419775
HK_18_6 Galkinius adamanteus 4th Non-type additional specimen KY419726 KY419781
HK_18_7 Galkinius adamanteus 4th Non-type additional specimen KY419727 KY419782
HK_18_8 Galkinius adamanteus 4th Non-type additional specimen KY419728 KY419783
HK_18_9 Galkinius adamanteus 4th Non-type additional specimen KY419729 KY419784
HK_18_10 Galkinius adamanteus 4th Non-type additional specimen KY419730 KY419785
KT_23_2_PlaPin Galkinius altiapiculus 4th Non-type additional specimen KY419731 KY419786
KT_32_1_GonPec Galkinius altiapiculus 4th Non-type additional specimen KY419732 KY419787
KT_32_4_GonPec Galkinius altiapiculus 4th Non-type additional specimen KY419733 KY419788
RYU_99_1_PlaRyu Galkinius altiapiculus 4th Non-type additional specimen KY419734 KY419789
RYU_168_1_GonAsp Galkinius altiapiculus 4th Non-type additional specimen KY419735 KY419790
DSA_200_01 Galkinius decima 4th Non-type additional specimen KY419736 KY419791
DSA_200_02 Galkinius decima 4th Non-type additional specimen KY419737 KY419792
GI_168_2_MoaSp Galkinius decima 4th Non-type additional specimen KY419738 KY419793
N_C_NE_001 Galkinius depressa 4th Non-type additional specimen KY419739 KY419794
N_C_NE_002 Galkinius depressa 4th Non-type additional specimen KY419740 KY419795
DSA_83_5 Galkinius equus 4th Non-type additional specimen KY419741 KY419796
DSA_95_1 Galkinius equus 4th Non-type additional specimen KY419742 KY419797
DSA_115_3 Galkinius equus 4th Non-type additional specimen KY419743 KY419798
DSA_151_1 Galkinius equus 4th Non-type additional specimen KY419744 KY419799
DSA_205_03 Galkinius equus 4th Non-type additional specimen KY419745 KY419800
RYU_121_1_HydMic Galkinius indica 4th Non-type additional specimen KY419746 KY419801
RYU_121_2_HydMic Galkinius indica 4th Non-type additional specimen KY419747 KY419802
RYU_121_3_HydMic Galkinius indica 4th Non-type additional specimen KY419748 KY419803
RYU_172_1_HydMic Galkinius indica 4th Non-type additional specimen KY419749 KY419804
RYU_172_2_HydMic Galkinius indica 4th Non-type additional specimen KY419750 KY419805
KC_107_7 Galkinius tabulates 4th Non-type additional specimen KY419751 KY419806
KC_107_10 Galkinius tabulates 4th Non-type additional specimen KY419752 KY419807
KC_108_1 Galkinius tabulatus 4th Non-type additional specimen KY419753 KY419808
KC_108_2 Galkinius tabulatus 4th Non-type additional specimen KY419754 KY419809
KC_109_1 Galkinius tabulatus 4th Non-type additional specimen KY419755 KY419810
HK_13_4 Galkinius trimegadonta 4th Non-type additional specimen KY419756 KY419811
HK_21_2 Galkinius trimegadonta 4th Non-type additional specimen KY419757 KY419812
HK_44_3 Galkinius trimegadonta 4th Non-type additional specimen KY419758 KY419813
KC_102_18 Galkinius trimegadonta 4th Non-type additional specimen KY419759 KY419814
KC_102_29 Galkinius trimegadonta 4th Non-type additional specimen KY419760 KY419815
DSA_198_01 Nobia grandis 4th Non-type additional specimen KY419761 KY419816
DSA_198_02 Nobia grandis 4th Non-type additional specimen KY419762 KY419817
NG_Cx_2 Nobia grandis 4th Non-type additional specimen KY419763 KY419818
RYU_80_1_GalFas Nobia grandis 4th Non-type additional specimen KY419764 KY419819
RYU_80_2_GalFas Nobia grandis 4th Non-type additional specimen KY419765 KY419820

All the Darwiniella and Galkinius specimens can be divided into two clades, one contains two Darwiniella species (D. angularis and D. conjugatum) while the remaining species (G. maculosus sp. n. and all the Galkinius species) construct the second clade. All the bootstrap values of the nodes which separate these two clades are above 80 and therefore these nodes are well supported.

Discussion

Galkinius maculosus sp. n. has shared similarities between Galkinius and Darwiniella. There are two possible genera for Galkinius maculosus sp. n. Based on the fused shell and opercular plates, Galkinius maculosus sp. n. can be placed under Darwiniella. Subsequently, the molecular phylogenetic pattern of Dawiniella will become diphyletic, with D. conjugatum and D. angularis in one molecular clade, and Galkinius maculosus sp. n. (if identified as Darwiniella) will be located in the other molecular clade with Galkinius species together. Identification of Galkinius maculosus sp. n. under the genus Darwiniella, based only on its fused shell character, probably trumps in characters of somatic body, tergum shape and molecular data.

Apart from the character of fused shell, there are many morphological characters of Galkinius maculosus sp. n. which fit well to Galkinius rather than Darwiniella. The shape of the opercular plates, especially the wide spur in the tergum of Galkinius maculosus sp. n., is similar to species of Galkinius (Fig. 12; also see Chan et al. 2013, Simon-Blecher et al. 2016). The adductor plate of Galkinius maculosus sp. n. is narrow, which is similar to other Galkinius species, rather than the wide adductor plate in Darwiniella (Fig. 12). The aperture frill, maxilla, mandibular palp, and cirrus of Galkinius maculosus sp. n. are spotted, similar to those of Galkinius, in contrast to those of species of Darwiniella which have very few spots. The size of the Galkinius maculosus sp. n. is comparable to Galkinius (see Chan et al. 2013) and much larger than Darwiniella (see Chen et al. 2012). Adults of Galkinius maculosus sp. n. are approximately twice as large as D. angularis and one and a half times larger than D. conjugatum. Based on the morphological similarities of Galkinius maculosus sp. n. to Galkinius, this species is classified under Galkinius and, in this case, the monophyly of Darwiniella and Galkinius in the molecular phylogeny tree is preserved.

Figure 12. 

Comparisons of opercular plates (fused scutum and tergum) of Galkinius maculosus sp. n. among species in Darwiniella and Galkinius. Note the height of adductor plate (indicated by double arrows) is much greater in Darwiniella than Galkinius species. The spur of tergum (indicated by single arrow) is sharper in Darwiniella than Galkinius. The opercular plate of G. maculosus sp. n. is closer to species in Galkinius.

The sequences divergence of the two Darwiniella species (UF8661 and UF7460) from Malay and Michonneau (2014) clustering into the clades with the Darwiniella species further supports the monophyly of Darwiniella. These two Darwiniella sequences from Malay and Michonneau (2014) were collected in the Oman and the Philippines, indicating that there is further diversity within Darwiniella waiting to be explored in the Pacific and Indian oceans.

Acknowledgements

The authors would like to thank Clarissa Fraser (Academia Sinica) for editing the English of the manuscript. Thanks for Pei-Chen Tsai, Yao-Fong Tsao, and Yen-Wei Chang (Academia Sinica) for assisting the collections in Dongsha Atoll. Thanks to Dr. Philip Bouchet (Muséum National d'Histoire Naturelle Paris, Ile de France, France) for organizing the expedition in Papua New Guinea. This paper is supported by the Ministry of Science and Technology (MOST) projects on South China Sea Diversity 104-2621-B-001 -002 and a Taiwan-France collaboration grant (NSC-102-2923-B-002 -001 -MY3). Thanks to the two reviewers for their constructive comments.

References

  • Annandale N (1924) Cirripedes associated with Indian corals of the families Astraeidae and Fungidae. Memoirs of the Indian Museum 8: 61–68.
  • Chan BKK, Garm A, Høeg JT (2008) Setal morphology and cirral setation of thoracican barnacle cirri: adaptations and implications for thoracican evolution. Journal of Zoology 275(3): 294–306. https://doi.org/10.1111/j.1469-7998.2008.00441.x
  • Chan BKK, Chen YY, Lin HC (2013) Biodiversity and host specificity of coral barnacles of Galkinius (Cirripedia: Pyrgomatidae) in Taiwan, with descriptions of six new species. Journal of Crustacean Biology 33(3): 392–431. https://doi.org/10.1163/1937240X-00002134
  • Chen YY, Lin HC, Chan BKK (2012) Description of a new species of coral-inhabiting barnacle, Darwiniella angularis sp. n. (Cirripedia, Pyrgomatidae) from Taiwan. ZooKeys 214: 43–74. https://doi.org/10.3897/zookeys.214.3291
  • Darwin C (1854) A monograph on the sub-class Cirripedia with figures of all the species. The Balanidae, the Verrucidae, etc. Ray Society, London, 684 pp.
  • de Blainville HM (1830) Zoophytes. In: Levrault FG (Ed.) Dictionnaire des sciences naturelles, dans lequel on traite méthodiquement des differénts êtres de la nature, considérés soit en eux-mêmes, d’après l’état actuel de nos connaissances, soit relativement à l’utlité qu’en peuvent retirer la médicine, l’agriculture, le commerce et les arts. Tome 60.Le Normat, Paris, 60: 1–546. [68 pls]
  • Galkin SV (1986) The system of coral-inhabiting barnacles (Cirripedia, Balanomorpha). Zoologichesky Zhurnal 65: 1285–1295.
  • Ghekker RF (1948) Kratauskoe Mestornakhozhdenie Faunui i Florui Yurskoghavozrasta. Akademia Nauk CCCP Paleontologicheskii Institut, Trudy 15: 7–85. [In Russian]
  • Gray JE (1825) A synopsis of the genera of Cirripedes arranged in natural families, with a description of some new species. Annals of Philosophy, new series 10: 97–107.
  • Hall T (2013) BioEdit, version 7.2. 5. Ibis Biosciences, Carlsbad, CA, USA.
  • Kumar S, Stecher G, Tamura K (2016) MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33(7): 1870–1874. https://doi.org/10.1093/molbev/msw054
  • Leach WE (1817) Distribution systématique de la classe des Cirripèdes: par le même. Journal de Physique 85: 67–69.
  • Malay MCMD, Michonneau F (2014) Phylogenetics and morphological evolution of coral‐dwelling barnacles (Balanomorpha: Pyrgomatidae). Biological Journal of the Linnean Society 113(1): 162–179. https://doi.org/10.1111/bij.12315
  • Ogawa K (2000) Coral-inhabiting barnacles (Cirripedia; Pyrgomatidae) from west coast of Babeldaob Island of the Republic of Palau. Biogeography 2: 29–43.
  • Pilsbry HA (1916) The sessile barnacles (Cirripedia) contained in the collection of the U. S. National Museum; including a monograph of the American species. Bulletin of the United States National Museum 93: 1–366. https://doi.org/10.5479/si.03629236.93.1
  • Ross A, Newman WA (1973) Revision of the coral-inhabiting barnacles (Cirripedia: Balanidae). Transactions of the San Diego Society of Natural History 17: 137–173.
  • Ross A, Newman WA (1995) A coral-eating barnacle, revisited (Cirripedia, Pyrgomatidae). Contributions to Zoology 65: 129–175.
  • Simon-Blecher N, Hosie AM, Guy‐Haim T, Chan BKK, Achituv Y (2016) Speciation, phenotypic plasticity, or ontogeny, the case of the genus Galkinius (Pyrgomatidae, Cirripedia, Crustacea). Zoological Journal of the Linnean Society 176(2): 305–322. https://doi.org/10.1111/zoj.12314
  • Sowerby GB (1839) A conchological manual. George Odell, London, 130 pp.
  • Tsang LM, Chan BKK, Shih FL, Chu KH, Chen AC (2009) Host-associated speciation in the coral barnacle Wanella milleporae (Cirripedia: Pyrgomatidae) inhabiting the Millepora coral. Molecular Ecology 18: 1463–1475. https://doi.org/10.1111/j.1365-294X.2009.04090.x
  • Tsang LM, Chu KH, Nozawa Y, Chan BKK (2014) Morphological and host specificity evolution in coral symbiont barnacles (Balanomorpha: Pyrgomatidae) inferred from a multi-locus phylogeny. Molecular Phylogenetics and Evolution 77: 11–22. https://doi.org/10.1016/j.ympev.2014.03.002
  • Tomlinson JT (1963) Two new acrothoracican barnacles from Japan. Publications of the Seto Marine Biological Laboratory 11: 54–58. https://doi.org/10.5134/175342
login to comment