Research Article
Print
Research Article
A new species of the genus Leptobrachella (Amphibia, Anura, Megophryidae) from Dayaoshan National Nature Reserve, Guangxi, China
expand article infoGui-Dong Yu‡, Kun Qin§|, Tao Meng‡, Peng Li, Wan-Xiao Peng, Wei-Cai Chen
‡ Guangxi Forest Inventory and Planning Institute, Nanning, China
§ Guangxi Dayaoshan Forest Ecosystem Research Station, Jinxiu, China
| Laibin Jinxiu Dayaoshan Forest Ecosystem Observation and Research Station of Guangxi, Jinxiu, China
¶ Nanning Normal University, Nanning, China

Corresponding author: Tao Meng ( dudu85116@163.com )

Corresponding author: Wei-Cai Chen ( chenweicai2003@126.com )

Academic editor: Angelica Crottini
© 2024 Gui-Dong Yu, Kun Qin, Tao Meng, Peng Li, Wan-Xiao Peng, Wei-Cai Chen.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Yu G-D, Qin K, Meng T, Li P, Peng W-X, Chen W-C (2024) A new species of the genus Leptobrachella (Amphibia, Anura, Megophryidae) from Dayaoshan National Nature Reserve, Guangxi, China. ZooKeys 1219: 105-122. https://doi.org/10.3897/zookeys.1219.121027
ZooBank: urn:lsid:zoobank.org:pub:BC0D5160-30A3-4F4F-8C2A-467690E85E3C
Open Access

Abstract

A new species of the Asian leaf litter toad genus Leptobrachella, L. dayaoshanensis sp. nov., is described based on phylogenetic analysis, morphological characters, and bioacoustic data. This species occurs in the Dayaoshan National Nature Reserve located in Jinxiu County, Guangxi, China. Phylogenetic analysis indicates that this new species is closely related to L. verrucosa, as demonstrated by phylogenetic trees. The new species can be distinguished from its congeners by a combination of the following characters: (1) medium size (mean snout–vent length (SVL) of 27.9 ± 0.7 mm, range 26.6–28.9 mm in males; 34.4 mm in female); (2) rough dorsal surface featuring small, raised tubercles and ridges; (3) flanks adorned with irregular black spots and creamy white glands; (4) creamy white ventral surface with sparse light-brown spots and irregular tiny textures; (5) brown throat and chest; (6) rudimentary toe webbing; (7) wide lateral fringes on toes; (8) distinct continuous ventrolateral glandular line; (9) tibiotarsal articulation reaching the midpoint of eye when the leg is extended forward; (10) heels that do not meet when thighs are appressed at right angles to body; (11) bicolored iris, with the upper half being copper and gradually transitioning to silver in the lower half; and (12) advertisement calls consisting of two model types, with dominant frequencies of 4.2–6.8 kHz at 21.0 °C. The new species has a breeding season that occurs from March to April and is found in evergreen forests at elevations between 1,000 and 1,600 m.

Key words

Bioacoustics, cryptic diversity, morphology, phylogeny, taxonomy

Introduction

Leptobrachella liui (Fei & Ye, 1990) is known to have a wide distribution in eastern and southern China (AmphibiaChina 2024; Frost 2024). In 1931, Pope collected 13 specimens from Chong’an (now Wuyishan City), Fujian, China, and initially classified them as Megophrys pelodytoides. Later, they were transferred to the genus Leptolalax Dubois, 1980, and then to Leptobrachella Smith, 1925 (Chen et al. 2018). However, Pope (1931) also noted that the Fujian specimens differed from the holotype (Boulenger 1893; Smith 1930), mainly in the number of law teeth of tadpoles (4 lines vs 5–6 lines). In 1950, Liu (1950) examined the Fujian specimens collected by Pope and argued that they belonged to an unknown species in the genus Megophrys (Liu 1950; Fei et al. 1992). In 1990, Fei et al. (1990) classified the Fujian specimens as a new species, Leptobrachella liui, and subsequently redescribed them (Fei et al. 1992). They also assigned specimens from Dayaoshan and Longsheng, Guangxi, Leishan, Guizhou, Yizhang, Hunan, and Zhejiang provinces to L. liui, despite some morphologic variations. Later reports indicated that L. liui was widely distributed in Fujian, Zhejiang, Jiangxi, Hunan, Guangdong, and Guangxi provinces (Fei et al. 2012; Mo et al. 2014; Shen 2014; Fei and Ye 2016; Chen et al. 2018). Based on molecular data, Chen et al. (2018) initially discovered that specimens of L. liui from various geographic populations can be categorized into three distinct lineages, forming the L. liui species complex. The first lineage, found in the Mangshan Nature Reserve, Yizhang County, Hunan, China, was identified as L. mangshanensis, representing the first cryptic species (Chen et al. 2018; Hou et al. 2018). The second lineage, discovered in the Dawuling Forest Station, Maoming City, Guangdong, China, was named L. yunkaiensis, corresponding to the second cryptic species (Chen et al. 2018; Wang et al. 2018). The third lineage was identified as L. liui, representing the sensu stricto L. liui. Interestingly, within the second lineage, a specific sequence (GenBank no. EF544238) from Dayaoshan, Jinxiu County, Guangxi, China, exhibited a significantly shorter evolutionary branch and a relatively larger genetic divergence compared to L. yunkaiensis, indicating the presence of an unknown species within Leptobrachella. Recently, we collected 16 specimens from Dayaoshan, Jinxiu County, Guangxi. Through thorough examination of morphology, phylogeny, and bioacoustics, we observed distinct differences between these specimens, previously classified as L. liui, and both the sensu stricto L. liui from the type locality and L. yunkaiensis. Therefore, we propose the classification of these specimens as a new species within the genus Leptobrachella.

Material and methods

Sampling

Sixteen specimens were collected from Dayaoshan (DYS), Jinxiu County, Guangxi, China (Fig. 1). All specimens were initially fixed in 10% formalin for 48 h and subsequently transferred to 75% ethanol for permanent storage at Nanning Normal University (NNU). Prior to fixation, muscle tissues were extracted and stored in 100% ethanol for molecular analysis.

Figure 1. 

Localities of the new species and its sister taxa.

Morphometrics and morphological comparisons

All specimens were measured following the methodology described in Rowley et al. (2016). Measurements were taken using a digital caliper with an accuracy of 0.1 mm. The following morphological characters were measured: snout–vent length (SVL), head length (HL) from the tip of the snout to the rear of the jaws, head width (HW) at the commissure of the jaws, snout length (SNT) from the tip of the snout to the anterior eye corner, diameter of the exposed portion of the eyeball (ED), interorbital distance (IOD), which is the shortest distance between the anterior corners of the orbits, horizontal diameter of the tympanum (TD), distance from the anterior edge of the tympanum to the posterior eye corner (TED), internarial space distance (IN), tibia length (TIB) with flexed hindlimb, forelimb length (FLL) from the elbow to the tip of the third finger, length of the foot and tarsus (TFL) from the tibiotarsal articulation to the distal end of toe IV, manus length (ML) from the tip of the third digit to the proximal edge of the inner palmar tubercle, hindlimb length (HLL) from the tip of the fourth toe to the vent, and the distance from the proximal edge of the femoral gland to the knee (FG-knee). Gender was determined through direct observation of calls in life or the presence of internal vocal sac openings.

Comparative morphological data were obtained from the references (Suppl. material 2: table S1) and museum specimens (Suppl. material 2: table S2). For morphological comparisons, we used 15 adult males from the new specimens to compare with their closely related species, including Leptobrachella liui (type locality, male, n = 6), L. mangshanensis (type locality, male, n = 6), and L. verrucosa (holotype and paratypes, male, n = 5), based on the results of phylogenetic analyses. We performed Principal Component Analyses (PCA) and the Mann-Whitney U test using SPSS v. 20. Before analysis, the measurements were transformed as follows: we calculated the ratio of each morphometric character (except SVL itself) to SVL, and then log-transformed them for morphometric analyses.

Molecular analyses

Genomic DNA was isolated from muscle tissue using tissue extraction kits (Tiangen Biotech Co. Ltd., Beijing, China). Mitochondrial fragments of the 16S gene were amplified and sequenced using the primers: 16Sar_L, 5′–CGCCTGTTTACCAAAAA CAT–3′; 16Sbr_H, 5′–CCGGTCTGAACTCAGATCACGT–3′) (Palumbi et al. 1991). Polymerase chain reaction (PCR) amplification was performed as described by Chen et al. (2021). The fragments were sequenced on an automated DNA sequencer (ABI Prism 3730, Applied Biosystems, USA). The newly obtained sequences were deposited in GenBank (accession numbers: PQ476281–PQ476287). Phylogenetic relationships were reconstructed using maximum-likelihood (ML) and Bayesian-inference (BI) analyses. The sequence information used in the molecular analysis is provided in Table 1. The best-fit nucleotide substitution models (GTR+F+I) were selected using ModelFinder v. 2.2.0 (Kalyaanamoorthy et al. 2017; Zhang et al. 2020) based on the Bayesian information criterion (BIC). ML analyses were performed in IQ-tree v. 2.2.2 (Nguyen et al. 2015) with 2000 ultrafast bootstrap replicates. BI was conducted using MrBayes v. 3.2 (Ronquist et al. 2012). Two independent runs with four Markov Chain Monte Carlo simulations were performed for 30 million iterations, and trees were sampled every 1,000th generation. The first 25% of trees were discarded as burn-in. Uncorrected pairwise distances were calculated using Mega v. 7 with the default settings (Kumar et al. 2016).

Table 1.
Download as
CSV
XLSX

DNA sequences used in this study. ‘*’ represents type locality. ‘#’ means the sequences named Leptobrachella liui from Chen et al. (2018).

ID Species Locality Voucher no. 16S Note#
1 L. liui Jiulian Shan, Jiangxi, China SYS a002105 MH055911 L. liui
2 L. liui Nankunshan Nature Reserve, Guangdong, China SYS a004497 MH055924 L. liui
3 L. liui Dongkeng Town, Jingning County, Zhejiang, China SYSa002732 MH605575 L. liui
4 L. liui Tongguzhang, Guangdong, China SYS a004733 MH055912 L. liui
5 L. liui Jiaoshuikeng, Guangdong, China SYS a003698 MH055913 L. liui
6 L. liui BaiTang, Guangdong, China KIZ018349 MH055914 L. liui
7 L. liui Tongba Shan, Jiangxi, China SYS a001702 KM014548 L. liui
8 L. liui Dongkeng, Zhejiang, China SYS a002733 MH055909 L. liui
9 L. liui Gutian Nature Reserve, Guangdong, China SYS a002650 MH055910 L. liui
10 L. liui Wuyishan, Fujian, China * SYS a001597 KM014547 L. liui
11 L. liui Wuyishan, Fujian, China * SYS a002478 MH605573 L. liui
12 L. liui Huanggangshan, Jiangxi, China SYS a001620 KM014549 L. liui
13 L. liui Daiyunshan, Fujian, China SYS a001736 KM014550 L. liui
14 L. liui Longqishan, Fujian, China SYS a002506 MH055907 L. liui
15 L. liui Wuyishan, Fujian, China * ZYCA907 MH055908 L. liui
16 L. mangshanensis Longzha, Hunan, China SYS a002539 MH055918 L. liui
17 L. mangshanensis Tianjingshan National Forest Park, Guangdong, China SYS a002805 MH055921 L. liui
18 L. mangshanensis Nanling National Forest Park, Guangdong, China SYS a002829 MH055920 L. liui
19 L. mangshanensis Dadong Shan, Guangxi, China SYS a002848 MH055922 L. liui
20 L. mangshanensis Wugongshan, Jiangxi, China SYS a004035 MH055916 L. liui
21 L. mangshanensis Jinggangshan, Jiangxi, China SYS a004051 MH055917 L. liui
22 L. mangshanensis Yunyangshan, Hunnan, China SYS a002540 MH055923 L. liui
23 L. mangshanensis Mangshan, Hunan, China* MSZTC201701 MG132196 L. liui
24 L. mangshanensis Mangshan, Hunan, China* MSZTC201702 MG132197 L. liui
25 L. mangshanensis Mangshan, Hunan, China* MSZTC201703 MG132198 L. liui
26 L. mangshanensis Guidong, Hunan, China SYS a002521 MH055919 L. liui
27 L. mangshanensis Yangxi, Jiangxi, China SYS a002578 MH055915 L. liui
28 L. mangshanensis Mt. Jinggang, Jiangxi, China SYSa004044 MH406906 L. liui
29 L. mangshanensis Mt. Jinggang, Jiangxi, China SYSa004045 MH406907 L. liui
30 L. mangshanensis Mt. Jinggang, Jiangxi, China SYSa004052 MH406908 L. liui
31 L. dayaoshanensis sp. nov. Dayaoshan, Jinxiu County, Guangxi, China* ZYC A100 EF544238 L. liui
32 L. dayaoshanensis sp. nov. Dayaoshan, Jinxiu County, Guangxi, China* NNU202103018 PQ476281
33 L. dayaoshanensis sp. nov. Dayaoshan, Jinxiu County, Guangxi, China* NNU202103019 PQ476282
34 L. dayaoshanensis sp. nov. Dayaoshan, Jinxiu County, Guangxi, China* NNU202103021 PQ476283
35 L. dayaoshanensis sp. nov. Dayaoshan, Jinxiu County, Guangxi, China* NNU202103022 PQ476284
36 L. dayaoshanensis sp. nov. Dayaoshan, Jinxiu County, Guangxi, China* NNU202103027 PQ476285
37 L. dayaoshanensis sp. nov. Dayaoshan, Jinxiu County, Guangxi, China* NNU202103028 PQ476286
38 L. dayaoshanensis sp. nov. Dayaoshan, Jinxiu County, Guangxi, China* NNU202103032 PQ476287
39 L. verrucosa Lianshan Bijiashan Nature Reserve, Guangdong, China GEP a059 OP279589
40 L. verrucosa Lianshan Bijiashan Nature Reserve, Guangdong, China GEP a060 OP279590
41 L. verrucosa Lianshan Bijiashan Nature Reserve, Guangdong, China GEP a061 OP279591
42 L. verrucosa Lianshan Bijiashan Nature Reserve, Guangdong, China GEP a062 OP279592
43 L. verrucosa Lianshan Bijiashan Nature Reserve, Guangdong, China GEP a063 OP279593
44 L. yunkaiensis Dawushan, Guangdong, China* SYS a004666 MH055933 L. liui
45 L. yunkaiensis Dawushan, Guangdong, China* SYS a004663 MH605584
46 L. yunkaiensis Lidong, Guangxi, China KIZ018211 MH055931 L. liui
47 L. yunkaiensis Ehuangzhang Nature Reserve, Guangdong, China KIZ047782 MH055932 L. liui
48 L. aerea Quang Binh, Vietnam ZFMK 86362 JN848409
49 L. alpina Caiyanghe, Yunnan, China KIZ049024 MH055867
50 L. applebyi Phong Dien Nature Reserve, Thua Thien-Hue, Vietnam KIZ010701 MH055947
51 L. arayai Borneo, Malaysia* AE100/S9 DQ642119
52 L. ardens Kon Ka Kinh National Park, Gia Lai, Vietnam* ZMMU-NAP-06099 MH055949
53 L. aspera Huanglianshan Nature Reserve, Lyuchun, Yunnan, China* SYS a007743 MW046199
54 L. baluensis Sabah, Borneo, Malaysia* SP 21604 LC056792
55 L. bashaensis Basha Nature Reserve, Guizhou, China* GIB196404 MW136295
56 L. bidoupensis Bidoup-Nui Ba National Park, Lam Dong, Vietnam* ZMMU-A-4797-01454 MH055945
57 L. bijie Bijie City, Guizhou, China* SYS a007313 MK414532
58 L. botsfordi Lao Cai, Vietnam* AMS R 176540 MH055952
59 L. bourreti Mao’ershan, Guangxi, China KIZ019389 MH055869
60 L. brevicrus Sarawak, Borneo, Malaysia* ZMH A09365 KJ831302
61 L. chishuiensis Guizhou, China* CIBCS20190518047 MT117053
62 L. crocea Thua Thien-Hue, Vietnam ZMMU-NAP-02274 MH055955
63 L. damingshanensis Wuming County, Guangxi, China* NNU202103281 MZ145229
64 L. dong Tongdao County, Hunan, China* CIB SSC1757 OP764530
65 L. dorsospina Yushe Forest Park, Shuicheng, Guizhou, China* SYS a004961 MW046194
66 L. dringi Borneo, Malaysia* KUHE:55610 AB847553
67 L. eos Phongsaly, Laos* MNHN 2004.0274 JN848452
68 L. feii Yunnan, China* KIZ048894 MT302634
69 L. firthi Kon Tum, Vietnam* AMS: R 176524 JQ739206
70 L. flaviglandulosa Xiaoqiaogou Nature Reserve, Yunnan, China* KIZ016072 MH055934
71 L. fritinniens Danum Valley Field Center, Sabah, Malaysia FMNH 244800 MH055971
72 L. fuliginosa Phetchaburi, Thailand KUHE:20197 LC201988
73 L. gracilis Bukit Kana, Sarawak, Malaysia FMNH 273682 MH055972
74 L. guinanensis Shangsi County, Guangxi, China* NNU00557 OP548561
75 L. hamidi Borneo, Malaysia* KUHE 17545 AB969286
76 L. heteropus Peninsular, Malaysia KUHE 15487 AB530453
77 L. isos Gia Lai, Vietnam* AMS R 176480 KT824769
78 L. itiokai Gunung Mulu National Park, Sarawak, Malaysia* KUHE:55897 LC137805
79 L. jinshaensis Lengshuihe Nature Reserve, Jinsha County, Guizhou, China* CIBJS20200516001 MT814014
80 L. jinyunensis Mt. Jinyun, Beibei District, Chongqing, China* CIB 119039 OQ024778
81 L. juliandringi Sarawak, Borneo, Malaysia* KUHE 17557 LC056784
82 L. kajangensis Tioman, Malaysia* LSUHC:4439 LC202002
83 L. kalonensis Binh Thuan, Vietnam* IEBR A.2014.15 KR018114
84 L. kecil Cameron, Malaysia * KUHE:52439 LC202003
85 L. khasiorum Meghalaya, India* SDBDU 2009.329 KY022303
86 L. korifi Doi Inthanon, Thailand* KUHE 19134 LC741033
87 L. laui Wutongshan, Shenzhen city, China* SYS a001507 KM014544
88 L. macrops Dak Lak, Vietnam* AMS R177663 KR018118
89 L. maculosa Ninh Thuan, Vietnam* AMS: R 177660 KR018119
90 L. maoershanensis Mao’er Shan, Guangxi, China KIZ07614 MH055927
91 L. marmorata Borneo, Malaysia* KUHE 53227 AB969289
92 L. maura Borneo, Malaysia SP 21450 AB847559
93 L. melanoleuca Kapoe, Ranong, Thailand KIZ018031 MH055967
94 L. melica Ratanakiri, Cambodia* MVZ 258198 HM133600
95 L. minima Doi Phu Fa, Nan, Thailand KIZ024317 MH055852
96 L. mjobergi Sarawak, Borneo, Malaysia* KUHE 47872 LC056787
97 L. nahangensis Tuyen Quang, Vietnam* ROM 7035 MH055853
98 L. namdongensis Thanh Hoa, Vietnam* VNUF A.2017.95 MK965390
99 L. neangi Veal Veng District, Pursat, Cambodia* CBC 1609 MT644612
100 L. niveimontis Yongde County, Yunnan, China * KIZ028276 MT302620
101 L. nyx Ha GiangProv., Vietnam* AMNH A 163810 DQ283381
102 L. oshanensis Emei Shan, Sichuan, China* Tissue ID: YPX37492 MH055896
103 L. pallida Lam Dong, Vietnam* UNS00510 KR018112
104 L. parva Mulu National Park, Sarawak, Malaysia* KUHE:55308 LC056791
105 L. pelodytoides NA TZ819 AF285192
106 L. petrops Ba Vi National Park, Ha Tay, Vietnam ROM 13483 MH055901
107 L. phiadenensis Phia Oac-Phia Den NP, Cao Bang Prov., Vietnam* IEBR A.5205 OR405872
108 L. phiaoacensis Phia Oac-Phia Den NP, Cao Bang Prov., Vietnam* IEBR A. 5195 OR405871
109 L. picta Borneo, Malaysia UNIMAS 8705 KJ831295
110 L. pluvialis Lao Cai, Vietnam* MNHN:1999.5675 JN848391
111 L. puhoatensis Nghe An, Vietnam* VNMN 2016 A.22 KY849586
112 L. purpurus Yunnan, China * SYSa006530 MG520354
113 L. purpuraventra Guizhou, China * SYSa007281 MK414517
114 L. pyrrhops Loc Bac, Lam Dong, Vietnam* ZMMU-A-4873-00158 MH055950
115 L. rowleyae Da Nang City, Vietnam* ITBCZ2783 MG682552
116 L. sabahmontanus Borneo, Malaysia* BORNEENSIS 12632 AB847551
117 L. shangsiensis Shangsi County, China* NHMG1401032 MK095460
118 L. shimentaina Shimentai Nature Reserve, Guangdong, China* SYS a004712 MH055926
119 L. shiwandashanensis Shangsi, Guangxi, China* NNU202103261 MZ326695
120 L. sinorensis Mae Hong Son, Thailand* KUHE 19816 LC741036
121 L. sola Gunung Stong, Kelantan, Malaysia KU RMB20973 MH055973
122 L. suiyangensis Guizhou, China * GZNU20180606005 MK829649
123 L. sungi Vinh Phuc, Vietnam * ROM 20236 MH055858
124 L. tadungensis Dak Nong, Vietnam* UNS00515 KR018121
125 L. tengchongensis Yunnan, China * SYSa004598 KU589209
126 L. tuberosa Kon Ka Kinh National Park, Gia Lai, Vietnam* ZMMU-NAP-02275 MH055959
127 L. ventripunctata Zhushihe, Yunnan, China * SYSa004536 MH055831
128 L. wuhuangmontis Pubei County, Guangxi, China * SYS a003486 MH605578
129 L. wulingensis Hunan, China * CSUFT194 MT530316
130 L. wumingensis Wuming County, Guangxi, China* NNU 01058 OR194551
131 L. yeae Mount Emei, Sichuan, China * CIBEMS20190422HLJ1-6 MT957019
132 L. yingjiangensis Yunnan, China * SYSa006532 MG520351
133 L. yunkaiensis Yunyang County, Chongqing, China * GZNU20210622001 OL800364
134 L. zhangyapingi Chiang Mai, Thailand * KIZ07258 MH055864
135 Xenophrys major Kon Tum Province, Vietnam AMS R173870 KY476333
136 Leptobrachium chapaense Lao Cai Province, Vietnam AMS R 171623 KR018126

Bioacoustics analyses

Advertisement calls were recorded using a SONY PCM-A10 recorder at a distance of approximately 0.5 m. Four individuals were recorded in the field, and ambient temperatures were measured immediately after the recordings using a Deli LE505 hand-held weather meter. The call recordings were analyzed using the software Raven Pro v. 1.6 (Cornell Laboratory of Ornithology, Ithaca, NY, USA), following the method described by Köhler et al. (2017). Audio-spectrograms were generated by applying a fast-Fourier transform to 512 points with a 50% overlap and a grid-spacing of 172 Hz, using Hanning windows.

Results

Morphology

The Mann-Whitney U test revealed that the DYS specimens differed significantly from Leptobrachella liui, L. mangshanensis, and L. verrucosa (Table 2) in terms of various morphological characters, such as SVL, HL, HW, SNT, TD, IN, TIB, FLL, ML, and HLL. This finding was further supported by the results of the PCA analysis, which demonstrated that the DYS specimens were distinct from L. liui, L. mangshanensis, and L. verrucosa (Fig. 2). In terms of morphology, the DYS specimens exhibited differences compared to L. liui in body size, ventral surface textures, and dermal ridges of toes. Additionally, they differed from L. mangshanensis in dorsal surface, lateral fringes of toes, and iris color, and from L. verrucosa in lateral fringes of toes, relative finger lengths, and ventrolateral glandular line. For more detailed comparisons, please refer to the “Comparisons” section.

Figure 2. 

Scatter plot of PC1 and PC2 of PCA based on the morphometric measurements, separating Leptobrachella dayaoshanensis sp. nov., L. liui, L. mangshanensis, and L. verrucosa.

Table 2.
Download as
CSV
XLSX

Measurements and morphometric comparisons between Leptobrachella dayaoshanensis sp. nov., L. liui, L. mangshanensis, and L. verrucosa. “*” stands for p-value < 0.05.

L. dayaoshanensis sp. nov. p-value from Mann-Whitney U test
Males (n = 15) Ranges (mm) Mean ± SD (mm) Female (n = 1) New species vs L. liui New species vs L. mangshanensis New species vs L. verrucosa
SVL 26.6–28.9 27.9 ± 0.7 34.4 0.000* 0.000* 0.001*
HL 7.8–9.1 8.4 ± 0.3 9.8 0.000* 0.000* 0.001*
HW 9.1–9.9 9.5 ± 0.2 10.9 0.000* 0.000* 0.001*
SNT 3.3–4.1 3.7 ± 0.2 4.1 0.001* 0.001* 0.026*
ED 3.0–4.0 3.5 ± 0.3 4.1 0.020* 0.020* 0.010*
IOD 2.6–3.3 2.9 ± 0.2 3.1 1.000 1.000 0.965
TD 1.3–1.8 1.5 ± 0.1 2.0 0.000* 0.000* 0.002*
TED 0.9–1.4 1.1 ± 0.1 1.4 0.010* 0.010* 0.032*
IN 2.4–2.9 2.6 ± 0.1 2.8 0.000* 0.000* 0.001*
TIB 11.7–13.7 12.9 ± 0.5 15.0 0.001* 0.001* 0.005*
FLL 11.4–13.1 12.4 ± 0.5 13.5 0.000* 0.000* 0.001*
TFL 16.8–19.4 17.8 ± 0.6 20.6 0.003* 0.001* unknown
ML 6.0–6.9 6.6 ± 0.3 7.1 0.000* 0.000* 0.001*
HLL 36.7–41.2 38.9 ± 1.0 46.2 0.000* 0.000* 0.001*
FG-knee 4.1–5.6 5.0 ± 0.4 5.9 0.000* 0.001* unknown

Phylogenetic analyses and genetic divergence

About 530 base pairs were included in the matrix of 136 sequences based on the 16S gene. The phylogenetic relationships within Leptobrachella remain unresolved in the 16S gene trees. Both ML and BI analyses resulted in similar topological trees (Fig. 3). The phylogenetic trees suggest that the DYS specimens form a monophyletic group and are genetically closest to L. verrucosa. Additionally, L. liui and L. mangshanensis are monophyletic to each other. The genetic divergences between the DYS specimens and L. verrucosa range from 2.3% to 2.8%, while for L. liui it ranges from 2.6% to 4.1%, and for L. mangshanensis it ranges from 2.1% to 2.8% (Suppl. material 2: table S3).

Figure 3. 

BI trees based on 16S fragments with Bayesian posterior probabilities/bootstrap supports on branches. Bayesian posterior probabilities, upper half, >0.95 = grey, 1 = black; bootstrap supports, lower half, >70%<90% = grey, >90% = black).

Bioacoustics

The ambient temperature was recorded at approximately 21.0 °C. The calls of DYS specimens consist of two types: Type A and Type B, as illustrated in Fig. 4. Type A calls have durations ranging from 68 to 88 ms (mean ± SD: 78.1 ± 4.4 ms, n = 58) and intervals of 110 to 170 ms (134.6 ± 13.7 ms, n = 58), with dominant frequencies between 4.2 and 6.8 kHz. In contrast, Type B calls have durations ranging from 261 to 361 ms (298.5 ± 25.4 ms, n = 14) and dominant frequencies also ranging from 4.5 to 6.8 kHz (Fig. 4). These call characters, including durations, intervals, number of notes per call, and dominant frequencies, differentiate the calls of DYS specimens from those of L. liui (Ding et al. 2019). Moreover, the calls of DYS specimens also exhibit differences from those of other known species within the Leptobrachella genus (Suppl. material 2: table S4). Based on the results of phylogenetic analysis, morphology, and bioacoustics, the DYS specimens are described as a new species within the genus Leptobrachella.

Figure 4. 

Advertisement call spectrograms of Leptobrachella dayaoshanensis sp. nov.

Taxonomic account

Leptobrachella dayaoshanensis Chen, Yu, Meng & Qin, sp. nov.

https://zoobank.org/FB15638D-4519-4DDA-A95A-007DAEDCEBB7
Fig. 5A–E

Leptolalax liui Fei & Ye, 1990 (Chresonymy): Fei et al. 1992; Fei et al. 2012; Mo et al. 2014.

Type material

Holotype • NNU 20210318, adult male, collected at the Dayaoshan National Nature Reserve (DYS), Jinxiu County, Guangxi, China (24.153°N, 110.213°E; elevation 1132 m), collected by Wei-Cai Chen on 12 March 2021. Paratypes • NNU 20210319–26, NNU 20210328–33, 14 adult males, and NNU 20210327, one adult female, collected at the same locality as holotype on 12 March 2021 by Wei-Cai Chen.

Etymology

The species name dayaoshanensis refers to the type locality, Mount Dayaoshan. The suggested English name is Dayaoshan Leaf Litter Toad, and the Chinese name is Da Yao Shan Zhang Tu Chan (大瑶山掌突蟾).

Diagnosis

Leptobrachella dayaoshanensis sp. nov. can be distinguished from its congeners by a combination of the following characters: (1) medium size (SVL mean 27.9 ± 0.7 mm, range 26.6–28.9 mm in males; 34.4 mm in female); (2) dorsal surface rough with small, raised tubercles and ridges; (3) flanks with irregular black spots and creamy-white glands; (4) ventral surface creamy-white with sparse, light-brown spots and irregular, tiny textures; (5) brown throat and chest; (6) rudimentary toe webbing; (7) wide toes lateral fringes; (8) distinct continued ventrolateral glandular line; (9) tibiotarsal articulation reaching the midpoint of eye when the leg is pressed forward; (10) heels not meeting when thighs are appressed at right angles to body; (11) bicolored iris, with upper half copper, gradually transitioning to silver in lower half; and (12) advertisement calls consisting of two types models, with dominant frequencies of 4.2–6.8 kHz (21.0 °C).

Description of holotype

Adult male, head width larger than length (HW/HL = 1.08); snout protruding, projecting over the lower jaw; nostril oval, closer to tip of snout than eye; canthus rostralis rounded; loreal region sloping; interorbital area flat; pupil vertical; eye diameter less snout length (ED/SNT = 0.75); internarial distance less than interorbital distance (IN/IOD = 0.77); tympanum distinct, rounded and concave, significantly less than eye diameter, TD/ED = 0.43; distinct and raised supratympanic fold from the corner of eye to supra-axillary gland; vomerine teeth absent; tongue with a shallow notch at the posterior tip (Fig. 5A–F).

Figure 5. 

The holotype of Leptobrachella dayaoshanensis sp. nov. A dorsal view B ventral view C dorsolateral view D calling in the field E ventral view of hand F ventral view of foot.

Tips of fingers slightly swollen; relative finger lengths I < II < IV < III; nuptial pad absent; subarticular tubercles absent; prominent inner palmar tubercle and very small outer palmar tubercle; finger webbing and dermal fringes absent. Tips of toes rounded, slightly swollen but less than toe width; relative toe lengths I < II < V < III < IV; subarticular tubercles absent, instead by consecutive dermal ridges; large and elongated inner metatarsal tubercle; outer metatarsal tubercle absent; toe webbing rudimentary; toes lateral fringes well-developed, half of phalange in width; TIB/SVL = 0.42; tibia–tarsal articulation reaching the medium of eye when the leg is pressed forward; heels not meeting when thighs are appressed at right angles to body.

Dorsal surface rough with small, raised tubercles and ridges; ventral surface smooth without tubercles; pectoral glands oval and creamy white, ~1.2 mm in diameter; femoral glands oval, ~1.3 mm in diameter, closer to knee than to vent; supra-axillary glands distinct and rounded, ~1.0 mm in diameter; continued ventrolateral glandular line distinct; limbs surface without tubercles (Fig. 5A–F).

Color of holotype in life

Dorsum saffron yellow with distinct brown markings, a brown triangle between eyes, a brown “W” marking on shoulder, and a brown “Λ” marking on lower back; tympanum pale brown; supratympanic line brown from posterior corner of eye to supra-axillary glands; brown bars on upper lip wide; flanks with irregular black spots and creamy yellow glands; three transverse, dark-brown bars distinct on dorsal surface of hindlimbs; elbows, upper arms and tibiotarsal surfaces light tangerine; ventral surface creamy white, with sparse, light-brown spots and irregular, tiny textures; throat and chest brown; pectoral and femoral glands creamy white, supra-axillary glands light tangerine; pupil black; iris bicolored, upper half copper, gradually transitioning to silver in lower half (Fig. 5A–F).

Color of holotype in preservative

Dorsum and limbs surfaces faded to uniform grey; brown triangular marking distinctly visible between eyes; irregular black spots on flanks distinct; throat, chest grey, and belly creamy white; pectoral, femoral, supra-axillary, and ventrolateral glands creamy white; dark bars on limbs, fingers, and toes distinct; elbow pale orange; upper arm and tibiotarsus faded to grey.

Variation

Measurements of the type series are presented in Table 2. The presence of tubercles or ridges on the dorsum varies, as do the irregular markings (Suppl. material 1: fig. S1). Certain specimens exhibit a lighter mustard color. Additionally, the margin of the throat displays creamy-white tubercles in some individuals (Suppl. material 1: fig. S2).

Measurements of holotype

(in mm). SVL 27.6, HL 8.6, HW 9.3, SNT 4.0, ED 3.0, IOD 3.1, TD 1.3, TED 1.2, IN 2.4, TIB 11.7, FLL 12.2, THL 17.8, ML 6.7, HLL 39.4, FG-knee 4.7.

Ecology and distribution

Leptobrachella dayaoshanensis sp. nov. was discovered in the evergreen forest at Mount Dayaoshan, at elevations between 1,000 and 1,600 m. Our observations revealed that adult males of this species were found calling near rocky streams between 19:00 and 24:00 h during our survey. Interestingly, there were also instances where advertisement calls could be heard during the daytime. We noted that the advertisement calls were audible from early March until the end of April. Presently, L. dayaoshanensis sp. nov. is only found within the Dayaoshan National Nature Reserve.

Comparisons

Leptobrachella dayaoshanensis sp. nov. can be distinguished from other Leptobrachella species by its body size (males: SVL 26.6–28.9 mm; female: 34.4 mm); small, raised tubercles and ridges on dorsum; presence of irregular black spots on flanks; creamy-yellow ventral surface with sparse, light-brown spots and irregular textures; rudimentary toe webbing; wide lateral fringes; tongue with a shallow notch; brown throat and chest; distinct continued ventrolateral glandular line; tibiotarsal articulation reaching the midpoint of eye; heels not meeting when thighs are appressed at right angles to body; and bicolored iris, with the upper half being copper, gradually transitioning to silver in the lower half. Furthermore, the species can be identified by its unique advertisement calls (Fig. 4, Suppl. material 2: table S4).

Phylogenetically, L. dayaoshanensis sp. nov. is closely related to L. liui, L. mangshanensis, and L. verrucosa (Fig. 3). Morphologically, L. dayaoshanensis sp. nov. differs from L. liui in having a relatively larger body size in female (SVL 34.4 mm vs SVL 23.1–28.1 mm); HL/HW = 0.92 (vs HL/HW = 1.01); ventral surface creamy yellow, with sparse, light-brown spots and irregular textures, brown throat and chest with scattered, light, creamy spots (vs chest and margins creamy white with dark-brown spots); heels not meeting when thighs are appressed at right angles to body (vs overlapped); consecutive dermal ridges under toes (vs discrete dermal ridges); different call durations (68–88 ms vs 26–78 ms) and dominant frequencies (4.2–6.8 kHz vs 4.8–5.5 kHz). Leptobrachella dayaoshanensis sp. nov. differs from L. mangshanensis in having a rough dorsal surface with small, raised tubercles and ridges (vs dorsal skin smooth with small orange tubercles and irregular, dark-brown stripes); wide toe lateral fringes (vs narrow toe lateral fringes); distinct longitudinal ridges under toes (vs indistinct longitudinal ridges under toes); tibiotarsal articulation reaching the medium of eye (vs tibiotarsal articulation reaching anterior margin of snout); brown throat and chest, and creamy-white belly with sparse, light-brown spots and irregular, tiny textures (vs greyish-white throat and belly with little white speckles); bicolored iris, upper half copper, gradually transitioning to silver in lower half (vs bright-orange upper, greyish cream below). Leptobrachella dayaoshanensis sp. nov. differs from L. verrucosa in having relatively larger body size in males (SVL 26.6–28.9 mm vs SVL 23.2–25.9 mm); head width larger than length (HW/HL = 1.08) (vs head length slightly larger than head width, HW/HL = 0.95); eye diameter less snout length (SNT/ED = 1.33) (vs SNT/ED = 1.03); tongue with a shallow notch at the posterior tip (vs tongue deeply notched distally); tibiatarsal articulation reaching the medium of eye when the leg is pressed forward (vs tibiotarsal articulation reaches to anterior corner of eye); rough dorsal surface with small, raised tubercles and ridges (vs shagreened dorsal surface with numerous conical tubercles, lacking spines, enlarged warts, or skin ridges); brown supratympanic line (vs black supratympanic line); wide toe lateral fringes (vs narrow toe lateral fringes); brown throat and chest (vs creamy white); relative finger lengths I < II < IV < III (vs I = II = IV < III); bicolored iris, upper half copper, gradually transitioning to silver in lower half (vs upper half coppery orange, lower half greyish brown); distinct continued ventrolateral glandular line (vs discrete ventrolateral gland line). Furthermore, L. dayaoshanensis sp. nov. is found at elevations over 1,000 m, whereas L. verrucosa inhabits elevations of 500–600 m. The advertisement calls of the new species can be heard from early March to the end of April, while the breeding season of L. verrucosa lasts from April to June according to Lin et al. (2022).

Leptobrachella dayaoshanensis sp. nov. differs from L. shimentaina and L. yunkaiensis in lacking lateral fringes on fingers (vs presence of lateral fringes on fingers), heels not meeting when thighs are appressed at right angles to body (vs overlapped); from L. flaviglandulosa in having heels not meeting when adpressed (vs overlapped), consecutive dermal ridges under toes (vs discrete dermal ridges); from L. bashaensis in having relatively larger body size (SVL 26.6–28.9 mm in males, 34.4 mm in female vs SVL 22.9–25.6 mm in males, 27.1 mm in female); wide toe lateral fringes (vs narrow toe lateral fringes); from L. maoershanensis in having wide toe lateral fringes (vs narrow toe lateral fringes), distinct consecutive dermal ridges under toes (vs indistinct longitudinal ridges under toes); from L. laui in lacking finger lateral fringes (vs presence of moderate lateral fringes), creamy-yellow ventral surface with sparse, light-brown spots and irregular textures, brown throat and chest with scattered, light-creamy spots (vs near immaculate creamy-white chest and belly); from L. phiaoacensis in having wide toe lateral fringes (vs narrow toe lateral fringes), heels not meeting when thighs are appressed at right angles to body (vs overlapped), continued ventrolateral glandular line (vs discrete ventrolateral gland line), brown throat and chest (vs creamy white).

In having supra-axillary and ventrolateral glands, L. dayaoshanensis sp. nov. differs from its congeners from South of the Isthmus of Kra, L. arayai, L. dringi, L. fritinniens, L. gracilis, L. hamidi, L. heteropus, L. kajangensis, L. kecil, L. marmorata, L. maura, L. melanoleuca, L. picta, L. platycephala, L. sabahmontana, and L. sola (vs absent in the latter species). In having a relatively larger body size (SVL 26.6–28.9 mm in males, 34.4 mm in females), L. dayaoshanensis sp. nov. differs from L. baluensis (SVL 14.9–15.9 mm in males), L. bondangensis (SVL 17.8 mm in male), L. brevicrus (SVL 17.1–17.8 mm in males), L. fusca (SVL 16.3 mm in male), L. itiokai (SVL 15.2–16.7 mm in males), L. juliandringi (SVL 17.0–17.2 mm in males), L. mjobergi (SVL 15.7–19.0 mm in males), L. natunae (SVL 17.6 mm in male), L. palmata (SVL 14.4–16.8 mm in males), L. parva (SVL 15.0–16.9 mm in males), and L. serasanae (SVL 16.9 mm in female).

For the remaining known Leptobrachella species from north of the Isthmus of Kra, in having SVL 26.6–28.9 mm in males, L. dayaoshanensis sp. nov. differs from the smaller L. applebyi (19.6–22.3 mm), L. ardens (21.3–24.7 mm), L. bidoupensis (18.5–25.4 mm), L. melica (19.5–22.7 mm), L. niveimontis (22.5–23.6 mm), L. pluvialis (21.3–22.3 mm), L. rowleyae (23.4–25.4 mm); from the larger L. dushanensis (31.9–32.9 mm), L. nahangensis (40.8 mm), L. sungi (48.3–52.7 mm), and L. zhangyapingi (45.8–52.5 mm).

Furthermore, in having wide lateral fringes on toes, L. dayaoshanensis sp. nov. differs from L. applebyi, L. ardens, L. crocea, L. kalonensis, L. lateralis, L. macrops, L. maculosa, L. melica, L. nahangensis, L. namdongensis, L. neangi, L. nyx, L. oshanensis, L. pallida, L. pluvialis, L. pyrrhops, L. rowleyae, L. shiwandashanensis, L. tadungensis, L. tuberosa and L. ventripunctatus (vs absent lateral fringes on toes). In having black spots on flanks, L. dayaoshanensis sp. nov. differs from L. aerea, L. botsfordi, L. crocea, L. eos, L. firthi, L. graminicola, L. isos, L. pallida, L. petrops and L. tuberosa (vs absent).

Leptobrachella dayaoshanensis sp. nov. differs from its congeners in the dominant frequency of 4.2–6.8 kHz (21.0 °C) (Suppl. material 2: table S4).

Discussion

Preprimary phylogenetic trees revealed that sequences named Leptobrachella liui downloaded from GenBank (Chen et al. 2018; Frost 2024) did not form a monophyletic group but could be divided into four lineages. Among these lineages, the DYS specimens form a monophyletic group closely related to L. verrucosa. Despite the close phylogenetic relationship, the DYS specimens and L. verrucosa are distinct, as confirmed by PCA, Man-Whitney U test, and morphological characters (see comparison section). Therefore, the DYS specimens can be classified as a new species of Leptobrachella. Three sequences named L. liui from southwestern Guangdong were clustered with L. yunkaiensis (paratype) with well-supported values (Fig. 3). Due to their close geographical distance and low genetic divergence (Suppl. material 2: table S3), we assigned these three sequences to L. yunkaiensis. Sequences named L. liui but nested within L. mangshanensis were treated as L. mangshanensis, which are found in the borders between Hunan and Jiangxi, and between Guangxi, Guangdong, and Hunan (Fig. 1). The sensu stricto L. liui occurs in and around the type locality (Wuyishan, Fujian, China), as well as northern and eastern Guangdong (Fig. 1). Further field investigations are required to determine whether L. liui and L. mangshanensis have sympatric distributions.

Additionally, it should be noted that the taxonomy of the population of Leishan, Guizhou reported by Fei et al. (1992) has not been considered within the L. liui species complex. In recent years, several new species of Leptobrachella have been discovered in Guizhou (AmphibiaChina 2024). However, there is no evidence supporting the existence of L. liui in Guizhou. Therefore, we conclude that L. liui does not exist in Guizhou.

Acknowledgements

We express our gratitude to the staff of the Dayaoshan National Nature Reserve for their assistance during fieldwork. We also extend our thanks to Zhi-Tong Lyu for providing measurements of certain species. Finally, we would like to acknowledge the contributions of the two reviewers, Chung Hoang and Gang Wei, as well as the academic editor, Angelica Crottini, in enhancing the quality of this manuscript.

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Funding

This work was supported by the National Natural Science Foundation of China (grant numbers 32360128 and 32060116), Guangxi Natural Science Foundation, China (grant number 2020GXNSFDA238022), and Guangxi Forest Department (grant number 2014–22). Additionally, this research received support from the scientific research capacity building project for Laibin Jinxiu Dayaoshan Forest Ecosystem Observation and Research Station of Guangxi (grant number 22–035–130–01).

Author contributions

CWC conceived and designed the study and prepared the manuscript. YGD and CWC measured the specimens. CWC and LP performed the molecular experiments and analyzed the data. CWC, YGD, MT and QK conducted field surveys. PWX drew the figures. All authors read and approved the final version of the manuscript.

Author ORCIDs

Gui-Dong Yu https://orcid.org/0009-0008-1928-6594

Peng Li https://orcid.org/0000-0001-8311-0544

Wan-Xiao Peng https://orcid.org/0000-0001-5635-9061

Wei-Cai Chen https://orcid.org/0000-0002-2398-4079

Data availability

All of the data that support the findings of this study are available in the main text or Supplementary Information.

References

  • AmphibiaChina (2024) The database of Chinese amphibians. Kunming Institute of Zoology (CAS), Kunming, Yunnan, China. [Electronic Database accessible at:] http://www.amphibiachina.org/ [accessed 5 Feb. 2024]
  • Boulenger GA (1893) Concluding report on the reptiles and batrachians obtained in Burma by Signor L. Fea dealing with the collection made in Pegu and the Karin Hills in 1887–88. Annali del Museo Civico di Storia Naturale di Genova 13: 304–347.
  • Chen JM, Poyarkov Jr NJ, Suwannapoom C, Lathrop A, Wu YH, Zhou WW, Yuan ZY, Jin JQ, Chen HM, Liu HQ, Nguyen TQ, Nguyen SN, Duong TV, Eto K, Nishikawa K, Matsui M, Orlov NL, Stuart BL, Brown RM, Rowley JJL, Murphy RW, Wang YY, Che J (2018) Largescale phylogenetic analyses provide insights into unrecognized diversity and historical biogeography of Asian leaf-litter frogs, genus Leptolalax (Anura: Megophryidae). Molecular Phylogenetics and Evolution 124: 162–171. https://doi.org/10.1016/j.ympev.2018.02.020
  • Chen WC, Peng WX, Pan WH, Liao NY, Liu YJ, Huang Y (2021) A new species of Leptobrachella Smith 1925 (Anura: Megophryidae) from southern Guangxi, China. Zootaxa 5020: 581–596. https://doi.org/10.11646/zootaxa.5020.3.8
  • Dubois A (1980) Notes sur la systematique et la repartition des amphibiens anoures de Chine et des regions avoisinantes IV. Classification generique et subgenerique des Pelobatidae Megophryinae. Bulletin Mensuel de la Société Linnéenne de Lyon 49: 469–482. https://doi.org/10.3406/linly.1980.10444
  • Fei L, Ye CY (2016) Amphibians of China, Volume 1. Chengdu Institute of Biology, Chinese Academy of Sciences. Science Press, Beijing, 1040 pp.
  • Fei L, Ye CY, Huang YZ (1990) Key to Chinese Amphibians. Publishing House for Scientific and Technological Literature, Chongqing, 364 pp.
  • Fei L, Ye CY, Li SS (1992) Two new species of pelobatid toads of genus Leptolalax from Yunnan Province of China (Amphibia: Anura). Acta Biologica Plateau Sinica 11: 45–54.
  • Fei L, Ye CY, Jiang JP (2012) Colored atlas of Chinese Amphibians and their distributions. Sichuan Publishing House of Science and Technology, Chengdu, 619 pp.
  • Hou YM, Zhang MF, Hu F, Li SY, Shi SC, Chen J, Mo XY, Wang B (2018) A new species of the genus Leptolalax (Anura, Megophryidae) from Hunan, China. Zootaxa 4444(3): 247–266. https://doi.org/10.11646/zootaxa.4444.3.2
  • Kalyaanamoorthy S, Minh BQ, Wong TK, Von Haeseler A, Jermiin LS (2017) ModelFinder: fast model selection for accurate phylogenetic estimates. Nature Methods 14(6): 587–589. https://doi.org/10.1038/nmeth.4285
  • Köhler J, Jansen M, Rodríguez A, Kok PJR, Toledo LF, Emmrich M, Glaw F, Haddad CFB, Rödel MO, Vences M (2017) The use of bioacoustics in anuran taxonomy: Theory, terminology, methods and recommendations for best practice. Zootaxa 4251(1): 1–124. https://doi.org/10.11646/zootaxa.4251.1.1
  • Kumar S, Stecher G, Tamura K (2016) MEGA 7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Molecular Biology and Evolution 33: 1870–1874. https://doi.org/10.1093/molbev/msw054
  • Lin SS, Li YH, Lu YH, Su HL, Wu SB, Zhang QQ, Mo MJ, Xiao SJ, Pan Z, Pan HJ, Zeng ZC (2022) A new species of the genus Leptobrachella (Anura, Megophryidae) from northwestern Guangdong Province, China. Herpetozoa 35: 165–178. https://doi.org/10.3897/herpetozoa.35.e89981
  • Mo YM, Wei ZY, Chen WC (2014) Colored Atlas of Guangxi Amphibians. Guangxi Science and Technology Publishing House, Nanning, 313 pp.
  • Nguyen LT, Schmidt HA, Von HA, Minh BQ (2015) IQ-TREE: A fast and effective stochastic algorithm for estimating maximum likelihood phylogenies. Molecular Biology and Evolution 32(1): 268–274. https://doi.org/10.1093/molbev/msu300
  • Palumbi SR, Martin R, Romano S, McMillan WO, Stice L, Grabowski G (1991) The Simple Fool’s Guide To PCR, v2.0. Special publication of the University of Hawaii Department of Zoology and Kewalo Marine Laboratory.
  • Pope CH (1931) Notes on Amphibians from Fukien, Hainan, and other parts of China. Bulletin of the AMNH 61: 8.
  • Ronquist F, Teslenko M, Van Der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) Mrbayes 3.2: Efficient bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029
  • Rowley JJL, Tran DTA, Le DTT, Dau VQ, Peloso PLV, Nguyen TQ, Hoang HD, Nguyen TT, Ziegler T (2016) Five new, microendemic Asian Leaf-litter Frogs (Leptolalax) from the southern Annamite mountains, Vietnam. Zootaxa 4085(1): 63–102. https://doi.org/10.11646/zootaxa.4085.1.3
  • Shen YH (2014) Fauna Hunan: Amphibia. Hunan Science and Technology Press, Changsha, China.
  • Smith MA (1925) Contributions to the herpetology of Borneo. Sarawak Museum Journal 3: 15–34.
  • Smith MA (1930) The reptiles and amphibians of Malay Peninsula. Bulletin Raffles Museum 3: 1–149.
  • Wang J, Yang JH, Li Y, Lyu ZT, Zeng ZC, Liu ZY, Ye YH, Wang YY (2018) Morphology and molecular genetics reveal two new Leptobrachella species in southern China (Anura, Megophryidae). ZooKeys 776: 105–137. https://doi.org/10.3897/zookeys.776.22925
  • Zhang D, Gao F, Jakovlić I, Zou H, Zhang J, Li WX, Wang GT (2020) PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Molecular Ecology Resources 20(1): 348–355. https://doi.org/10.1111/1755-0998.13096

Supplementary materials

Supplementary material 1 

Supplementary figures

Gui-Dong Yu, Kun Qin, Tao Meng, Peng Li, Wan-Xiao Peng, Wei-Cai Chen

Data type: pdf

Explanation note: figure S1. Dorsal surface compared between holotype and some paratypes. A NNU 20210318, B NNU 20210322, C NNU 20210324, D NNU 20210325, E NNU 20210330, F NNU 20210327; figure S2. Ventral surface compared among some paratypes and ventral view of foot. A NNU 20210320, B NNU 20210322, C NNU 20210324, D NNU 20210327, E NNU 20210330, F NNU 20210332, G NNU 20210322, H NNU 20210325.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (668.14 kb)
Supplementary material 2 

Supplementary tables

Gui-Dong Yu, Kun Qin, Tao Meng, Peng Li, Wan-Xiao Peng, Wei-Cai Chen

Data type: xlsx

Explanation note: table S1: References for morphological characters for congeners of the genus Leptobrachella; table S2: Comparative material examined; table S3: Uncorrected p-distance in Leptobrachella species based on 16S gene fragments; table S4: Dominant frequency of advertisement calls of species available in the genus Leptobrachella.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (122.87 kb)
login to comment