Catalogue |
|
Corresponding author: Anja Palandačić ( anja.palandacic@nhm-wien.ac.at ) Academic editor: Fedor Konstantinov
© 2024 Anja Palandačić, Min J. Chai, Gennadiy A. Shandikov, Nesrine Akkari, Pedro R. Frade, Susanne Randolf, Hans-Martin Berg, Ernst Mikschi, Nina G. Bogutskaya.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Palandačić A, Chai MJ, Shandikov GA, Akkari N, Frade PR, Randolf S, Berg H-M, Mikschi E, Bogutskaya NG (2024) An annotated catalogue of selected historical type specimens, including genetic data, housed in the Natural History Museum Vienna. ZooKeys 1203: 253-323. https://doi.org/10.3897/zookeys.1203.117699
|
Museum collections are an important source for resolving taxonomic issues and species delimitation. Type specimens as name-bearing specimens, traditionally used in morphology-based taxonomy, are, due to the progress in historical DNA methodology, increasingly used in molecular taxonomic studies. Museum collections are subject to constant deterioration and major disasters. The digitisation of collections offers a partial solution to these problems and makes museum collections more accessible to the wider scientific community. The Extended Specimen Approach (ESA) is a method of digitisation that goes beyond the physical specimen to include the historical information stored in the collection. The collections of the Natural History Museum Vienna represent one of the largest non-university research centres in Europe and, due to their size and numerous type specimens, are frequently used for taxonomic studies by visiting and resident scientists. Recently, a version of ESA was presented in the common catalogue of the Fish and Evertebrata Varia collections and extended to include genetic information on type specimens in a case study of a torpedo ray. Here the case study was extended to a heterogeneous selection of historical type series from different collections with the type locality of Vienna. The goal was to apply the ESA, including genetic data on a selected set of type material: three parasitic worms, three myriapods, two insects, twelve fishes, and one bird species. Five hundred digital items (photographs, X-rays, scans) were produced, and genetic analysis was successful in eleven of the 21 type series. In one case a complete mitochondrial genome was assembled, and in another case ten short fragments (100–230 bp) of the cytochrome oxidase I gene were amplified and sequenced. For five type series, genetic analysis confirmed their taxonomic status as previously recognised synonyms, and for one the analysis supported its status as a distinct species. For two species, genetic information was provided for the first time. This catalogue thus demonstrates the usefulness of ESA in providing digitised data of types that can be easily made available to scientists worldwide for further study.
Biodiversity, digitisation, historical DNA, type locality Vienna, zoological collections
Museum collections are the largest archives of biodiversity, encompassing taxonomic, spatial, and temporal variation (
Museum collections are subject to gradual but constant deterioration, as well as catastrophes of major proportions (recently reviewed in
Founded more than 270 years ago, the collections of the Natural History Museum Vienna (
Similarly, a version of this approach was presented in the common catalogue of the
The Chromadorea and Trematoda type series represented in this catalogue are a part of the Parasitic-worms collection (for further reading see
Maximilian Braun (1850–1930) was an ornithologist, zoologist, and physician whose main focus was on the trematode parasites of birds. As an anatomist, Braun contributed greatly to the medical field of parasitology. Born in Myslowitz in 1850, Braun studied medicine and natural sciences before obtaining his doctorate in 1877. Braun was a full Professor of zoology and comparative anatomy at the University of Rostock and later in Königsberg (now Kaliningrad), where he was director of the Zoological Museum and where he would die in 1930. In 1916–1917 he was president of the German Zoological Society. During his career, Maximilian Braun published several zoological books, such as Developmental history of the Tapeworm (Entwicklungsgeschichte des Bandwurms) (
Leopold Karl Böhm (1886–1958) was a veterinarian, zoologist, and parasitologist. Born in Vienna in 1886, Böhm received his doctorate in 1910 and his veterinary degree in 1916, becoming an associate Professor in 1924 and a Professor in 1937. Böhm went on to head the Institute of General Zoology and Parasitology at the University of Veterinary Medicine in Vienna, and later serving as its rector (1948–1950) and vice-rector (1950–1952). In 1941, Böhm became a full member of the Austrian Academy of Sciences and died in Vienna in 1958. Böhm published numerous scientific papers in zoological and veterinary journals and was co-editor of several journals (e.g., the Vienna Veterinary Monthly (Wiener Tierärztliche Monatsschrift), the Journal of Scientific Biology (Zeitschrift für wissenschaftliche Biologie), the Journal of Parasitology (Zeitschrift für Parasitenkunde), and the Austrian Zoological Journal (Österreichische Zoologische Zeitschrift).
Rudolf Supperer (1918–2006) was a veterinary surgeon and student of Leopold Karl Böhm, who later became Professor of Parasitology and General Zoology at the University of Veterinary Medicine in Vienna. Born in Kirchstetten in 1918, Supperer was also rector of the University of Veterinary Medicine from 1967 to 1969. Together with Böhm, Supperer established the genus name Wehrdikmansia, in honour of the work of Wehr and Dikmans, who described numerous filarioid nematodes (family Filariidae;
The Diplopoda type series represented in this catalogue are a part of Myriapoda collection (MY; for further reading see
Robert Latzel (1845–1919), a pioneer in myriapodology, was born in Silesia (today’s Czech Republic). Although his main profession at that time was a teacher of natural history at high schools and later a principal of the main grammar school in Klagenfurt, Carinthia, since 1875, he studied myriapods. His major work (
The collection owes its value also to the imminent Austrian myriapodologist Carl Attems (1894–1952), examined material from nearly all parts of the world, described ca 1700 species and published 138 papers, monographs, and textbooks.
The Insecta type series represented in this catalogue are a part of the Neuropterida-Orthopteroidea-Insecta Varia collection (ORTH; for further reading see
Detailed biographical data on Vinzenz Kollar (1797–1860) can be found in
Vinzenz Kollar was born in Kranowitz (then Prussian Silesia, now Poland) on 15 January 1797. After completing his education, he moved to Vienna in 1815 to study medicine. His growing interest in entomology led him to the Natural History Cabinet in 1817, where he met the curator of the insect collection, Franz Anton Ziegler (1760–1842). Under his guidance, Kollar began to examine the existing collections and put them into a systematic order. Initially an unpaid volunteer, he was eventually given a permanent position and finally became the director of the Imperial Court Zoological Cabinet in 1851.
His first publication was a systematic work on a genus of beetles, inspired by the many collections made by explorers in Brazil (
Vinzenz Kollar was a member of the Austrian Academy of Sciences, awarded the Ritterkreuz of the Franz-Joseph Order and appointed a Geheimer Regierungsrat. After his death on 30 May 1860, he was buried in an honorary grave in the Vienna Central Cemetery.
The largest and most valuable addition to the Orthoptera collection was the Brunner von Wattenwyl collection, acquired by the Museum in 1901. At that time, it was one of the most important Orthoptera collections in the world, with some 79,500 specimens of 10,600 species. Carl Brunner von Wattenwyl (1823–1914) was a Swiss geologist who established telegraphy in Switzerland in 1851 and became director of the Austrian Post and Telegraph Administration in 1857 (
Not only did he collect himself, but he also actively traded and added to his collection through purchases. In 1859 he received from Rudolf Türk some alpine groundhoppers collected on the banks of the Danube. Not much is known about Rudolf Türk. His date of birth is given as “around 1820” (
The physician and entomologist Hermann Krauss (1848–1939) was in active correspondence with Brunner von Wattenwyl for several decades (Entomological letter collection Brunner von Wattenwyl (Entomologische Briefsammlung Brunner von Wattenwyl)/Second Zoological Department/
The Actinopteri type series represented in this catalogue are a part of the Fish collection (FS from Fischsammlung in German; for further reading see
A detailed description of the life and scientific career of Johann Jakob Heckel (1790–1857) can be found in historical (
Johann Jakob Heckel, born on 23 January 1790 in Churpfalz (now Mannheim), began his career in 1818 as a volunteer taxidermist in the United Imperial Royal Natural History Cabinet in Vienna. In 1819–1820, Heckel travelled through Germany, Switzerland, and Italy, and in August 1820 he was officially employed as a taxidermist in the vertebrate department of the Natural History Cabinet in Vienna under the curator Joseph Natterer Jr. He began scientific studies of terrestrial and freshwater molluscs, birds, and fishes, paying particular attention to the Fish collection, which at that time consisted of only ca 700 specimens.
Under the guidance of the curator Leopold Joseph Fitzinger (1802–1884), Heckel participated in the preparation of a detailed inventory of Austrian fish fauna, first of the Danube, then of Lake Neusiedl, Lake Balaton, and the Upper Austrian lakes. In 1824 he travelled to Upper Austria and Salzburg for several months and made some useful acquaintances, including the well-known Swiss ichthyologist Louis J. R. Agassiz (1807–1873), who then spent a long period in Vienna in 1830. A number of fish specimens collected during these trips are still extant in the
On 26 February 1832, Heckel was appointed curator of the Fish collection of the Natural History Cabinet. A number of stuffed fishes collected by him were given to the Vienna University Museum (
Heckel was a skilled artist; his original drawings of scales, bones, teeth, and whole fishes were used as illustrations in his publications (e.g.,
During the 1840s and 1850s, Heckel authored or contributed to more than 30 publications on recent fishes (e.g.,
In 1851, Emperor Franz Joseph ordered the reorganisation of the United Imperial Royal Natural History Cabinet into three administratively separate cabinets, and Heckel was appointed deputy curator of the Fish collection of the Court Zoological Cabinet. Johann Jakob Heckel died of ‘wasting’ (a long-term infection or tuberculosis) on 1. March 1857. He did not live to see the publication of the summary results on the fishes of Austria (
The two Aves types represented in this catalogue are a part of the Bird collection (VS from Vogelsammlung in German; for further reading see
Christian Ludwig Brehm (1787–1864) was born on 24 January 1787 in Schönau vor dem Walde near Gotha, Thuringia, the son of a pastor. He studied theology at Jena and began a career as a tutor in 1810. In 1812 he became a pastor in Drackendorf, near Jena, and from 1813 until his death on 23 June 1864 he was the parish priest in Renthendorf, near Neustadt, Thuringia (
Throughout his life, Brehm’s deep interest in the world of birds coexisted with his pastoral duties, earning him an honoured position in German ornithology. His early fascination with birds, coupled with his expertise in taxidermy and bird collecting, culminated in a collection of at least 9000 bird specimens. This collection laid the foundation for his research into the differentiation of bird species. Initiated by Pastor Otto Kleinschmidt and Ernst Hartert, a significant part of Brehm’s collection found its way to the Rothschild Museum in Tring, UK, and then to New York. Some parts of the collection eventually returned to the Alexander Koenig Museum in Bonn. Brehm’s attention to minute morphological distinctions led to several species and subspecies descriptions, most notably in his comprehensive work Handbook of the natural history of all birds in Germany (Handbuch der Naturgeschichte aller Vögel Deutschlands) (
Brehm’s other notable works include Contributions to Ornithology (Beiträge zur Ornithologie, 3 volumes, 1820–1822), the world’s first ornithological journal, Ornis or the newest and most important of ornithology (Ornis oder das neueste und wichtigste der Vögelkunde; 3 issues, 1824–1827) and The entire bird catch (Der gesamte Vogelfang) (
It is evident that Brehm was in contact with Johann Jakob Heckel, as a note at Anser brevirostris “Heckel” in the copy of Handbook of the natural history of all birds in Germany (
The ESA, as previously applied to the
It is impossible to publish all the imagery and other prepared files, so these data have been linked to the associated physical voucher specimens via a database (Fig.
Dates in the species accounts are given as they appear on the labels, catalogue cards, acquisition book and main inventory book. In some cases, it is not possible to distinguish between the date of collection, acquisition, and inventory (registration) based on existing written collection information sources. However, special searches were made for historical data on the routes and times of the collection trips under consideration, and the dates of collection and geographical location of type localities were clarified.
Recent preservation condition of type specimens was evaluated by a six-point grade: very poor – poor – bad – average – good – very good. The descriptions of the conditions are based on the definitions given in the Fish collection data base and are summarised in Table
The descriptions used for describing the preservation condition of specimens are based on the descriptions given in the Fish collection data base and are summarised here.
| Condition | Description |
|---|---|
| Very poor | Fallen apart, completely destroyed; worse than dissected, maybe should be discarded. |
| Poor | Specimen not good for some systematic work, e.g., scale counts, colour or shape analysis. |
| Bad | Specimen not good but still suitable for some systematic work, e.g., shape analysis or radiography. |
| Average | Suitable for systematic work like some measurements and counts. |
| Good | Specimen well suitable for morphological analysis and photography or demonstration, but some damage to, e.g., fins. |
| Very good | Nice specimen suitable for photography or demonstration characters but not completely excellent. |
| Excellent | 100% intact specimen; should be treated with great care. |
BL
, body length; ESA, Extended Specimen Approach;
The set of Acquisition Sheets is a reliable source of original primary information that accompanied the specimens at the time of their accession to the collection. However, the earliest Acquisition Sheets (1806 to 1850s) do not constitute a true register analogous to a collection catalogue (they do not contain catalogue numbers), but rather a register to identify the materials in terms of from whom they were received: purchased (with the money paid indicated), donated, or exchanged. Identifications follow a sender or a person who filled in the acquisition list, and were sometimes later corrected or some information added. Localities are not always given, have been added later, or are not accurate, as the information would have been given on labels accompanying the specimens. However, these have often faded, been damaged or lost over time. As a result, the date of collection has often been lost or omitted, and only the date of acquisition is known. See also the Remarks section in the catalogue list.
There are no acquisition lists for the Orthoptera collection, apart from the directories (Figs
After the acquisition of the material, the identifications follow either a sender or a person who filled in the acquisition list (Josef Natterer, Fitzinger or Heckel), with later corrections and additions by Heckel (who was the only one to study the collection taxonomically at the time). Localities were sometimes added later by Heckel (an example is shown in Fig.
The source of a large number of fish specimens received (purchased) by the Fish collection in the 1825–1840s, named ‘Laboratorio’ or ‘Laboratorium’, is not entirely clear. Judging by the context, it could have been a laboratory of the Natural History Cabinet itself, which was organisationally not part of the collections and was managed separately (M. Svojtka, pers. comm.); at least this “laboratory” was involved in some kind of aquatic studies or fisheries control. It is important to note that although no localities were given in the acquisition sheets (only “purchased from Laboratory”), many (but not all) labels on (in) jars and recorded in the inventory book contain localities (mostly Vienna (“Wien”)), but also Lake Neusiedl (“Neusidlersee”) and some others; all reasonably close to Vienna. This obviously means that at least when Victor Pietschmann (curator of the Fish collection 1919–1946) started the Inventory Book (presumably, late 1940s), the old (now lost) labels existed.
The sample set contains type series of 21 nominal species: three of parasitic worms, three of myriapods, two of insects, twelve of fishes, and one bird. Vernacular names are used here and throughout the text where generalisation is necessary, and original names when Latin names are given, for detailed classification see Table
Classification of type series presented in this catalogue. The classification of fishes follows
| Coll. | Phylum | Subphylum | Class | Order | Family | Original name | Name |
|---|---|---|---|---|---|---|---|
| EV | Platyhelminthes | Trematoda | Plagiorchiida | Dicrocoeliidae | Lyperosomum corrigia Braun, 1901 | parasitic worm | |
| EV | Platyhelminthes | Trematoda | Plagiorchiida | Orchipedidae | Orchipedum tracheicola Braun, 1901 | parasitic worm | |
| EV | Nematoda | Chromadorea | Rhabditida | Onchocercidae | Wehrdikmansia rugosicauda Böhm & Supperer, 1935 | parasitic worm | |
| MY | Arthropoda | Myriapoda | Diplopoda | Polydesmida | Polydesmidae | Brachydesmus superus Latzel, 1884 | myriapod |
| MY | Arthropoda | Myriapoda | Diplopoda | Julida | Julidae | Cylindroiulus ignoratus Attems, 1927; Iulus scandinavius Latzel, 1884 | myriapod |
| ORTH | Arthropoda | Insecta | Orthoptera | Rhaphidophoridae | Locusta cavicola Kollar, 1833 | insect | |
| ORTH | Arthropoda | Insecta | Orthoptera | Tetrigidae | Tetrix tuerki Krauss, 1876 | insect | |
| FS | Chordata | Actinopteri | Cypriniformes | Leuciscidae | Abramis leuckartii Heckel, 1836; Abramis schreibersii Heckel, 1836; Alburnus breviceps Heckel & Kner, 1858; Aspius mento Heckel, 1837; Blicca argyroleuca Heckel, 1843; Cyprinus acuminatus Heckel & Kner, 1858; Idus melanotus Heckel & Kner, 1858; Idus miniatus Heckel & Kner, 1858; Leuciscus virgo Heckel, 1852; Phoxinus marsilii Heckel, 1836; Squalius delineatus Heckel, 1843; Squalius lepusculus Heckel, 1852 | fish | |
| VS | Chordata | Aves | Anseriformes | Anatidae | Anser brevirostris Brehm, 1831 | goose |
| Collection | Original name | Valid name | Inventory number | Type status | Year | Preservation |
|---|---|---|---|---|---|---|
| EV | Lyperosomum corrigia Braun, 1901 | Lyperosomum corrigia | 4429 | SYN | 1858 | Ethanol |
| EV | Orchipedum tracheicola Braun, 1901 | Orchipedum tracheicola | 4472 | SYN | 1857 | Ethanol |
| EV | Wehrdikmansia rugosicauda Böhm & Supperer, 1935 | Cercopithifilaria rugosicauda | 6352 | SYN | 1952 | Ethanol |
| MY | Brachydesmus superus Latzel, 1884 | Brachydesmus superus | 3661 | SYN | 1884 | Ethanol |
| MY | Cylindroiulus ignoratus Attems, 1927 | Cylindroiulus parisiorum | 8170 | SYN | 1884 | Ethanol |
| MY | Iulus scandinavius Latzel, 1884 | Julus scandinavius | 2749 | SYN | 1884 | Ethanol |
| ORTH | Locusta cavicola Kollar, 1833 | Troglophilus cavicola | - | SYN | 1831 | Dry Mounted |
| ORTH | Tetrix tuerki Krauss, 1876 | Tetrix tuerki | - | HOLO, PARA | 1859 | Dry Mounted |
| FS | Abramis leuckartii Heckel, 1836 | hybrid | 55331, 94754 | SYN | 1836 | Ethanol |
| FS | Abramis schreibersii Heckel, 1836 | Ballerus sapa | 16584, 79462–63 74963 | SYN | 1825 | Dry Mounted |
| FS | Alburnus breviceps Heckel & Kner, 1858 | Alburnus alburnus | 55539 | HOLO | 1856 | Ethanol |
| FS | Aspius mento Heckel, 1837 | Alburnus mento | 16261, 16441, 50440, 55630, 55650, 55652, 94795 | SYN | 1824, 1836 | Ethanol, Dry Mounted |
| FS | Blicca argyroleuca Heckel, 1843 | Blicca bjoerkna | 16901, 54918–20, 94767 | SYN | 1836 | Ethanol |
| FS | Cyprinus acuminatus Heckel & Kner, 1858 | Cyprinus carpio | 52846, 52854–55, 52927–29, 52950, 53403, 94708 | SYN | 1836, 1840 | Ethanol |
| FS | Idus melanotus Heckel & Kner, 1858 | Leuciscus idus | 53434, 53436, 53438–39, 53455, 53467, 58775, 94805 | SYN | 1825, 1840 | Ethanol, pharyngeal teeth |
| FS | Idus miniatus Heckel & Kner, 1858 | Leuciscus idus | 53432, 94807 | SYN | 1852 | Ethanol, pharyngeal teeth |
| FS | Leuciscus virgo Heckel, 1852 | Rutilus virgo | 22373, 50626, 94733 | SYN | 1825, 1836 | Ethanol |
| FS | Phoxinus marsilii Heckel, 1836 | Phoxinus marsilii | 51225, 98672 | LECTO, paralecto | 1825 or 1836 | Ethanol |
| FS | Squalius delineatus Heckel, 1843 | Leucaspius delineatus | 49783, 50794, 94777 | SYN | 1840 | Ethanol, pharyngeal teeth |
| FS | Squalius lepusculus Heckel, 1852 | Leuciscus leuciscus | 49345, 49347–48, 49359, 49393 | SYN | 1825, 1840 | Ethanol |
| VS | Anser brevirostris Brehm, 1831 | Anser erythropus | 55170, 20928 | SYN | 1824, 1828 | Dry Mounted |
Different tissue types were sampled depending on the animal group. For myriapods and parasitic worms, a damaged (incomplete) syntype was selected and digested for DNA extraction. For insects, a leg was carefully removed from a topotype (collected with the holotype) and digested for DNA extraction. For fish, gill rakes were taken from the right side of the body, while for dry specimens, small pieces of tissue were cut from the (historical) incision used to stuff the fish. For bird species, small pieces of toe pads were used. The insect species L. cavicola is represented by only one poorly preserved syntype, which is already missing a leg and was therefore considered too valuable to be further damaged for genetic analysis. See Table
Laboratory procedures were carried out in accordance with all requirements for working with museum material, including the use of UV-irradiated equipment, a clean room and negative extraction controls. For alcohol preserved samples, DNA was extracted from air-dried tissue using the QIAamp® DNA Blood and Tissue Micro Kit (Qiagen) following the manufacturer’s protocol, but with the addition of 40 µl of 100 mM dithiothreitol to the lysis buffer (to enhance lysis, following
After DNA extraction, the amount of double-stranded DNA was assessed by fluorometry (Qubit; ThermoFisher Scientific) using the Double-stranded DNA High Sensitivity Assay Kit. The average DNA fragment length was measured on the TapeStation system (Agilent) using High Sensitivity DNA Screen Tape. Depending on the results of these two measurements, the DNA was either sent for shotgun sequencing (IGA Technology Services, Udine, Italy). The raw sequences were then trimmed and complete mitochondrial genomes were assembled from a subset of 15 million pair-end reads using Geneious v 10.2.6 (http://www.geneious.com; for details see
After sequencing, smaller sequence fragments were visually inspected, aligned using MEGA 6.0 (
| Collection - Original name - Valid name - Gene | Primer Name | Sequence (5´-3´ direction) |
|---|---|---|
| EV - Lyperosomum corrigia - Corrigia corrigia - 28S | LcorriF1 | TTCATCGAGCTTCCTTGCCA |
| LcorriR1 | GCTAACGAGCTACCTGCCAT | |
| LcorriF2 | GTTAAACCGGCCTTGCGATG | |
| LcorriR2 | ACAGAACCATCACGGTCAGC | |
| EV - Orchipedum tracheicola - Orchipedum tracheicola - 18S | OtracheiiF1 | CGCTGCTCGTATTCTGGTCC |
| OtracheiiR1 | AACCGGCAAGTGGAACTCAC | |
| OtracheiiF2 | GTGAGTCGGTGTCGTGGTT | |
| OtracheiiR2 | GAAGCATGCCAACCAACCG | |
| EV - Wehrdikmansia rugosicauda - Cercopithifilaria rugosicauda - COI | WrugoF1 | GACCAGGAAGTAGTTGAA |
| WrugoR1 | CAGCCTCACTAATAATACCA | |
| MY - Brachydesmus superus - Brachydesmus superus - COI | BrachySuperF1 | GCACCCGATATGGCTTTTCC |
| BrachySuperR1 | AGACCACTAGCCAAAGGAGGA | |
| BrachySuperF2 | GGAAATTGGGGTTGGTACTGGA | |
| BrachySuperR2 | AGAAGAAGCCCCAGCTAAGT | |
| MY - Cylindroiulus ignoratus - Cylindroiulus parisiorum - COI | CylinIgnoF1 | TCCGCTGTTGAAAAAGGTGC |
| CylinIgnoR1 | ATGAAGCACCCGCTAAGTGT | |
| CylinIgnoF2 | GATATGGCCTTCCCCCGTTT | |
| CylinIgnoR2 | ACAGAAGGACCTGAGTGTGA | |
| MY - Iulus scandinavius - Julus scandinavius - COI | JulScandiF1 | ACCCTGGGAGTTTAATTGGAGA |
| JulScandiR1 | AATCGAGGGAAAGCTATGTC | |
| JulScandiF2 | AATTGATTAGTACCTTTAAT | |
| JulScandiR2 | AGGGCCAGAGTGAGAAATGT | |
| ORTH - Tetrix tuerki - Tetrix tuerki - COI | Ttuerki_F1 | TTCATCTTCGGGGCATGAGC |
| Ttuerki_R1 | AATCGGAGGGTTTGGTAATTGA | |
| Ttuerki_F2 | TAGTAGTAACAGCTCACGCATTTAT | |
| Ttuerki_R2 | AGATATGGCATTCCCGCGAATA | |
| FS - Abramis leuckartii – hybrid - COI | FishF1 | TCAACCAACCACAAAGACATTGGCAC |
| AleuckR1 | TATTACGAAGGCGTGGGCAGT | |
| AleuckF2 | AACGTCATCGTTACTGCCCA | |
| AleuckR2 | ACGATGGGGGTAGAAGTCAGA | |
| FS - Abramis schreibersii - Ballerus sapa - COI | FishF1 | TCAACCAACCACAAAGACATTGGCAC |
| BsapaR1 | AGAAAATTATTACGAAGGCGTGGG | |
| BsapaF2 | GTCACTTTTAGGCGATGACCAAAT | |
| BsapaR2 | TCGTGGGAATGCTATATCAGGT | |
| FS - Alburnus breviceps - Alburnus alburnus - COI FS - Aspius mento - Alburnus mento - COI FS - Blicca argyroleuca - Blicca bjoerkna - COI FS - Leuciscus virgo - Rutilus virgo - COI | FishF1 | TCAACCAACCACAAAGACATTGGCAC |
| BlicR1 | CGTGGGCGGTAACGATGACA | |
| BlicF2 | CTAAGCCAACCCGGGTCAC | |
| BlicR2 | TCAGGCGCACCGATTATTAGT | |
| FS - Idus melanotus - Leuciscus idus - COI FS - Idus miniatus - Leuciscus idus - COI | FishF1 | TCAACCAACCACAAAGACATTGGCAC |
| LeuiduR1 | TGGTCATCGCCTAAAAGTGACCC | |
| LeuiduF2 | CCCTAAGCCTCCTTATTCGGG | |
| LeuiduR2 | AGTCAATTTCCGAACCCGCC | |
| FS - Squalius delineatus - Leucaspius delineatus - COI | FishF1 | TCAACCAACCACAAAGACATTGGCAC |
| SdeliR1 | TCATCGCCTAAAAGTGACCCAGG | |
| SdeliF2 | GGAATAGTGGGGACTGCCTT | |
| SdeliR2 | ATCGGGCGCACCAATCATTA | |
| FS - Squalius lepusculus - Leuciscus leucisus- COI | FishF1 | TCAACCAACCACAAAGACATTGGCAC |
| Leuleu_R1 | CGTGGGCGGTAACGATAACATTG | |
| Leuleu_F2 | GCCGAACTAAGCCAACCCG | |
| Leuleu_R2 | GCCAATCATTAGTGGGACGAG | |
| VS - Anser brevirostris - Anser erythropus | Aerythro F1 | GCACCGCACTCAGCCTATTA |
| Aerythro R1 | CAGTTGCCGAATCCTCCGAT | |
| Aerythro F2 | ACCGCTCACGCCTTTGTAATA | |
| Aerythro R2 | TGGATGAGGCTAGTAGGAGGAG |
A total of 16 original descriptions, 17 drawings and illustrations, 64 acquisitions, registries, and labels, 48 catalogue cards, 91 radiographs, 239 image files (photographs and scans) were produced (Table
Digital items (image files, pdfs) prepared in the course of the project.
| Category of digital item | Content | Collection | Total | ||||
|---|---|---|---|---|---|---|---|
| EV | MY | ORTH | FS | VS | |||
| Original descriptions | Printed text | 2 | 3 | 2 | 14 | 1 | 22 |
| Drawings, illustrations | Graphic | 17 | 17 | ||||
| Acquisition books, registries, labels | Handwritten text | 9 | 5 | 3 | 38 | 9 | 64 |
| Catalogue cards | Text | 3 | 48 | 1 | 52 | ||
| Radiographs | Digitised x-ray films | 89 | 2 | 91 | |||
| Image files (photos and scans) | Specimens (different aspects), specimen parts | 18 | 25 | 18 | 174 | 6 | 241 |
| Genetic information | Deposited at GenBank | 1 | 1 | 10 | 1 | 13 | |
| TOTAL | 29 | 37 | 24 | 390 | 20 | = 500 | |
The results of the DNA extraction are shown in Table
| Collection | Original name | Valid name | Inv. No. | Lab ID | DNA concentration (ng/µl) | Result |
|---|---|---|---|---|---|---|
| EV | Lyperosomum corrigia | L. corrigia | 4429 | Lcorr | too low | PCR not successful |
| EV | Orchipedum tracheicola | Orchipedum tracheicola | 4472 | Otrache | too low | PCR not successful |
| EV | Wehrdikmansia rugosicauda | Cercopithifilaria rugosicauda | 6352 | Wrugo | too low | PCR not successful |
| MY | Brachydesmus superus | Brachydesmus superus | 3661 | Bsuper1 | 0,184 | C1+C2 COI fragments 214 bp long with primers 167 bp long without primers GB No. PP576055 |
| MY | Cylindroiulus ignoratus | Cylindroiulus parisiorum | 8170 | Cigno | 0,144 | PCR not successful |
| MY | Iulus scandinavius | Julus scandinavius | 2749 | Jscandi | 7,96 | PCR not successful |
| ORTH | Troglophilus cavicola | Troglophilus cavicola | / | / | Only one damaged syntype, not sampled | |
| ORTH | Tetrix tuerki | Tetrix tuerki | / | Ttuerki | 0,404 | C2 COI fragment 147 bp long with primers 101 bp long without primers GB No. PP579753 |
| FS | Abramis leuckartii | hybrid | 55331 | Aleu1 | 0,6 | PCR not successful |
| FS | Abramis schreibersii | Ballerus sapa | 79462 | Abram2 | 0,568 | C1+C2 COI fragments 266 bp long with primers 217 bp long without primers GB No. PP576053 |
| FS | Abramis schreibersii | Ballerus sapa | 16584 | Abram1 | 0,302 | PCR not successful |
| FS | Alburnus breviceps | Alburnus alburnus | 55539 | Abrevi1 | 0,188 | C2 reverse sequence turns out to be a contamination |
| FS | Aspius mento | Alburnus mento | 55630 | Amento1 | 3,34 | C1 COI fragment 162 bp long with primers 114 bp long without primers GB No. PP579756 |
| FS | Aspius mento | Alburnus mento | 55629 | Amento2 | 3,84 | PCR not successful |
| FS | Aspius mento | Alburnus mento | 50440 | Amento3 | 1,68 | C1 COI fragment 162 bp long with primers 114 bp long without primers GB No. PP579755 |
| FS | Aspius mento | Alburnus mento | 55650 | Amento4 | 1,67 | PCR not successful |
| FS | Aspius mento | Alburnus mento | 55652 | Amento5 | 2,56 | C1 COI fragment 162 bp long with primers 114 bp long without primers GB No. PP579754 |
| FS | Aspius mento | Alburnus mento | 16441 | Amento6 | 2,1 | PCR not successful |
| FS | Aspius mento | Alburnus mento | 16261 | Amento7 | 0,134 | PCR not successful |
| FS | B. argyroleuca | B. bjoerkna | 54918 | Bargy4 | 1,33 | C2 COI fragment 152 bp long with primers 112 bp long without primers GB No. PP579757 |
| FS | Cyprinus acuminatus | Cyprinus carpio | 52846 | Cacu1 | 16,2 | Shot-gun Reads after trimming 68 895 309 Complete mitochondrial genome Possibility of a draft genome assembly. GB No. (COI) PP576059 GB No. (complete mt) PP621518 |
| FS | Idus melanotus | Leuciscus idus | 53434 | Imel1 | 2,4 | C1+C2 COI fragments 243 bp long with primers 193 bp long without primers GB No. PP576058 |
| FS | Idus melanotus | Leuciscus idus | 58775 | Imel2 | 0,26 | PCR not successful |
| FS | Idus melanotus | Leuciscus idus | 53432 | Imini1 | 6,69 | Shot-gun: only contaminates C2 COI fragment 170 bp long with primers 149 bp long without primers GB No. PP579758 |
| FS | Leuciscus virgo | Rutilus virgo | 50626 | Lvir1 | 0,9 | C1+C2 COI fragments 250 bp long with primers 218 bp long without primers GB No. PP576056 |
| FS | Phoxinus marsilii | Phoxinus marsilii | 51225 | / | / | Three previously published partial sequences of the genes: MF408203 (partial cytb) MF407956 (partial COI) MN818242 (partial ITS1) |
| FS | Squalius delineatus | Leucaspius delineatus | 50794 | Sdeli1 | 0,929 | PCR not successful |
| FS | Squalius lepusculus | Leuciscus leuciscus | 49345_1 | Sleb1 | 1,1 | C1+C2 COI fragments 242 bp long with primers 192 bp long without primers GB No. PP576057 |
| VS | Anser brevirostris | Anser erythropus | 55170 | Aerythro | 30,4 | C1+C2 COI fragments 262 bp long with primers 220 bp long without primers GB No. PP576054 |
Two overlapping fragments of COI (designated C1 and C2) were successfully amplified and sequenced in the myriapod Bsuper1 (NMW (MY) 3661, Brachydesmus superus), fish samples Abram2 (NMW (FS) 16584, Abramis schreibersii), Imel1 (NMW (FS) 53434, Idus melanotus), Lvir1 (NMW (FS) 50626, Leuciscus virgo), Sleb1 (NMW (FS) 49345, Squalius lepusculus), and the bird species Aerythro1 (NMW (VS) 55170 Anser brevirostris). While in the insect sample Ttuerki (no inv. number given; Tetrix tuerki) and the fish samples Abrevi1 (NMW (FS) 55539, Alburnus breviceps), Amento1 (NMW (FS) 55630, Aspius mento), Bargy4 (NMW (FS) 54918, Blicca argyroleuca) and Imini1 (NMW (FS) 53432, Idus miniatus) either C1 or C2 was successfully amplified and sequenced. In the remaining samples, DNA extraction, amplification, and/or sequencing were not successful.
Trematoda : Plagiorchiida: Dicrocoeliidae
1. Lyperosomum corrigia Braun, 1901
Original publication of the name.
Syntypes.
Remarks. The year 1858 given in the Inventory Book (Fig.
Type locality. Vienna; from the intestine of Tetrao tetrix (Linnaeus, 1758) (= Lyrurus tetrix, the black grouse).
Distribution. Gastrointestinal parasite of Galliformes in the Alpine area (Italy, France, Austria) (
Etymology. The species name is a Latin noun meaning shoelace or tie, from corrigō (smooth out, make straight).
Taxonomic status. Valid as Corrigia corrigia (Braun, 1901).
Conservation status. Not assessed for the IUCN Red List.
Genetic information. Genetic analysis was not successful.
2. Orchipedum tracheicola Braun, 1901
Original publication of the name.
Syntypes.
Type locality. Vienna; in the trachea of Anas fusca Linnaeus, 1758 (the velvet scoter), collected in October 1857 (
Remarks. The host specimen was registered in the old collection (Wiener Sammlung) in 1857 under the number 377.
Distribution. Orchipedum tracheicola in reported from trachea of water birds in North America and Europe (
Etymology. The name tracheicola is a Latin compound noun, from trachea (windpipe) and cola (inhabitor, one who inhabits), referring to the finding of the syntypes in trachea of an avian host.
Taxonomic status. Valid as Orchipedum tracheicola Braun, 1901.
Conservation status. Not assessed by the IUCN.
Genetic information. Genetic analysis was not successful.
3. Wehrdikmansia rugosicauda Böhm & Supperer, 1953
Original publication of the name.
Syntypes.
Remarks. The species was described based on four syntypes in total: three female and one male (
Type locality. Vienna; from the subcutaneous connective tissue of the back in the lumbar region of Capreolus capreolus (Linnaeus, 1758) (roe deer, collected in March 1952 (
Distribution. The species is a subcutaneous filarial nematode of roe deer Capreolus capreolus (Linnaeus, 1758) in Europe (
Etymology. The species name is a feminine Latin adjective, from rugosa (with wrinkles, folds, or creases) and cauda (tail), referring to the area rugosa, a peculiar feature in males.
Taxonomic status. Valid as Cercopithifilaria rugosicauda (Böhm & Supperer, 1953).
Conservation status. Not assessed by the IUCN.
Genetic information. Genetic analysis was not successful.
1. Brachydesmus superus Latzel, 1884
Original publication of the name.
Syntypes.
Remarks.
Type locality. Vienna, Prater.
Etymology. Not mentioned in the original description. However, the prefix super (above/upper) might indicate the fact that the species lives in the upper soil layers, but this remains a tentative explanation.
Distribution. Nearly Pan-European species. Anthropochorous and has spread beyond its natural range.
Taxonomic status. Valid. To date, around 21 subspecies of Brachydesmus superus have been described, mostly by
Conservation status. Not assessed by the IUCN.
Genetic information. Two overlapping fragments of the mitochondrial COI region (LabID Bsuper1; 167 bp in total, GenBank Accession No. PP576055) were successfully amplified. Nucleotide blast search with a subsequent alignment of the sequences and simple neighbour-joining tree analysis showed the closest relative to be B. superus, GenBank Accession No. HQ966183, from Lombardy, Italy. In this case, sequencing of the type has irreversibly connected this COI fragment with the species name B. superus, which will be helpful in the subsequent taxonomic and barcoding projects.
2. Cylindroiulus ignoratus Attems, 1927
Original publication of the name.
Syntypes.
Type locality. Vienna, Lower Austria, Styria.
Distribution. Mainly Central Europe, Britain, Ireland, and southern Scandinavia. Also introduced into New Zealand and North America.
Taxonomic status. Not valid. A junior subjective synonym of Cylindroiulus parisiorum (Brölemann & Verhoeff, in
Conservation status. Not assessed by the IUCN.
Genetic information. Genetic analysis was not successful.
3. Iulus scandinavius Latzel, 1884
Original publication of the name.
Syntypes.
Remarks. As many of the types of Robert Latzel, the original type locality of this species was not provided with precision and mentioned by
Type locality. Lower Austria; Vienna, Prater, Upper Austria, Kirchdorf.
Etymology. Not mentioned in the original description but the name refers to the fact the author believed the species is rare in Central Europe and should most probably come from Scandinavia and Denmark (
Distribution. A very common species in Central Europe with a wide distribution range. Mostly encountered in woodlands although also recorded on heaths, wetlands, humid open grassland, and sand dunes (
Taxonomic status. Valid.
Conservation status. Not assessed by the IUCN.
Genetic information. Genetic analysis was not successful.
1. Locusta cavicola Kollar, 1833
Original publication of the name.
Syntype. One male (dry mounted; Fig.
Remarks. The original description is based on several male individuals, found by Carl von Schreibers (1775–1852), director of the United Natural History Cabinet, in the cave “Schelmenloch” south of Vienna around 1831 (
Type locality. Schelmenloch (cave), Baden, south of Vienna, Lower Austria.
Etymology. the species name is a noun, coming from the Latin word cavum, meaning cave dweller. The current combination Troglophilus cavicola by
Taxonomic status. Valid asTroglophilus cavicola (Kollar, 1833).
Distribution. The main distribution area of Troglophilus cavicola is in southeastern Europe. From central Greece, the range extends across the Balkan Peninsula to the Bergamo Alps, the south of Graubünden to Austria. The northern limit of distribution is south of Vienna (
Conservation. Troglophilus cavicola is in the LC category (Europe and Austria) (
Genetic information. As there is only one, already damaged, syntype left, no genetic analysis was performed.
2. Tetrix tuerki Krauss, 1876
Original publication of the name.
Holotype. One male (dry mounted; Fig.
Remarks. In Brunner von Wattenwyl’s directory I (Fig.
Type locality. Vienna, on flat, sandy banks of the Danube, washed by water, sparsely vegetated, in the Prater, Brigittenau, near Klosterneuburg and in several other places (
Etymology. The species name is a patronym, a noun in the genitive, named after Rudolf Türk.
Taxonomic status. Valid.
Distribution. Tetrix tuerki is a Pontomediterranean faunal element that is native to the Alps and mountain ranges of eastern and southern Europe, but also occurs east of the Black Sea region (
Conservation. Tetrix tuerki is in the VU category for Europe (
Genetic information. To refrain from damaging the types, a topotype specimen (Fig.
classification according to
1. Abramis leuckartii Heckel, 1836
Original publication of the name.
Remarks. This paper (
Syntypes. NMW 55331 (a specimen in alcohol), 94754 (a pair of pharyngeal bones with teeth). Recent measurements: TL ca 130 mm (the caudal fin damaged), SL 105 mm (Fig.
Remarks. The original description is based on more than one individual (the numbers of countable feature are given as ranges, e.g., the number of branched anal-fin rays is 15–17). The extant syntype (NMW 55331) has 15 (if two last rays are counted as one, as it was accepted at the time), similar to a syntype in the original drawing (Fig.
Type locality. “Schnellfliessenden Stellen der Donau bei Fischment unter Wien” (“Fast-flowing parts of the Danube near Fischment downstream of Vienna”) in the original description (
Etymology. The species name is a patronym, a noun in the genitive; named for Friedrich Sigismund Leuckart, a German naturalist (1794–1843).
Taxonomic status. Hybrid between Rutilus rutilus (Linnaeus, 1758) × Abramis brama (Linnaeus, 1758) (
Distribution. Only known by the syntypes.
Conservation status. None (a hybrid).
Genetic information. Genetic analysis was not successful.
2. Abramis schreibersii Heckel, 1836
Original publication of the name.
Syntypes. NMW 16584 (1), 79462–63 (1, 1); all are stuffed individuals. Recent measurements (TL, SL): NMW 16584 ca 255 mm, ca 215 mm (Fig.
Remarks. The original description is based on more than one individual (the numbers of countable feature are given as ranges, e.g., the number of branched anal-fin rays is 39–43); 38 branched anal-fin rays in the illustrated individual. The extant syntypes are all with Acquisition Number 1825.V.32 which indicates three specimens.
Type locality. “Schnellfliessenden Stellen der Donau unter Wien, auch in der March kommt er vor“ (“Fast-flowing parts of the Danube below Vienna, also in the March“) (Heckel, 1836: 228). Acquisition 1825.V.32 (as Balerus (sic) neu species): “ II. Semester 1825, vom Laboratorio zukauft”.
Etymology. The species name is a patronym, a noun in the genitive; named for Carl Franz Anton Ritter von Schreibers (1775–1852), an Austrian naturalist and botanist, the director of the Natural History Cabinet since 1806.
Taxonomic status. Treated as a synonym of Abramis sapa (Pallas, 1814) since as early as
Distribution. Ballerus sapa is native in large rivers draining to Black, Azov, Caspian, and Aral seas. Introduced elsewhere (Northern Dvina, Volkhov, Rhine, Vistula) (
Conservation. IUCN: Ballerus sapa is in the LC category (
Genetic information. DNA extraction was performed on scales from two stuffed specimens, NMW 16584 and 79462, but genetic analysis was successful only on the latter. Two overlapping fragments of the mitochondrial COI regions (LabID Abram2; 217 bp in total, GenBank Accession No. PP576053) were successfully amplified in the specimen NMW 79462. The sequence was identical to the Ballerus sapa sequences from Austria (
3. Alburnus breviceps Heckel & Kner, 1857
Original publication of the name.
Although dated 1858, the book (
Holotype. NMW 55539 (in alcohol). Recent measurements: TL 152 mm, SL 124 mm. Preservation condition: average.
Remarks. The original description is based on one individual of 5 Zoll (Viennese inches) of total length (= 131.7 mm) (Fig.
Type locality. Not provided in the original description (
Etymology. The species name is an adjective, short-headed, comes from the Latin word brevis, meaning short, and ceps, head.
Taxonomic status. Synonymised with Alburnus alburnus (Linnaeus, 1758) soon after the description (e.g.,
Distribution. Alburnus alburnus is native in most of Europe north of Caucasus, Pyrénées, and Alps, eastward to Ural and Emba. Locally introduced elsewhere (Spain, Italy, the Irtysh River) (
Conservation. IUCN: Alburnus alburnus is in the LC category (
Genetic information. Genetic analysis was not successful.
4. Aspius mento Heckel, 1836
Original publication of the name.
Remarks. The name of the species in the acquisition records (listed below) (e.g., Fig.
On the other hand, Heckel knew that Agassiz was going to describe the species as the two ichthyologists were well acquainted. At the time Agassiz stayed in Vienna in 1830, he was preparing a multi-volume monography titled ‘Histoire naturelle des poissons d’eau douce de l’Europe centrale, ou description anatomique et historique des poissons qui habitent les lacs et les fleuves de la chaine des Alpes et les rivières qu’ils reçoivent dans leur cours’ (‘Natural history of the freshwater fishes of Central Europe, or anatomical and historical description of the fishes which inhabit the lakes and rivers of the Alps and the rivers which they receive in their course’). This work, which remained unfinished, has a curious history. Agassiz undertook it in 1828, in Munich, having the plates of his future work drawn by Joseph Dinkel. On August 30, 1830, Agassiz published a prospectus in German and French announcing the book: “In the arrangement of the materials I followed the procedure that I am going to indicate: everything is arranged by natural families, each of which is the subject of a particular monograph. General considerations on the class of fishes should first serve as an introduction to my work, but what I have to say cannot be appreciated until after the publication of all the particular facts, I have had to return these generalities at the end of the work. Each monograph therefore begins with the indication of the general external characteristics, and the main organizational features of a detailed exposition of the characters of each genus, I have given the anatomy as complete and as concise as possible of the species…” (
Syntypes. NMW 16261 (1) and 16441 (1), both stuffed; 50440 (1), 55630 (1), 55650 (2) and 55652 (1), in alcohol; NMW 94795 (a pair of pharyngeal bones).
Recent measurements (SL): NMW 16261, 140 mm; NMW 16441, 134 mm, NMW 50440, 221 mm; NMW 55630, 190 mm; NMW 55650, 157 and 137.5 mm, NMW 55652, 219 mm. Preservation condition: poor to good.
Remarks. The original description (
Type locality. The original description reads (
Etymology. The species name is a noun in apposition; an Italian mento for chin, mentum, reflecting a peculiar feature of the fish, its protruding chin.
Taxonomic status. After recent revisions of the genus Alburnus, it is commonly considered that Alburnus mento is a valid species (e.g.,
Distribution. Alburnus mento is a lacustrine species in most subalpine lakes in Germany and Austria.
Conservation. IUCN: Alburnus mento is in the LC category (
Genetic information. Amplification and sequencing of only the first of the two overlapping fragments of the mitochondrial COI region (LabIDs Amento1, Amento3, Amento5; 114 bp in total, GenBank Accession Nos. PP579754–PP579756) was successful in two lacustrine (NMW 50440 and 55652) and one riverine specimen (NMW 55630). In this short fragment, all three sequences of all three specimens differ in one nucleotide base. Nucleotide blast search puts them in the same group as A. mento and other “shemayas” from Turkey (e.g., GenBank Accession Nos. MT407383, NC019574, MG182572, MT407410, MW649504). In the publication reporting on Austrian DNA barcode inventory of fish species (
5. Blicca argyroleuca Heckel, 1843
Original publication of the name.
Remarks.
In the original publication, Heckel only refers to the structure of the pharyngeal teeth of a single specimen (
It is not quite clear why Heckel did not refer in his publications to the
Holotype or a syntype. NMW 94767, left pharyngeal bone (uppermost tooth in the longer row broken) (Fig.
Remarks. A single (left) pharyngeal bone is now kept in the collection. As mentioned in Introduction, in many cases, individuals from which the pharyngeal bones were taken for a special study, are still kept in
Apparently due to the misinterpretation of the date and authorship, all specimens in NMW lots, historically (since Heckel’s time) labelled as Blicca argyroleuca, became considered as syntypes of the species: NMW 16901 (2; 1840, Fish market in Berlin), 54918 (6; 1836, Vienna), 54919 (4; 1836, Neusiedlersee), 54920 (1; 1842, Pommern). All 13 of them have the pharyngeal bones intact.
Among the mentioned above possible syntypes, NMW 54918 (6 specimens, SL 111–222 mm) (Fig.
Type locality. Not provided in the original description (
Etymology. The species name is a patronym, a noun in the genitive; named for Friedrich Sigismund Leuckart, a German naturalist (1794–1843).
Taxonomic status. Synonym of Blicca bjoerkna (Linnaeus, 1758).
Distribution. Blicca bjoerkna is native to North, Baltic, White, Black (south to Rioni drainage) and Caspian Sea basins, Atlantic basin southward to Adour drainage and Mediterranean basin in France (Hérault and Rhône drainages), in Aral, Marmara and Anatolian Black Sea basins west of Ankara. Locally introduced elsewhere (Spain, northeastern Italy, France) (
Conservation status. IUCN: Blicca bjoerkna is in the LC category (
Genetic information. Amplification and sequencing of only the second of the two overlapping fragments of the mitochondrial COI region (LabID Bargy4; 112 bp in total, GenBank Accession No. PP579757) was successful in the specimen NMW 54918. This short fragment is identical to sequences of Blicca bjoerkna collected in Austria (
6. Cyprinus acuminatus Heckel & Kner, 1857
Original publication of the name.
Remarks. The name is objectively invalid being a junior homonym of Cyprinus acuminatus Richardson, 1846.
The original description is based on more than one individual (the numbers of countable feature are given as ranges, e.g., the number of branched dorsal-fin rays is 18–20). Besides, Heckel refers to two of his earlier species (unavailable, nomina nuda): Cyprinus angulatus and Cyprinus thermalis “Heck. nov. spec. (Hungaria)” (
Syntypes. NMW 52846 (2), acquisition 1836.I.2, Vienna; 52854 (1) and 52855 (1), acquisition 1836.I.22, Neusiedlersee, coll. Lestrin; 52927 (1), 52928 (1), 52929 (1), 53403 (2), acquisition 1840.III.3, Plattensee (Balaton), received from “Laboratorium”; 52950 (9), acquisition 1840.III.4, Kesythely (Keszthely, Balaton), received from “Laboratorium”; 94708 (a pair of pharyngeal bones; before 1857, Heckel).
Recent measurements of the Viennese syntypes, NMW 52846 (TL, SL): 230 mm, 182.5 mm (Fig.
Type locality. Danube, Neusiedler Lake and Plattensee (Balaton Lake) in the original description (
Etymology. The species name is a Latin adjective, past participle of acuminare “to sharpen”, from acumen “a point”, and refers to the shape of the snout.
Taxonomic status. The name has been considered a synonym of Cyprinus carpio Linnaeus, 1758, or its variety, from as early as at least
Distribution. Wild European Cyprinus carpio is native to Black, Caspian and Aral Sea basins. Introduced throughout the world. Cultivated in large quantities for human food and stocked for sport fishing (
Conservation status. IUCN: wild native European Cyprinus carpio is in the category VU (under criteria A2ce) (
In the Red Data List of Lower Austria (
Genetic information. Shot-gun sequencing resulted in over 68 million pair-end reads. Based on a subset of 15 million reads, a complete mitochondrial genome was assembled (LabID Cacu1; GenBank Accession No. for COI PP576059; for complete mitochondrial genome PP621518). According to a nucleotide blast search, the sequence with the highest identity score is OL693871, C. carpio from Eugene, Portland, USA. Further analysis is beyond the scope of this paper, and will be presented elsewhere.
7. Idus melanotus Heckel, 1843
Original publication of the name.
Remarks. In the original publication, Heckel only refers to the structure of the pharyngeal teeth, and the description is unambiguously available as providing a clear diagnosis referring to a single species name. Though, in later times, the date and authorship of the species name was often thought to be
As
Syntypes. 1. NMW 94805, a pair of pharyngeal bones (Fig.
Recent measurements of NMW 58775:1 (TL, SL): 380 mm, 291 mm. Preservation condition: good.
Remarks. As explained in Introduction, in many cases, cypriniform specimens from which the pharyngeal bones were taken for a special study by Heckel, were still kept in the collection. We assumed that the pharyngeal bones NMW 94805 belong to the individual under the number NMW 58775 as they suit each other by size, and NMW 58775:1 is the only one extant individual collected at Vienna before 1843, which lacks pharyngeal bones, among the whole set of extant Heckel’s I. melanotus specimens.
Type locality. Not provided in the original description (
Etymology. The species name is a Latinized Greek adjective, melano, meaning black and melanotus, meaning the black-coloured one, alluding to the predominantly black dorsal colouration of the fish.
Taxonomic status. Synonym of Leuciscus idus (Linnaeus, 1758) since soon after the description (e.g.,
Distribution. Leuciscus idus is native to Baltic, Black, northern Caspian and North Sea basins, Atlantic basin southward to Seine and lower Loire drainages (France). Introduced to Great Britain and northern Italy (
Conservation status. IUCN: Leuciscus idus is in the LC category (
Genetic information. DNA extraction was performed on two specimens, NMW 53434 and 58775, but genetic analysis was successful only on the first. Two overlapping fragments of the mitochondrial COI region (LabID Imel1; 217 bp in total, GenBank Accession No. PP576058) were successfully amplified. The sequence is identical to the L. leuciscus or L. idus (which, based on COI sequences, exhibit no differences) sequences from Austria (
8. Idus miniatus Heckel & Kner, 1857
Original publication of the name.
Remarks. In an earlier publication,
Holotype. NMW 53432 and a pair of pharyngeal bones, NMW 94807 (Fig.
Remarks. The original description per se is based on a single specimen; and only one specimen was registered as Idus miniatus Heckel from “Hofgarten” – acquisition entry 1852.XV.1, Royal Gardens of Burg (k.k. Hofgarten), received from Court gardener (Hofgärtner) Antoine, is handwritten by Heckel. However, the text in
Type locality. The species name is applied to captive fish; they had been kept in the pond of the Imperial court garden of the castle in Vienna but originated from Tyrol (
Etymology. The species name is a Latin first/second-declension adjective meaning scarlet, cinnabar-red in reference to the reddish (“blasser rot”) colouration of the back of the fish.
Taxonomic status. Synonym of Leuciscus idus (Linnaeus, 1758).
Distribution. As Leuciscus idus (above).
Conservation status. As Leuciscus idus (above).
Genetic information. Amplification and sequencing of only the second of the two overlapping fragments of the mitochondrial COI region (LabID Imini1; 149 bp in total, GenBank Accession No. PP579758) was successful in the specimen NMW 53432. The sequence is identical to the L. leuciscus or L. idus (which based on COI sequences exhibit no differences) sequences from Austria (
9. Leuciscus virgo Heckel, 1852
Original publication of the name.
Remarks. This paper is published in the Proceedings of the Academy of Sciences in Vienna, Mathematics and Natural Sciences class (Sitzungsberichte der Akademie der Wissenschaften in Wien, Mathematisch-Naturwissenschaftliche Klasse), Vol. 9 (1) with pagination 49–123, and numbers of plates of figures VI–XIII, and, also, as a separate with different pagination, 127–201, and numbers of plates of figures, XI–XVIII. It is one of six papers by
The original description is based on a number of individuals, the length of the described specimens is 6–15 Zoll (Viennese inches) (= 158–395 mm) (
Syntypes. NMW 22373 (1) and NMW 50626 (1), whole individuals in alcohol, pharyngeal bones intact; NMW 94733 (4 pairs of pharyngeal bones from fish of a variety of size). It is not clear to which acquisition numbers these individuals refer to; there are at least three acquisition entries referring to this species: 1. 1825.IV.4 (one specimen), 2. 1825.IV.4 (one specimen), both purchased in the first semester of 1825 from “Laboratorium” (supposedly, Danube at Vienna); 3. 1836.I.12 (two specimens), Danube, no other data; all three acquisition records were made by Heckel, first as Leuciscus Jeses but then the species name corrected (in pencil) to virgo. In 1825.IV.4 entry, there is a later note by Heckel in pencil “[sent] to Munich”. One more syntype, apparently not preserved as a whole fish or lost, is the one in the figures (
Recent measurements of the extant syntypes collected at Vienna (TL, SL): NMW 22373 (Fig.
Type locality. Not clearly provided in the original description but apparently the Danube. The syntypes are from Vienna and from the Danube without specification.
Etymology. The species name is a Latin word for virgin or maiden, which serves both as adjective and substantive.
Taxonomic status. Commonly treated as a synonym of Rutilus pigus (Lacepède, 1803) in earlier literature (e.g.,
Distribution. Danube drainage upriver of Iron Gate; most abundant in Save drainage (
Conservation status. IUCN: Rutilus virgo is in the LC category (
Genetic information. Two overlapping fragments of the mitochondrial COI region (LabID Lvir1; 217 bp in total, GenBank Accession No. PP576056) were successfully amplified in the specimen NMW 50626. The sequence is identical to the Austrian R. virgo sequences (
10. Phoxinus marsilii Heckel, 1836
Original publication of the name.
Remarks. The original description does not contain any specification of the examined specimens but makes clear that Heckle had examined (or observed) many. Heckel also refers to Cyprinus aphya of
He also provides a comparison of Phoxinus from the upper Danube in Germany (that could represent P. csikii in present understanding) and the new species: “Our museum owes many specimens of this species to the kindness of Professor Agassiz, who found them in Bavaria, and sent to the Cabinet Collection under the name Phoxinus laevis. How closely this species approaches our local Phoxinus Marsilii in colour, from which it differs slightly by its larger scales and the lateral line that disappears in front of the tail, I do not dare to determine from specimens in alcohol; meanwhile, the black spot on the caudal fin is clearly visible, the back appears light brown with darker spots, the sides are mottled black along its length and the belly is silver; in terms of size they are at least 1/3 larger than the following [P. marsilii]”.
Lectotype. NMW 51225, male (Fig.
The sample NMW 51225 was apparently registered (included into the inventory book) in Pietschmann’s time (judging from the number of the record and the handwriting) as belonging to the acquisition record 1836.I.20 for “Phoxinus marsilii Donau”, but the locality was given as Vienna, possibly based on some information (e.g., labels that have been lost). However, there were only two (not six) individuals in the acquisition entry 1836.I.20 and the species name was given as already existing (known) that may indicate that the sample had been collected (received) after the species description. The six specimens which were considered syntypes, NMW 51225:1–6 (now 51225 and 98672) are in a very similar preservation condition (dried apparently long ago), so, all six specimens may belong to one and the same sample. We would assume that Heckel had seen all museum samples that were present in the collection before he described the species in 1836. These could be as follows.
Lectotype of Phoxinus marsilii, NMW 51225, lectotype, SL 65.5 mm, male, possibly, at Vienna A lateral view, B ventral view of head and breast to show a distinguishing feature of the species, continuous patches of breast scales (type 6 as defined in
Type locality. The original description does not specify neither examined individuals nor localities. However, it is clear from the context (
As shown above, the exact locality of the lectotype is not quite clear; it is still probable that it belongs to the acquisition 1836.I.20 and the locality is Vienna. Genetic analysis presented in Palanadačić et al. (2017a, 2020) shows that the same mitochondrial genetic lineage (lineage 9) has been distributed in Vienna in the last 200 years.
Etymology. The species name is a patronym, a noun in the genitive; named after Count Luigi Ferdinando Marsili (or Marsigli, Latin Marsilius; 1658–1730), an Italian scholar and natural scientist, an author of “Danubius Pannonico-Mysicus”, richly illustrated work in six volumes containing much valuable historic and scientific information on the river Danube (published in 1726).
Taxonomic status. Recently re-established as a valid species (
Distribution. Danube drainage in Austria and Germany; also, Odra drainage in Germany (J. Freyhof, personal communication).
Conservation status. Not evaluated by IUCN. In the Red Data List of Lower Austria (
Genetic information. Three previously published partial sequences of the genes cytochrome b (cytb, MF408203), COI (MF407956) and internal transcribed spacer 1 (ITS1, MN818242).
11. Squalius delineatus Heckel, 1843
Original publication of the name.
Remarks. The original description is based on more than one individual (the number of lateral-line scales is given as a range, and two localities are mentioned).
Syntypes. NMW 49783 (7) and 50794 (6) (Fig.
Type locality. In the original description as “in der Ebene des Marchfelds bei Wien, so wie auch in Mahren die einzelnen Feldlachen hautig bewonnt” (“in the plain of the Marchfeld near Vienna, as well as in Moravia”) (
Etymology. The species name is an adjective from Latin delineatus, past participle of delineare (to sketch out, from de- completely) + lineare (draw lines, from linea line), that refers to a peculiar feature of the species, a very shortened (reduced) lateral line.
Taxonomic status. A valid species since it was described, in a genus of its own, Leucaspius Heckel & Kner (1857: 145).
Distribution. Leucaspius delineatus is native to Europe from lower Rhine and northern Germany eastward to southern Baltic basin, Black Sea basin south to Rioni drainage, Aegean Sea basin (from Maritsa to Nestos), and in northern Caspian basin; in Asia, native to western Caspian basin (south to Kura drainage). Introduced elsewhere (France, Great Britain, Switzerland, western Siberia in the Ob drainage in Russia and Kazakhstan) (
Conservation status. IUCN: Leucaspius delineatus is in the LC category (
Genetic information. Genetic analysis was not successful.
12. Squalius lepusculus Heckel, 1852
Original publication of the name.
Syntypes. The original description is mostly based on a single individual eight Viennese inches (= 158 mm) long (
Type locality. Danube near Vienna and Moosbrun (defined by the possible syntypes as above). In the original description, the type locality is not specified per se; specimens seen by Heckel (including those deposited in the collection at the time) are from Upper Danube, Vienna, Vltava near České Budějovice, Olsa at Teschen (Cieszyn), upper reaches of the Elbe, and the Oder.
Etymology. The species name is a Latin masculine noun, diminutive of lepus + -culus, meaning a young hare, or leveret.
Taxonomic status. Synonymised with Leuciscus leuciscus (Linnaeus, 1758) (= Leuciscus vulgaris auct.) soon after the description (
Distribution. Leuciscus leuciscus is native to North, Baltic, White, Barents, Caspian (Volga and Ural), Black Sea (Danube to Dnieper) basins (
Conservation status. IUCN: Leuciscus leuciscus is in the LC category (
Genetic information. Two overlapping fragments of the mitochondrial COI region (LabID Sleb1; 192 bp in total, GenBank Accession No. PP576057) were successfully amplified in the specimen NMW 49345:1. The sequence is identical to the L. leuciscus or L. idus (which based on COI sequences exhibit no differences) sequences from Austria (
1. Anser brevirostris Brehm, 1831
Original publication of the name.
Syntypes. 1. AMNH 730708, 2. RMNH 87330, 3.
Syntypes in the bird collection Natural History Museum Vienna:
Remarks. Syntype status of AMNH 730708, RMNH 87330, 3.
Type locality. 1. presumably Austria (from Vienna Market), 2. “Europe”, 3. Seefeld [Seefeld-Kadolz, Lower Austria; 48°43'N, 16°10'E]; 4. Aspern [48°13'N, 16°29'E Lower Austria; today 22nd district of Vienna].
Etymology. The species name brevirostris is from Latin brevis (short), rostrum (beak).
Taxonomic status. Synonym of Anser erythropus (Linnaeus, 1758).
Distribution. Breeds in discontinuous narrow band across Arctic Eurasia from Norway to E Siberia. Winters from C and SE Europe east to Iran and in some regions of E Asia (
Conservation status. In the IUCN category VU (
Genetic information. Two overlapping fragments of the mitochondrial COI region (LabID Aerythro; 220 bp in total, GenBank Accession No. PP576054) were successfully amplified in the specimen
This catalogue presents and annotates historical type series of three parasitic worms, three myriapods, two insects, twelve fish, and one bird species with type locality in the state of Vienna. The catalogue includes historical information and the references to the literature in which they are mentioned, as well as photographs of specimens and their labels, scans of acquisition records, and radiographs where available. A total of 500 digital items have been produced, including the digitisation of 22 original descriptions, 17 drawings and illustrations, 64 acquisition books, registers, and labels, 52 catalogue cards, 91 radiographs, 241 image files, 12 short COI sequences, and one complete mitochondrial genome.
Genetic analysis was at least partially successful in 11 of the 21 type series, but only one extraction produced DNA of a quality that allowed shotgun sequencing, whereas in ten type series short fragments (100–230 bp) of COI were amplified and sequenced. The only existing L. cavicola syntype is already damaged and missing a leg, so genetic analysis was not attempted. Of the 27 specimens used for DNA extraction, genetic analysis provided at least some results in 13 specimens (48%), which is higher than previously reported for the
For the myriapod Brachydesmus superus, the genetic analysis provided the first genetic information of this species in Austria and a genetic reference for the species name to be used in further (barcoding) projects. For the insect Tetrix tuerki, the COI fragment obtained was identical to the COIs originating from specimens collected from the Austrian-German border. For the fish species Abramis schreibseri, Blicca argyroleuca, Cyprinus acuminatus, Idus melanotus, and Idus miniatus, the genetic analysis confirmed their taxonomic status as synonyms of Ballerus sapa, Blicca bjoerkna, Cyprinus carpio, Leuciscus idus, and L. idus, respectively. For Rutilus virgo, the genetic analysis confirmed the difference from R. pigus and the genetic identity with R. virgo recently collected in Austria (
Despite the partial success of the genetic analyses, this catalogue demonstrates the usefulness of ESA with the addition of genetic data. The catalogue contains digitised data from 21 type series, making them available to scientists around the world for further study.
We would like to thank Matthias Svojtka for discussing some of the historical aspects of this catalogue. NA is grateful to Oliver Macek and Nathalie Fial (
The authors have declared that no competing interests exist.
No ethical statement was reported.
This study was partially funded by grant H-868630/2022 awarded by Hochschuljubiläumsstiftung der Stadt Wien, Vienna, Austria.
AP – conceptualization, general methodology, genetic analysis, original draft, reviewing and editing, supervision, project administration, funding acquisition; MC – laboratory work and genetic analysis; GS – photographing, x-rays, pre- and post- production, methodology; PF – Parasitic worms, reviewing and editing; NA – Myriapods, reviewing and editing; SR - Orthopthera, reviewing and editing; EM - Fishes, reviewing and editing; HMB - Birds, reviewing and editing; NB – Fishes, conceptualization, methodology, original draft, reviewing and editing, supervision.
Anja Palandačić https://orcid.org/0000-0002-4555-5240
Min J. Chai https://orcid.org/0009-0003-6213-2973
Nesrine Akkari https://orcid.org/0000-0001-5019-4833
Pedro R. Frade https://orcid.org/0000-0002-4010-255X
Susanne Randolf https://orcid.org/0000-0002-2402-3077
Nina G. Bogutskaya https://orcid.org/0000-0002-9153-0095
All of the data that support the findings of this study are available in the main text.