Research Article |
Corresponding author: Jian-Jun Gao ( gao-leyun@263.net ) Academic editor: Rudolf Meier
© 2017 Jin-Hua Yang, Masanori J. Toda, Awit Suwito, Rosli Hashim, Jian-Jun Gao.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Yang J-H, Toda MJ, Suwito A, Hashim R, Gao J-J (2017) A new species group in the genus Dichaetophora, with descriptions of six new species from the Oriental region (Diptera, Drosophilidae). ZooKeys 665: 121-146. https://doi.org/10.3897/zookeys.665.11609
|
The genus Dichaetophora Duda comprises 61 described species classified into four species groups: agbo, tenuicauda, acutissima and sinensis. This genus is distributed exclusively in the Old World, and is rich in species in the tropical and subtropical areas of the Oriental, Australasian, and Afrotropical regions. In this paper, a new species group, the trilobita group, is established for six new species discovered from the Oriental region. The delimitation of these species is firstly performed in light of morphology and further with the aid of DNA sequences of the mitochondrial COI and COII (cytochrome c oxydase, subunits I and II, respectively) genes, considering also their respective geographical origins. Then, the new species (trilobita Yang & Gao, sp. n., heterochroma Yang & Gao, sp. n., flatosternata Yang & Gao, sp. n., borneoensis Yang & Gao, sp. n., javaensis Yang & Gao, sp. n., and sumatraensis Yang & Gao, sp. n.) are described, and a key, based on not only morphological but also molecular information, is provided.
DNA barcoding, geographical isolation, mitochondrial DNA, taxonomy
The genus Dichaetophora is widely distributed in the Old World, especially its tropical and subtropical regions. This genus was originally established by
A summary of the specimens employed in the present study is shown in Table
Summary of new species and specimens of Dichaetophora employed in the present study.
Code of morpho-species | Formal name | Voucher # a | Distribution / collection site | Collection date |
---|---|---|---|---|
sp.K1 | trilobita sp. n. | #03876 (♂) | Park Headquarters, Mt. Kinabalu, Sabah, Malaysia | 11.iii.2008 |
#03877–8 (♂, ♀) | Ulu Gombak, Selangor, Malaysia | 8.xii.2013 | ||
#03882 (♀) | Poring, Mt. Kinabalu, Sabah, Malaysia | 20.iii.2008 | ||
unnumbered (1♂, 1♀) | Kubah, Sarawak, Malaysia | 19.i.1999 | ||
sp.K2 | heterochroma sp. n. | #03879–81 (2♂, 1♀), (1♂) | Poring, Mt. Kinabalu, Sabah, Malaysia | 20.iii.2008 |
#03883 (♀) | Poring, Mt. Kinabalu, Sabah, Malaysia | 13.iii.2008 | ||
#03884–6 (1♂, 2♀) | Ulu Senagang, Crocker Range, Sabah, Malaysia | 18.x.1999 | ||
unnumbered (1♂) | Poring, Mt. Kinabalu, Sabah, Malaysia | 19.iii.2008 | ||
unnumbered (1♂) | Poring, Mt. Kinabalu, Sabah, Malaysia | 3.x.1999 | ||
unnumbered (3♀) | Mahua, Crocker Range, Sabah, Malaysia | 14.x.1999 | ||
sp.K2-like | flatosternata sp. n. | #04171–8 (6♂, 2♀) | Guanlei, Xishuangbanna Nature Reserve, Yunnan, China | 14–15.x.2012 |
sp.K3 | borneoensis sp. n. | #03893–4 (♀) | Park Headquarters, Mt. Kinabalu, Sabah, Malaysia | 11.iii.2008 |
#03895 (♂) | Park Headquarters, Mt. Kinabalu, Sabah, Malaysia | 16.viii.2011 | ||
#03896 (♂) | Park Headquarters, Mt. Kinabalu, Sabah, Malaysia | 17.viii.2011 | ||
unnumbered (8♂, 4♀) | Park Headquarters, Mt. Kinabalu, Sabah, Malaysia | 2.i.1999 | ||
unnumbered (1♂) | Poring, Mt. Kinabalu, Sabah, Malaysia | 28.xii.1998 | ||
unnumbered (1♂) | Mahua, Crocker Range, Sabah, Malaysia | 14.x.1999 | ||
javaensis sp. n. | #03887–89 (♀) | Cikaniki, Mt. Halimun, West Java, Indonesia | 6.xi.2009 | |
#03892 (♂) | Cikaniki, Mt. Halimun, West Java, Indonesia | 7.xi.2009 | ||
unnumbered (1♀) | Cikaniki, Mt. Halimun, West Java, Indonesia | 10.xi.2009 | ||
unnumbered (1♂) | Cibodas, West Java, Indonesia | 16.xi.2013 | ||
unnumbered (1♂) | Mt. Patuha, Sugihmukti, West Java, Indonesia | 13.x.2004 | ||
sumatraensis sp. n. | #03890–1 (♂, ♀) | Mt. Kerinci, Jambi, Sumatra, Indonesia | 7.x.2004 | |
unnumbered (1♀) | Mt. Kerinci, Jambi, Sumatra, Indonesia | 6.x.2004 |
The specimens were first identified as of Dichaetophora in light of morphology referring to
Target region | Primer name | Primer sequence (5’–3’) | Reference |
---|---|---|---|
COI | LCO1490 | GGTCAACAAATCATAAAGATATTGG |
|
HCO2198 | TAAACTTCAGGGTGACCAAAAAATCA | ditto | |
COII | COII-1 | ATGGCAGATTAGTGCAATGG |
|
COII-2 | GTTTAAGAGACCAGTACTTG | Ditto |
In species illustration, a DinoLite® Digital Eyepiece Camera was used to microphotograph some organs for representative specimens.
The specimens examined were first sorted into four morpho-species (Table
Specimens of the morpho-species sp.K3 clustered into three more or less diverged, allopatric lineages each endemic to Borneo (Sabah), West Java, or Sumatra (Jambi) in the COII tree (PP = 1.00 for each lineage). While the former two lineages were recovered in the COI tree (PPs = 0.99 and 1.00, respectively), the last one was not supported in this tree. Table
Gene | Data set | Model selected | BIC score | ln L | Invariant | Gamma | R |
---|---|---|---|---|---|---|---|
COI | whole | GTR+G | 4417.9362 | -1962.0299 | n/a | 0.2057 | 2.1514 |
CP 1+2 | K2+G | 2057.0568 | -823.9557 | n/a | 0.0500 | 18.7827 | |
CP 3 | T92+G | 2322.3495 | -967.9958 | n/a | 1.0658 | 3.3825 | |
COII | whole | T92+G | 4745.1717 | -2118.2231 | n/a | 0.1231 | 4.6468 |
CP 1+2 | T92+G | 2250.9406 | -881.6321 | n/a | 0.0500 | 4.4687 | |
CP 3 | T92+G | 2525.5613 | -1037.0171 | n/a | 0.9274 | 9.6084 |
Species (Morpho-species code) |
Intraspecific mean distance (±SE) a | Interspecific mean distance (COI / COII) b | ||||||
---|---|---|---|---|---|---|---|---|
COI | COII | 1 | 2 | 3 | 4 | 5 | 6 | |
1. trilobita sp. n. (sp.K1) | 0.0078 ± 0.0028 | 0.0098 ± 0.0033 | 0.0112 / 0.0117 | 0.0101 / 0.0098 | 0.0127 / 0.0128 | 0.0122 / 0.0115 | 0.0123 / 0.0114 | |
2. heterochroma sp. n. (sp. 2) | 0.0076 ± 0.0026 | 0.0044 ± 0.0018 | 0.1123 / 0.1054 | 0.0082 / 0.0076 | 0.0128 / 0.0103 | 0.0114 / 0.0104 | 0.0125 / 0.0114 | |
3. flatosternata sp. n. sp.K2-like) | 0.0041 ± 0.0017 | 0.0111 ± 0.0021 | 0.1105 / 0.1148 | 0.0573 / 0.0707 | 0.0128 / 0.0112 | 0.0127 / 0.0110 | 0.0123 / 0.0106 | |
4. borneoensis sp. n. (sp.K3, Borneo) | 0.0063 ± 0.0024 | 0.0007 ± 0.0007 | 0.1256 / 0.1273 | 0.1412 / 0.1159 | 0.1448 / 0.1355 | 0.0082 / 0.0075 | 0.0085 / 0.0076 | |
5. javaensis sp. n. (sp.K3, Java) | 0.0045 ± 0.0019 | 0.0044 ± 0.0020 | 0.1118 / 0.1170 | 0.1295 / 0.1136 | 0.1271 / 0.1280 | 0.0751 / 0.0607 | 0.0079 / 0.0072 | |
6. sumatraensis sp. n. (sp.K3, Sumatra) | 0.0185 ± 0.0065 | 0.0060 ± 0.0027 | 0.1007 / 0.1178 | 0.1184 / 0.1129 | 0.1175 / 0.1223 | 0.0713 / 0.0576 | 0.0349 / 0.0468 |
In the following descriptions of the new species group and new species, and also the key to species, some figures in
The six new species to be described here certainly belong to the genus Dichaetophora, according to its diagnosis revised by
Diagnosis. Cercus anteromedially with two or three prominent setae on anteromedial portion, strongly sclerotized along anterior to caudoventral margin; sclerotized plates of curci fused with each other caudoventrally and to epandrium anteroventrally (Figs
Common characters.Head (Fig.
Thorax (Fig.
Legs (Fig.
Abdomen (Fig.
Male terminalia (Figs
Female terminalia (Figs
Included species. trilobita Yang & Gao, sp. n., heterochroma Yang & Gao, sp. n., flatosternata Yang & Gao, sp. n., borneoensis Yang & Gao, sp. n., javaensis Yang & Gao, sp. n., and sumatraensis Yang & Gao, sp. n.
Selected diagnostic nucleotide sites for each of borneoensis sp. n., javaensis sp. n., and sumatraensis sp. n. in the COI and COII sequences. For nonsynonymous nucleotide substitutions, corresponding amino acid status are given in parentheses. Hyphens (-) indicate missing data, and dots (.) indicate identical symbols with the first sequence (i.e., that of the specimen #03876 of trilobita sp. n.).
Species | Voucher # | Diagnostic sites | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
COI | COII | |||||||||||||||||||
142 | 205 | 235 | 499 | 519 | 532 | 541 | 544 | 18 | 69 | 270 | 303 | 309 | 381 | 389 | 393 | 441 | 513 | 636 | ||
trilobita sp. n. | #03876 | T | T | T | T | C (Ala) | A | T | T | T | T | T | T | A | A | C (Thr) | T | T | G | A |
#03877 | . | . | . | . | . (.) | . | . | . | . | . | . | . | . | . | . (.) | . | . | . | . | |
#03878 | . | . | . | . | . (.) | . | . | . | . | . | . | . | . | . | . (.) | . | . | . | . | |
#03882 | . | . | . | . | . (.) | . | . | . | . | . | . | . | . | . | . (.) | . | . | . | . | |
heterochroma sp. n. | #03879 | . | . | . | . | . (.) | . | . | . | . | . | . | . | . | . | . (Pro) | . | . | . | . |
#03880 | . | . | . | . | . (.) | . | . | . | . | . | . | . | . | . | . (Pro) | . | . | . | . | |
#03881 | - | - | - | - | - | - | - | - | . | . | . | . | . | . | . (Pro) | . | . | . | . | |
#03883 | . | . | . | . | . (.) | . | . | . | . | . | . | . | . | . | . (Pro) | . | . | . | . | |
flatosternata sp. n. | #04171 | . | . | . | . | . (.) | . | . | . | . | . | . | . | . | . | . (Ser) | . | . | . | . |
#04172 | . | . | . | . | . (.) | . | . | . | . | . | . | . | . | . | . (Ser) | . | . | . | . | |
#04173 | . | . | . | . | . (.) | . | . | . | . | . | . | . | . | . | . (Ser) | . | . | . | . | |
#04174 | - | - | - | - | - | - | - | - | . | . | . | . | . | . | . (Ser) | . | . | . | . | |
#04175 | . | . | . | . | . (.) | . | . | . | . | . | . | . | . | . | . (Ser) | . | . | . | . | |
#04176 | . | . | . | . | . (.) | . | . | . | . | . | . | . | . | . | . (Ser) | . | . | . | . | |
#04177 | - | - | - | - | - | - | - | - | . | . | . | . | . | . | . (Ser) | . | . | . | . | |
#04178 | . | . | . | . | . (.) | . | . | . | . | . | . | . | . | . | . (Ser) | . | . | . | . | |
borneoensis sp. n. | #03893 | . | . | C | C | T (Val) | T | C | C | . | . | . | . | G | . | T (Ile) | . | C | A | G |
#03894 | . | . | C | C | T (Val) | T | C | C | . | . | . | . | G | . | T (Ile) | . | C | A | G | |
#03895 | . | . | C | C | T (Val) | T | C | C | . | . | . | . | G | . | T (Ile) | . | C | A | G | |
#03896 | . | . | C | C | T (Val) | T | C | C | . | . | . | . | G | . | T (Ile) | . | C | A | G | |
javaensis sp. n. | #03887 | C | . | . | . | . (.) | . | . | . | . | C | C | C | . | G | . (.) | C | . | . | . |
#03888 | C | . | . | . | . (.) | . | . | . | . | C | C | C | . | G | . (.) | C | . | . | . | |
#03889 | C | . | . | . | . (.) | . | . | . | . | C | C | C | . | G | . (.) | C | . | . | . | |
#03892 | C | . | . | - | - | - | - | - | . | C | C | C | . | G | . (.) | C | . | . | . | |
sumatraensis sp. n. | #03890 | . | C | . | - | - | - | - | - | C | . | . | . | . | . | . (.) | . | . | . | . |
#03891 | . | C | . | . | . (.) | . | . | . | C | . | . | . | . | . | . (.) | . | . | . | . |
In the following key, not only morphological characters but also the selected pure diagnostic nucleotide sites of COI and COII sequences (Table
1 | Postocellar setae absent; ocellar plate granulose; posteromost pseudotrachea of labellum thicker than the others; mid-leg first tarsomere with one subproximal and one apical, short, blackish brown spines, and hindleg first tarsomere with one apical, short spine; prensisetae on surstylus apically blunt (Figs |
2 |
– | Postocellar setae present (Fig. |
4 |
2 | Wing nearly entirely, lightly fuscous, without distinct cloud (Fig. |
Di. trilobita Yang & Gao, sp. n. |
– | Wing largely clouded, except for central pale patch around dm-cu vein and periphery (Fig. |
3 |
3 | Dorsolateral tentorial apodemes nearly parallel in basal half but strongly divergent in distal half (Fig. |
Di. heterochroma Yang & Gao, sp. n. |
– | Dorsolateral tentorial apodemes slightly divergent in basal half but strongly divergent in distal half (Fig. |
Di. flatosternata , Yang & Gao, sp. n. |
4 | Spermathecal capsule somewhat cylindrical, apically flat; introvert 7/10 as deep as capsule height (Fig. |
Di. borneoensis Yang & Gao, sp. n. |
– | Spermathecal capsule somewhat dome-shaped, apically roundish; introvert 2/5 as deep as capsule height (Figs |
5 |
5 | Hypandrium sparsely pubescent in small, medial patch on caudolateral plate (Fig. |
Di. javaensis Yang & Gao, sp. n. |
– | Hypandrium without pubescence on caudolateral plate (Fig. |
Di. sumatraensis Yang & Gao, sp. n. |
The characters described above for the genus, the species group, and the key are not referred to in the following descriptions.
Holotype ♂ (#03877): MALAYSIA: Ulu Gombak, Selangor, 8.xii.2013, MJ Toda (
Paratypes: same data as holotype (1♀: #03878,
Postocellar setae absent; wing without distinct cloud (Fig.
Left lateral habitus, head and thorax (dorsal view), wing (left, ventral view), and abdomen (dorsal view). A−D Dichaetophora tirlobita sp. n. (#03877) E−G D. heterochroma sp. n. (#03879) H−JD. flatosternata sp. n. (#04172) K−M D. borneoensis sp. n. (#03895) N−P D. javaensis sp. n. (#03892) Q−S D. sumatraensis sp. n. (#03890). Scale bars: 1.0 mm.
Head (anterior view), postocciput, palpus, and prementum (ventral and lateral view, respectively). A−E Dichaetophora tirlobita sp. n. (#03877) F−J D. heterochroma sp. n. (#03879) K−O D. flatosternata sp. n. (#04172) P−T D. borneoensis sp. n. (#03895) U−Y D. javaensis sp. n. (#03892) Z−D D. sumatraensis sp. n. (#03890). Scale bars: 0.1 mm except for A, F, K, P, U, Z (0.5 mm).
Dichaetophora trilobita sp. n. (A−H #03877 I−K paratype #03878). A Periphallic organs (posterior view), with red arrow indicating the median process on the caudoventral bridge of cerci B periphallic organs (posterolateral view), with red arrows indicating the prominent setae on the cercus and the anteroventral fusion of cercus (sclerotized, marginal plate) with the epandrium C surstyli (ventral view) D surstylus (inner side) E−G phallic organs (ventral, ventrolateral and lateral view, respectively) H paramedian setae (indicated with red arrows), and apical portion of paramere I, J oviscapt (lateral and ventral view, respectively) K spermathecae. Abbreviations: aed = aedeagus, aed a = aedeagal apodeme, cerc = cercus, epand = epandrium, hypd = hypandrium, pm = paramere, sur = surstylus, 10S = tenth sternite. Scale bars: 0.1 mm.
Head (Figs
Wings (Fig.
Legs (Fig.
Male terminalia (Fig.
Female terminalia (Fig.
Measurements (in mm): BL (straight distance from anterior edge of pedicel to tip of abdomen) = 2.03 in holotype (1♂ paratype: 2.00; range in 2♀ paratypes: 2.00−2.21), ThL (distance from anterior notal margin to apex of scutellum) = 0.84 (0.82; 0.86−0.88), WL (distance from humeral cross vein to wing apex) = 1.62 (1.69; 1.72−1.73), WW (maximum wing width) = 0.71 (0.72; 0.74−0.79).
Indices: FW/HW (frontal width/head width) = 0.53 (range in 1♂, 2♀, or less if noted, paratypes: 0.38−0.50), ch/o (maximum width of gena/maximum diameter of eye) = 0.18 (0.19−0.26), prorb (proclinate orbital seta/posterior reclinate orbital seta in length) = 0.72 (2♀: 0.71−0.80), rcorb (anterior reclinate orbital seta/posterior reclinate orbital seta in length) = 0.30 (2♀: 0.31−0.33), orbito (distance between proclinate and posterior reclinate orbital setae / distance between inner vertical and posterior reclinate orbital setae) = 0.60 (0.58−0.68), dcl (anterior dorsocentral seta/posterior dorsocentral seta in length) = 0.78 (2♀: 0.64−0.74), sctl (basal scutellar seta/apical scutellar seta in length) = 0.67 (1♀: 0.60), sterno (anterior katepisternal seta/posterior katepisternal seta in length) = 0.51 (0.57−0.60), dcp (distance between ipsilateral dorsocentral setae/distance between anterior dorsocentral setae) = 0.49 (0.53−0.60), sctlp (distance between ipsilateral scutellar setae/distance between apical scutellar setae) = 0.79 (0.68−0.77), C (2nd costal section between subcostal break and R2+3/3rd costal section between R2+3 and R4+5) = 1.57 (1.35−1.53), 4c (3rd costal section between R2+3 and R4+5/M1 between r-m and dm-cu) = 1.54 (1.46−1.66), 4v (M1 between dm-cu and wing margin/M1 between r-m and dm-cu) = 2.19 (2.11−2.33), 5x (CuA1 between dm-cu and wing margin/dm-cu between M1 and CuA1) = 2.19 (2.00−2.38), ac (3rd costal section between R2+3 and R4+5/distance between distal ends of R4+5 and M1) = 3.58 (3.66−3.76), M (CuA1 between dm-cu and wing margin/M1 between r-m and dm-cu) = 0.72 (0.66−0.70), C3F (length of heavy setation in 3rd costal section/length of 3rd costal section) = 0.70 (0.66−0.68).
Referring to the trilobed, caudoventral bridge of cercal sclerotized plates.
Malaysia (Peninsular Malaysia, Sarawak, Sabah).
Holotype ♂ (#03879): MALAYSIA: Poring, Mt. Kinabalu, Sabah, 20.iii.2008, MJ Toda (
Paratypes: same data as holotype (1♂, 1♀: #03880, #03881,
Dichaetophora heterochroma sp. n. (A−I #03879 J−L paratype #03881). A, B Periphallic organs (posterior and posterolateral view, respectively) C surstyli and cerci, with red arrow indicating the caudoventral bridge of cerci D, E tenth sternite (ventral and anterior view, respectively), with red arrows (E) indicating a pair of depressions F−H phallic organs (ventral, ventrolateral and lateral view, respectively), with red arrow (H) indicating the dorsally swollen, submedial portion of aedeagus I paramedian setae J, K oviscapt (lateral and ventral view, respectively) L spermathecae (lateral view). Scale bars: 0.1 mm.
Wing largely clouded, except for central pale patch around dm-cu vein and periphery (Fig.
Head (Figs
Wings (Fig.
Legs (Fig.
Male terminalia (Fig.
Female terminalia (Fig.
Measurements (in mm): BL = 2.18 in holotype (range in 2♂ paratypes: 1.99 –2.21; range in 4♀ paratypes: 2.31–2.77), ThL = 0.79 (0.81–0.85; 0.92 –0.97), WL = 1.64 (1.60–1.64; 1.80 –2.30), WW = 0.68 (0.69–0.70; 0.75 –0.97).
Indices: FW/HW = 0.59 (2♂, 4♀, or less if noted, paratypes: 0.50–0.54), ch/o = 0.20 (0.25–0.28), prorb = 0.74 (2♂, 1♀: 0.76–0.87), rcorb = 0.29 (2♂, 3♀: 0.31–0.36), orbito = 0.54 (0.48–0.76), dcl = 0.71 (1♂, 2♀: 0.60–0.73), sctl = n/a (1♂, 3♀: 0.88–0.94), sterno = 0.54 (0.50–0.61), dcp = 0.55 (0.55–0.65), sctlp = 0.62 (0.75–0.95), C = 1.69 (1.99–2.08), 4c = 1.54 (1.41–1.54), 4v = 2.50 (2.28 –2.51), 5x = 1.79 (1.25–1.56), ac = 2.86 (2.38–3.09), M = 0.70 (0.62–0.64), C3F = 0.78 (0.73–0.87).
Referring to the heterochromatic legs.
Malaysia (Sabah).
Holotype. ♂ (#04172), CHINA: Mengyuan Substation, Mengla Station, Xishuangbanna National Nature Reserve, Guanlei, Mengla, Xishuangbanna, Yunnan, 14–15.xi.2012, JJ Gao (
Paratypes: same data as holotype (5♂, 2♀: #04171, #04173–4178,
Dichaetophora flatosternata sp. n. (A−I #04172 J−L paratype #04177). A, B Periphallic organs (posterior and posterolateral view, respectively) C surstyli and cerci D, E tenth sternite (ventral and anterior view, respectively) F−H phallic organs (ventral, ventrolateral and lateral view, respectively) I paramedian setae J, K oviscapt (lateral and ventral view, respectively) L spermatheca (lateral view). Scale bars: 0.1 mm.
Wing largely clouded, except for central pale patch around dm-cu vein and periphery (Fig.
Head (Figs
Wings (Fig.
Legs (Fig.
Male terminalia (Fig.
Female terminalia (Fig.
Measurements (in mm): BL = 2.10 in holotype (range in 5♂ paratype: 2.08–2.32; range in 2♀ paratypes: 2.21 –2.31), ThL = 0.87 (0.83–0.88; 0.83 –0.93), WL = 1.78 (1.67–1.81; 1.71 –1.81), WW = 0.81 (1.79–1.82; 0.81–0.83).
Indices: FW/HW = 0.54 (5♂, 2♀, or less if noted, paratypes: 0.49–0.54), ch/o = 0.23 (0.27–0.29), prorb = 0.71 (0.79–0.87), rcorb = n/a (0.33–0.39), orbito = 0.54 (0.55–0.74), dcl = 0.64 (0.62–0.78), sctl = n/a (4♂, 2♀: 0.89–0.97), sterno = 0.65 (0.54–0.63), dcp = 0.55 (0.54–0.62), sctlp = 0.73 (0.74–0.80), C = 1.53 (1.63–1.71), 4c = 1.45 (1.22–1.36), 4v = 1.96 (1.42–1.60), 5x = 1.89 (1.79–1.94), ac = 3.04 (2.53–2.76), M = 0.64 (0.57–0.64), C3F = 0.69 (0.62–0.71).
Referring to the flat male tenth sternite.
China (Yunnan).
Holotype ♂ (#03895), MALAYSIA: Park Headquarters, Mt. Kinabalu, Sabah, 16.viii.2011, K Akutsu (
Paratypes: same data as holotype except for 17.viii.2011 (1♂: #03896,
Dichaetophora borneoensis sp. n. (A−G #03895 H−J paratype #03894). A, B Periphallic organs (posterior and posterolateral view, respectively) C surstyli and cerci, with red arrow indicating the median, elongated process on the caudoventral bridge of cerci D−F phallic organs (ventral, ventrolateral and lateral view, respectively) G distal portion of hypandrium (posteroventral view), showing the caudolateral plates not pubescent (red arrows) and the paramedian setae H, I oviscapt (lateral and ventral view, respectively) J spermatheca (lateral view). Scale bars: 0.1 mm.
Postocellar setae present; spermathecal capsule somewhat cylindrical, apically flat; introvert 7/10 as deep as capsule height (Fig.
Head (Figs
Wings (Fig.
Legs (Fig.
Male terminalia (Fig.
Female terminalia (Fig.
Measurements (in mm): BL = 2.42 in holotype (1♂ paratype: 2.10; range in 2♀ paratypes: 2.34–2.57), ThL = 1.01 (0.87; 0.93–0.96), WL = 2.19 (1.84; 1.82–2.14), WW = 0.97 (0.85; 0.92–0.94).
Indices: FW/HW = 0.50 (1♂, 2♀, or less if noted, paratypes: 0.48–0.51), ch/o = 0.19 (0.25–0.29), prorb = 0.66 (1♂, 1♀: 0.63–0.73), rcorb = 0.23 (1♂, 1♀: 0.24–0.30), orbito = 0.62 (0.53–0.60), dcl = 0.76 (1♀: 0.77), sctl = 0.86 (0.84–0.87), sterno = 0.59 (1♂, 1♀: 0.58–0.62), dcp = 0.49 (0.49–0.52), sctlp = 0.90 (0.84–0.89), C = 1.82 (1.82–2.01), 4c = 1.47 (1.31–1.51), 4v = 2.51 (2.22–2.70), 5x = 2.16 (2.11–2.32), ac = 2.81 (2.88–3.15), M = 0.79 (0.71–0.87), C3F = 0.59 (0.57–0.63).
Pertaining to the type locality.
Malaysia (Sabah).
Holotype. ♂ (#03892), INDONESIA: Cikaniki, Mt. Halimun, West Java, 7.x.2009, MJ Toda (
Paratypes: same as holotype except for 6.xi.2009 (1♀: #03887,
Dichaetophora javaensis sp. n. (A−G #03892 H−J paratype #03888). A, B Periphallic organs (posterior and posterolateral view, respectively) C surstyli and ventral portions of cerci D−F phallic organs (ventral, ventrolateral and lateral view, respectively) G distal portion of hypandrium (posteroventral view), showing a pair of small patches of sparse pubescence on the caudolateral plates (red arrows) and the paramedian setae H, I oviscapt (lateral and ventral view, respectively) J spermatheca (lateral view). Scale bars: 0.1 mm.
Postocellar setae present; spermathecal capsule somewhat dome-shaped, apically roundish; introvert 2/5 as deep as capsule height (Fig.
Head (Figs
Wings (Fig.
Legs (Fig.
Male terminalia (Fig.
Female terminalia (Fig.
Measurements (in mm): BL = 1.94 in holotype (range in 3♀ paratypes: 2.08–2.50), ThL = 0.86 (0.97–1.03), WL = 1.81 (1.99–2.07), WW = 0.82 (0.86–0.92).
Indices: FW/HW = 0.56 (3♀, or less if noted, paratypes: 0.49–0.52), ch/o = 0.21 (0.34–0.41), prorb = 0.76 (0.72–0.79), rcorb = 0.24 (0.29–0.31), orbito = 0.60 (0.54–0.69), dcl = 0.74 (1♀: 0.71), sctl = 0.81(1♀: 0.81), sterno = 0.60 (0.50–0.54), dcp = 0.52 (0.53–0.60), sctlp = 0.71 (0.52–0.71), C = 1.85 (1.78–1.98), 4c = 1.54 (1.35–1.40), 4v = 2.62 (2.26–2.28), 5x = 2.28 (1.73–1.91), ac = 3.03 (2.95–3.24), M = 0.76 (0.71–0.90), C3F = 0.58 (0.50–0.60).
Pertaining to the type locality.
Indonesia (West Java).
Holotype ♂ (#03890): INDONESIA: Mt. Kerinci., Jambi, Sumatra, 7.x.2004, MJ Toda (
Paratypes: same as holotype (1♀: #03891,
Postocellar setae present; spermathecal capsule somewhat dome-shaped, apically roundish; introvert 2/5 as deep as capsule height (Fig.
Dichaetophora sumatraensis sp. n. (A−H #03890 I−K paratype #03891). A, B Periphallic organs (posterior and posterolateral view, respectively) C surstyli and ventral portions of cerci D tenth sternite (posteroventral view) E−G phallic organs (ventral, ventrolateral and lateral view, respectively) H distal portion of hypandrium (posteroventral view), showing the caudolateral plates not pubescent (red arrows) and the paramedian setae I, J oviscapt (lateral and ventral view, respectively) K spermatheca (lateral view). Scale bars: 0.1 mm.
Head (Figs
Wing (Fig.
Legs (Fig.
Male terminalia (Fig.
Female terminalia (Fig.
Measurements (in mm): BL = 2.33 in holotype (1♀ paratype: 2.70), ThL = 1.04 (1.13), WL = 2.17 (2.46), WW = 1.10 (1.00).
Indices: FW/HW = 0.36 (1♀ paratype: 0.40), ch/o = 0.39 (0.33), prorb = n/a (n/a), rcorb = n/a(n/a), orbito = 0.75 (0.78), dcl = 0.72 (n/a), sctl = n/a (n/a), sterno = n/a (0.61), dcp = 0.62 (0.60), sctlp = 0.80 (0.75), C = 1.90 (2.00), 4c = 1.29 (1.34), 4v = 2.18 (2.23), 5x = 2.18 (1.84), ac = 2.37 (2.57), M = 0.79 (0.75), C3F = 0.58 (0.60).
Pertaining to the type locality.
Indonesia (Sumatra).
The last three species somewhat resemble trilobita sp. n. in having the following morphological characters: wing without distinct, dark cloud; surstylus with medial patch of pubescence on outer surface; sclerotized, caudoventral bridge of cerci with narrow, median process; and oviscapt valve dorsomedially narrowly extended. However, the three species are very hard to distinguish from each other because of their least morphological differentiation. To overcome this difficulty, we employed 19 nucleotide sites of COI and COII genes as molecular diagnostic characters to identify these cryptic species (Table
We thank Dr Maklarin B. Lakim and Dr Maryati Bte Mohamed for their help in field works in Sabah, Malaysia under research permissions (UPE:40/200/19 SJ. 732 and UPE: 40/200/19 SJ.1194 and 1195) of Economic Planning Unit of Malaysian Government. This work was supported by NSFC (Nos 31160429, 31572238), the fund of the Ministry of Science and Technology of China (No. 2011FY120200 and 2012FY110800).