A new species of Amolops (Amphibia, Anura, Ranidae) from Guizhou Province, China

Shi-Ze Li; Jing Liu; Xiao-Cong Ke; Gang Cheng; Bin Wang

doi:10.3897/zookeys.1189.115621

Abstract

The Torrent frogs of the genus Amolops are widely distributed in Nepal and northern India eastwards to southern China and southwards to Malaysia. The genus currently contains 84 species. Previous studies indicated underestimated species diversity in the genus. In the context, a new species occurring from the mountains in the northwestern Guizhou Province, China is found and described based on morphological comparisons and molecular phylogenetic analyses, Amolops dafangensis sp. nov. Phylogenetic analyses based on DNA sequences of the mitochondrial 16S rRNA and COI genes supported the new species as an independent lineage. The uncorrected genetic distances between the 16S rRNA and COI genes in the new species and its closest congener were 0.7% and 2.6%, respectively, which are higher than or at the same level as those among many pairs of congeners. Morphologically, the new species can be distinguished from its congeners by a combination of the following characters: body size moderate (SVL 43.2–46.8 mm in males); head length larger than head width slightly; tympanum distinct, oval; vocal sacs absent; vomerine teeth present; dorsolateral folds weak formed by series of glands; nuptial pads present on the base of finger I; heels overlapping when thighs are positioned at right angles to the body; tibiotarsal articulation reaching the level far beyond the tip of the snout when leg stretched forward.

Key words

Mitochondrial gene, taxonomy

Introduction

The Torrent frogs of the genus Amolops Cope, 1865 are widespread in Asia, from the southern and eastern Himalayas eastward to the southeastern mainland China and southwards to the Peninsular Malaysia (Wu et al. 2020; Zeng et al. 2020; Frost 2023). The frogs live in the fast-flowing water and occupy specialized features that help them cling to rocks and navigate the turbulent currents (Fei et al. 2009; Fei et al. 2012). The genus currently contains 84 species, of which 51 species have been recorded in China (Fei et al. 2012; Amphibia China 2023; Frost 2023). Recently, according to the phylogenetic framework of the genus, the 84 Amolops species were divided into ten species groups, namely the A. monticola group, A. chayuensis group, A. hainanensis group, A. ricketti group, A. spinapectoralis group, A. marmoratus group, A. larutensis group, A. daiyunensis group, A. viridimaculatus group, and the A. mantzorum group (Lyu et al. 2019b; Wu et al. 2020; Zeng et al. 2020, 2021; Jiang et al. 2021; Patel et al. 2021; Mahony et al. 2022; Saikia et al. 2022a, 2022b, 2023; Wang et al. 2022; Pham et al. 2023; Qian et al. 2023; Tang et al. 2023; Sheridan et al. 2023). Among them, the A. mantzorum group, to which Amolops dafangensis sp. nov. belongs, was proposed by Fei et al. (1999) and is mainly distributed along the eastern margin of the Qinghai-Tibet Plateau (Fei et al. 2009; Lu et al. 2014; Zeng et al. 2020) and currently comprises eleven species (Jiang et al. 2021; Qian et al. 2023; Tang et al. 2023): Amolops ailao Tang, Sun, Liu, Luo, Yu & Du, 2023, A. mantzorum (David, 1872), A. granulosus (Liu & Hu, 1961), A. loloensis (Liu, 1950), A. lifanensis (Liu, 1945), A. jinjiangensis Su, Yang & Li, 1986, A. tuberodepressus Liu & Yang, 2000, A. sangzhiensis Qian, Xiang, Jiang, Yang & Gui, 2023, A. shuichengicus Lyu & Wang, 2019, A. ottorum Pham, Sung, Pham, Le, Zieger & Nguyen, 2019, and A. minutus Orlov & Ho, 2007. In this species group, A. ottorum and A. minutus are only known from northwestern Vietnam, and the other species are known from southwestern China (Frost 2023). However, within the group, the phylogenetic relationships between species remain controversial (Lu et al. 2014; Lyu et al. 2019b; Zeng et al. 2020; Wu et al. 2020), and the species diversity of it is also expected to be underestimated (Jiang et al. 2021; Qian et al. 2023; Tang et al. 2023).

Guizhou Province is one of the richest areas for amphibians in China and three Amolops species (A. chaochin, A. chunganensis, and A. sinensis) were have been recorded (Amphibia China 2023). During fieldwork in Dafang County, Guizhou Province, some Amolops specimens were collected. By our comparisons, these specimens were different from A. chaochin, A. chunganensis, and A. sinensis by the dorsolateral folds being weak, formed by series of glands, and the presence of a circum-marginal groove on the disc of the first finger. Molecular phylogenetic analyses based on mitochondrial DNA and comprehensive morphological comparisons all indicated that the specimens from Dafang County were an undescribed species, herein described as a new species, Amolops dafangensis sp. nov.

Materials and methods

Sampling

Five specimens of Amolops dafangensis sp. nov. including three adult males and two juveniles, were collected from Dafang County, Guizhou Province, China (Fig. 1). All specimens were fixed in 10% buffered formalin for one day, and then transferred to 70% ethanol. Tissue samples were preserved separately in 95% prior to fixation. Specimens collected in this work were all deposited in Maotai Institute (MT), Renhuai City, Guizhou Province, China.

Figure 1.

Geographical location of the type locality of Amolops dafangensis sp. nov. in Dafang County, Guizhou Province, China.

Collection of molecular data

DNA was extracted from tissue using a standard phenol-chloroform extraction protocol (Sambrook et al. 1989). Two mitochondrial genes, partial 16S ribosomal RNA gene (16S) and cytochrome oxidase subunit I (COI), were amplified. The primers used for 16S were P7 (5’- CGCCTGTTTACCAAAAACAT -3’) and P8 (5’-CCGGTCTGAACTCAGATCACGT’) following Simon et al. (1994), and that for COI were Chmf4 (5’-TYTCWACWAAYCAYAAAGAYATCGG-3’) and Chmr4 (5’-ACYTCRGGRTGRCCRAARAATCA-3’) following Che et al. (2012). PCR amplification reactions were performed in a 30 µl reaction with the following cycling conditions: an initial denaturing step at 95 °C for 4 min; 35 cycles of denaturing at 95 °C for 40 s, annealing at 48 °C/46 °C (16S/COI) for 40 s and extending at 72 °C for 70 s, and a final extending step of 72 °C for 10 min. PCR products were purified with spin columns and then were sequenced with both forward and reverse primers same as PCR. Sequencing was conducted using an ABI Prism 3730 automated DNA sequencer in Chengdu TSING KE Biological Technology Co. Ltd. (Chengdu, China). All sequences were deposited in GenBank (for GenBank Accession numbers refer to Table 1). For phylogenetic analyses, we downloaded corresponding sequences for all related species from GenBank according to previous studies (Qian et al. 2023; Tang et al. 2023; for GenBank accession numbers see Table 1).

Table 1.

Download as

CSV

XLSX

Information for samples used in molecular phylogenetic analyses in this study.

ID	Species	Locality	Voucher number	GenBank accession number
ID	Species	Locality	Voucher number	16S	COI
1	Amolops dafangensis sp. nov.	Dafang, Guizhou, China	MT DF20230601002	OR936315	OR924345
2	Amolops dafangensis sp. nov.	Dafang, Guizhou, China	MT DF20230601001	OR936314	OR924344
3	Amolops dafangensis sp. nov.	Dafang, Guizhou, China	MT DF20230601003	OR936316	OR924346
4	Amolops dafangensis sp. nov.	Dafang, Guizhou, China	MT DF20230601004	OR936317	OR924347
5	Amolops dafangensis sp. nov.	Dafang, Guizhou, China	MT DF20230601005	OR936318	OR924348
6	A. mantzorum	Wolong, Sichuan, China	SCUM 045817HX	MN953706	MN961408
7	A. mantzorum	Fengtongzhai, Sichuan, China	SYS a005365	MK573808	MK568323
8	A. mantzorum	Dayi, Sichuan, China	SCUM 045825HX	MN953707	MN961409
9	A. mantzorum	Mt. Wawu, Sichuan, China	SYS a005337	MK604853	MK605611
10	A. mantzorum	Kangding, Sichuan, China	KIZ 041127	MN953764	MN961465
11	A. mantzorum	Kangding, Sichuan, China	KIZ 041129	MN953765	MN961466
12	A. mantzorum	Fengtongzhai, Sichuan, China	SYS a005366	MK604862	MK605620
13	A. mantzorum	Kangding, Sichuan, China	SYS a005356	MK604858	MK605616
14	A. mantzorum	Kangding, Sichuan, China	SYS a005357	MK604859	MK605617
15	A. mantzorum	Mt. Wawu, Sichuan, China	SYS a005336	MK573804	MK568319
16	A. ailao	Mt. Ailao, Xinping, Yunnan, China	GXNU YU000001	MN650752	MN650738
17	A. ailao	Mt. Ailao, Xinping, Yunnan, China	GXNU YU000002	MN650753	MN650739
18	A. tuberodepressus	Jingdong, Yunnan, China	SCUM 050433CHX	MN953729	MN961432
19	A. tuberodepressus	Mt. Wuliang, Yunnan, China	SYS a003931	MK573799	MG991933
20	A. tuberodepressus	Jingdong, Yunnan, China	SCUM 050430CHX	MN953730	MN961433
21	A. tuberodepressus	Mt. Wuliang, Yunnan, China	SYS a003932	MK573800	MG991934
22	A. tuberodepressus	Mt. Ailao, Yunnan, China	SYS a003900	MK573797	MK568314
23	A. tuberodepressus	Mt. Ailao, Yunnan, China	SYS a003901	MK573798	MK568315
24	A. granulosus	Mt. Guangwu, Sichuan, China	SYS a005399	MK573811	MK568326
25	A. granulosus	Mt. Guangwu, Sichuan, China	SYS a005400	MK573812	MK568327
26	A. granulosus	Mt. Wawu, Sichuan, China	SYS a005315	MK604850	MK605608
27	A. granulosus	Mt. Wawu, Sichuan, China	SYS a005316	MK604851	MK605609
28	A. granulosus	China: Dayi, Sichuan	SCUM 045823HX	MN953680	JN700804
29	A. granulosus	China: Anxian, Sichuan	SCUM 060911HX	MN953681	MN961381
30	A. shuichengicus	Shuicheng, Guizhou, China	SYS a004956	MK604845	MK605603
31	A. shuichengicus	Shuicheng, Guizhou, China	SYS a004957	MK604846	MK605604
32	A. jinjiangensis	Mt. Gaoligong, Yunnan, China	SYS a004571	MK573801	MK568316
33	A. jinjiangensis	Deqing, Yunnan, China	SCUM 050434CHX	MN953700	MN961402
34	A. jinjiangensis	Deqing, Yunnan, China	SCUM 050435CHX	EF453741	MN961403
35	A. jinjiangensis	Chuxiong, Yunnan, China	KIZ 047905	MN953701	MN961404
36	A. loloensis	Zhaojue, Sichuan, China	SYS a005346	MK604854	MK605612
37	A. loloensis	Zhaojue, Sichuan, China	SYS a005347	MK604855	MK605613
38	A. loloensis	Xichang, Sichuan, China	SCUM 045806HX	MN953704	MN961407
39	A. loloensis	Xichang, Sichuan, China	SCUM 045807HX	EF453743	MN961456
40	A. sangzhiensis	Mt. Doupeng, Sangzhi, Hunan, China	CSUFT 901	OQ079538	OQ078903
41	A. sangzhiensis	Mt. Doupeng, Sangzhi, Hunan, China	CSUFT 907	OQ079540	OQ078905
42	A. sangzhiensis	Mt. Doupeng, Sangzhi, Hunan, China	CSUFT 912	OQ079541	OQ078906
43	A. sangzhiensis	Mt. Doupeng, Sangzhi, Hunan, China	CSUFT 916	OQ079542	OQ078907
44	A. sangzhiensis	Mt. Doupeng, Sangzhi, Hunan, China	CSUFT 927	OQ079543	OQ078908
45	A. sangzhiensis	Mt. Doupeng, Sangzhi, Hunan, China	CSUFT 930	OQ079544	OQ078909
46	A. sangzhiensis	Mt. Doupeng, Sangzhi, Hunan, China	CSUFT 933	OQ079545	OQ078910
47	A. lifanensis	Lixian, Sichuan, China	SYS a005374	MK573809	MK568324
48	A. lifanensis	Lixian, Sichuan, China	SYS a005375	MK573810	MK568325
49	A. lifanensis	Maoxian, Sichuan, China	SCUM 045801HX	MN953702	MN961405
50	A. lifanensis	Maoxian, Sichuan, China	SCUM 045803HX	MN953703	MN961406
51	A. chunganensis	Mt. Jinggang, Jiangxi, China	SYS a004212	MK263263	MG991914
52	A. ricketti	Mt. Wuyi, Fujian, China	SYS a004141	MK263259	MG991927

Phylogenetic analyses and genetic distance

Sequences were assembled and aligned using the Clustalw module in BioEdit 7.0.9.0 (Hall 1999) with default settings. The datasets were checked by eye and revised manually if necessary. Based on the 16S + COI concatenated dataset, phylogenetic analyses were conducted using maximum likelihood (ML) and Bayesian Inference (BI) methods, implemented in PhyML 3.0 (Guindon et al. 2010) and MrBayes 3.12 (Ronquist and Huelsenbeck 2003), respectively. The best-fit model was obtained by the Bayesian inference criteria (BIC) computed with PartitionFinder 2 (Lanfear et al. 2012). In this analysis, 16S gene and each codon position of COI gene were defined, and Bayesian Inference Criteria was used. As a result, the analysis suggested that the best partition scheme is16S gene/each codon position of COI gene, and selected GTR + G + I model as the best model for each partition. For ML analysis, the bootstrap consensus tree inferred from 1000 replicates was used to estimate nodal supports of inferred relationships on phylogenetic trees. For Bayesian analyses, four Markov chains were run for 50 million generations with sampling every 1000 generations. The first 25% of the trees were discarded, representing the burn-in phase of the analyses, and the remaining trees were used to calculate the Bayesian posterior probabilities. Genetic distance between species of A. mantzorum group were estimated on 16S and COI genes, respectively, based on uncorrected p-distance model using MEGA 6.06 (Tamura et al. 2013).

Morphological comparisons

Morphological measurements were made with dial calipers to nearest 0.1 mm by S-ZL following Fei et al. (2009). In total, twenty morphological characteristics were measured for the adult specimens:

ED eye diameter (distance from the anterior corner to the posterior corner of the eye);

FL foot length (distance from tarsus to the tip of fourth toe);

HDL head length (distance from the tip of the snout to the articulation of jaw);

HDW maximum head width (greatest width between the left and right articulations of jaw);

HLL hindlimb length (maximum length from the vent to the distal tip of the Toe IV);

IND internasal distance (minimum distance between the inner margins of the external nares);

IOD interorbital distance (minimum distance between the inner edges of the upper eyelids);

LAL length of lower arm and hand (distance from the elbow to the distal end of the Finger IV);

ML manus length (distance from tip of third digit to proximal edge of inner palmar tubercle);

NED nasal to eye distance (distance between the nasal and the anterior corner of the eye);

NSD nasal to snout distance (distance between the nasal the posterior edge of the vent);

LW lower arm width (maximum width of the lower arm);

SVL snout-vent length (distance from the tip of the snout to the posterior edge of the vent);

SL snout length (distance from the tip of the snout to the anterior corner of the eye);

TFL length of foot and tarsus (distance from the tibiotarsal articulation to the distal end of the Toe IV);

THL thigh length (distance from vent to knee);

TL tibia length (distance from knee to tarsus);

TW maximal tibia width;

TYD maximal tympanum diameter;

UEW upper eyelid width (greatest width of the upper eyelid margins measured perpendicular to the anterior-posterior axis).

We also compared the morphological characters of the new taxon with other species of Amolops. Comparative data were obtained from the literature for all species of Amolops (Table 2).

Table 2.

Download as

CSV

XLSX

References for morphological characters for congeners of the genus Amolops.

Species	Literature
A. adicola Patel, Garg, Das, Stuart & Biju, 2021	Patel et al. 2021
A. afghanus (Günther, 1858)	Günther 1858
A. ailao Tang, Sun, Liu, Luo, Yu & Du, 2023	Tang et al. 2023
A. akhaorum Stuart, Bain, Phimmachak & Spence, 2010	Stuart et al. 2010
A. albispinus Sung, Wang & Wang, 2016	Sung et al. 2016
A. aniqiaoensis Dong, Rao & Lü, 2005	Zhao et al. 2005
A. archotaphus (Inger & Chan-ard, 1997)	Inger and Chan-ard 1997
A. attiguus Sheridan, Phimmachak, Sivongxay & Stuart, 2023	Sheridan et al. 2023
A. assamensis Sengupta, Hussain, Choudhury, Gogoi, Ahmed & Choudhury, 2008	Sengupta et al. 2008
A. australis Chan, Abraham, Grismer & Grismer, 2018	Chan et al. 2018
A. beibengensis Jiang, Li, Zou, Yan & Che, 2020	Che et al. 2020
A. bellulus Liu, Yang, Ferraris & Matsui, 2000	Liu et al. 2000
A. binchachaensis Rao, Hui, Ma & Zhu, 2022“2020”	Zhu and Rao 2022
A. chakrataensis Ray, 1992	Ray 1992
A. chanakya Saikia, Laskar, Dinesh, Shabnam & Sinha, 2022	Saikia et al. 2022a
A. chaochin Jiang, Ren, Lyu & Li, 2021	Jiang et al. 2021
A. chayuensis Sun, Luo, Sun & Zhang, 2013	Sun et al. 2013
A. chunganensis (Pope, 1929)	Pope 1929
A. compotrix (Bain, Stuart & Orlov, 2006)	Bain et al. 2006
A. cremnobatus Inger and Kottelat, 1998	Inger and Kottelat 1998
A. cucae (Bain, Stuart & Orlov, 2006)	Bain et al. 2006
A. daiyunensis (Liu & Hu, 1975)	Liu and Hu 1975
A. daorum (Bain, Lathrop, Murphy, Orlov & Ho, 2003)	Bain et al. 2003
A. deng Jiang, Wang & Che, 2020	Che et al. 2020
A. formosus (Günther, 1876)	Günther 1876 “1875”
A. gerbillus (Annandale, 1912)	Annandale 1912
A. gerutu Chan, Abraham, Grismer & Grismer, 2018	Chan et al. 2018
A. granulosus (Liu & Hu, 1961)	Liu and Hu 1961
A. hainanensis (Boulenger, 1900)	Boulenger 1900 “1899”
A. himalayanus (Boulenger, 1888)	Boulenger 1888
A. hongkongensis (Pope & Romer, 1951)	Pope and Romer 1951
A. indoburmanensis Dever, Fuiten, Konu & Wilkinson, 2012	Dever et al. 2012
A. iriodes (Bain & Nguyen, 2004)	Bain and Nguyen 2004
A. jaunsari Ray, 1992	Ray 1992
A. jinjiangensis Su, Yang & Li, 1986	Su et al. 1986
A. kaulbacki (Smith, 1940)	Smith 1940
A. kohimaensis Biju, Mahony & Kamei, 2010	Biju et al. 2010
A. kottelati Sheridan, Phimmachak, Sivongxay & Stuart, 2023	Sheridan et al. 2023
A. larutensis (Boulenger, 1899)	Boulenger 1899a
A. latopalmatus (Boulenger, 1882)	Boulenger 1882
A. lifanensis (Liu, 1945)	Liu 1945
A. loloensis (Liu, 1950)	Liu 1950
A. longimanus (Andersson, 1939)	Andersson 1939 “1938”
A. mahabharatensis Khatiwada, Shu, Wang, Zhao, Xie & Jiang, 2020	Khatiwada et al. 2020
A. mantzorum (David, 1872)	David 1872 “1871”
A. marmoratus (Blyth, 1855)	Blyth 1855
A. medogensis Li & Rao, 2005	Zhao et al. 2005
A. mengdingensis Yu, Wu & Yang, 2019	Yu et al. 2019
A. mengyangensis Wu & Tian, 1995	Wu and Tian 1995
A. minutus Orlov & Ho, 2007	Orlov and Ho 2007
A. monticola (Anderson, 1871)	Anderson 1871
A. nepalicus Yang, 1991	Yang 1991
A. nidorbellus Biju, Mahony & Kamei, 2010	Biju et al. 2010
A. nyingchiensis Jiang, Wang, Xie, Jiang & Che, 2016	Jiang et al. 2016
A. ottorum Pham, Sung, Pham, Le, Ziegler & Nguyen, 2019	Pham et al. 2019
A. pallasitatus Qi, Zhou, Lyu, Lu & Li, 2019	Qi et al. 2019
A. panhai Matsui & Nabhitabhata, 2006	Matsui and Nabhitabhata 2006
A. putaoensis Gan, Qin, Lwin, Li, Quan, Liu & Yu, 2020	Gan et al. 2020b
A. ricketti (Boulenger, 1899)	Boulenger 1899b
A. sangzhiensis Qian, Xiang, Jiang, Yang & Gui, 2023	Qian et al. 2023
A. senchalensis Chanda, 1987	Chanda 1987
A. sengae Sheridan, Phimmachak, Sivongxay & Stuart, 2023	Sheridan et al. 2023
A. shihaitaoi Wang, Li, Du, Hou & Yu, 2022	Wang et al. 2022
A. shuichengicus Lyu & Wang, 2019	Lyu et al. 2019a
A. siju Saikia, Sinha, Shabnam & Dinesh, 2023	Saikia et al. 2023
A. sinensis Lyu, Wang & Wang, 2019	Lyu et al. 2019b
A. spinapectoralis Inger, Orlov & Darevsky, 1999	Inger et al. 1999
A. tanfuilianae Sheridan, Phimmachak, Sivongxay & Stuart, 2023	Sheridan et al. 2023
A. tawang Saikia, Laskar, Dinesh, Shabnam & Sinha, 2022	Saikia et al. 2022a
A. teochew Zeng, Wang, Lyu & Wang, 2021	Zeng et al. 2021
A. terraorchis Saikia, Sinha, Laskar, Shabnam & Dinesh, 2022	Saikia et al. 2022b
A. tonkinensis (Ahl, 1927 “1926”)	Ahl 1927 “1926”
A. torrentis (Smith, 1923)	Smith 1923
A. truongi Pham, Pham, Ngo, Sung, Ziegler & Le, 2023	Pham et al. 2023
A. tuanjieensis Gan, Yu & Wu, 2020	Gan et al. 2020a
A. tuberodepressus Liu & Yang, 2000	Liu and Yang 2000
A. viridimaculatus (Jiang, 1983)	Jiang 1983
A. vitreus (Bain, Stuart & Orlov, 2006)	Bain et al. 2006
A. wangyali Mahony, Nidup, Streicher, Teeling & Kamei, 2022	Mahony et al. 2022
A. wangyufani Jiang, 2020	Che et al. 2020
A. wenshanensis Yuan, Jin, Li, Stuart & Wu, 2018	Yuan et al. 2018
A. wuyiensis (Liu & Hu, 1975)	Liu and Hu 1975
A. yatseni Lyu, Wang & Wang, 2019	Lyu et al. 2019
A. yunkaiensis Lyu, Wang, Liu, Zeng & Wang, 2018	Lyu et al. 2018

Results

Phylogenetic analyses

The ML and BI phylogenetic trees were constructed based on concatenated DNA sequences of the mitochondrial 16S (425 bp) and COI (606 bp) genes. ML and BI analyses resulted in essentially identical topologies though some basal relationships between clades were not resolved (Fig. 2). The new taxon was indicated as an independent clade. Furthermore, the smallest uncorrected p-distance between Amolops dafangensis sp. nov. and its most closely-related congeners is 0.7% (vs A. sangzhiensis) on 16S gene (Suppl. material 1), and 2.6% (vs A. loloensis) on COI gene (Suppl. material 2), which was higher or at the same level with those among many pairs of congeners, for example, 0.3% between A. sangzhiensis and A. jinjiangensis on the 16S gene, and 3.2% between A. jinjiangensis and A. loloensis on the COI gene.

Figure 2.

Maximum likelihood (ML) tree of Amolops mantzorum group based on the 16S and CO1 genes. ML bootstrap supports (BS) /Bayesian posterior probability (BPP) were denoted beside each node, and “-” denotes BS < 50% or BPP < 0.60. Samples 1–52 refer to Table 1.

Morphological comparisons

Morphological measurements are given in Table 3. The new taxon could be identified from its congeners by a series of differences in morphological characters.

Table 3.

Download as

CSV

XLSX

Measurements of the adult specimens of Amolops dafangensis sp. nov. Units are given in mm. See abbreviations for the morphological characters in Materials and methods section.

Voucher	MT DF20230601001	MT DF20230601002	MT DF20230601003	Range	Mean ± SD
Sex	male	male	male	Range	Mean ± SD
SVL	43.2	44.7	46.8	43.2–46.8	44.9 ± 1.8
HDL	14.5	15.0	15.6	14.5–15.6	14.9 ± 0.6
HDW	14.3	14.7	15.1	14.3–15.1	14.8 ± 0.4
SL	6.1	6.1	6.6	6.1–6.6	6.3 ± 0.3
ED	3.9	4.5	4.3	3.9–4.5	4.3 ± 0.3
UEW	3.5	3.9	3.8	3.5–3.9	3.7 ± 0.2
IOD	4.4	4.1	4.7	4.1–4.7	4.4 ± 0.3
IND	5.2	5.4	5.7	5.2–5.7	5.4 ± 0.3
NED	2.7	2.4	3.0	2.4–3.0	2.7 ± 0.3
NSD	3.2	2.4	3.0	2.4–3.2	2.9 ± 0.4
TYD	1.9	2.4	1.7	1.7–2.4	2.0 ± 0.4
LAL	22.5	24.0	23.5	22.5–24.0	23.3 ± 0.8
LW	3.2	3.8	3.8	3.2–3.8	3.6 ± 0.3
ML	13.8	14.4	14.6	13.8–14.6	14.3 ± 0.4
HLL	80.4	83.4	87.3	80.4–87.3	83.7 ± 3.4
THL	22.3	24.0	24.9	22.3–24.9	23.7 ± 1.3
TL	25.8	26.2	27.9	25.8–27.9	26.6 ± 1.1
TW	5.0	5.4	5.8	5.0–5.8	5.4 ± 0.4
TFL	36.3	38.1	39.5	36.3–39.5	38.0 ± 1.6
FL	22.3	22.8	24.6	22.3–24.6	23.2 ± 1.2

Taxonomic account

Amolops dafangensis sp. nov.

https://zoobank.org/22D19386-8779-4FBC-8BF9-71FB7070403B

Figs 3, 4, 5

Material examined

Holotype. MT DF20230601002, adult male, collected by Shize Li on 1 June 2023 in Dafang County (27.40078312°N, 105.92804027°E; elevation 1300 m a.s.l.), Guizhou Province, China. Paratypes. One male MT DF20230601003 collected by Jing Liu on 1 June 2023, one male MT DF20230601001 and two juveniles MT DF20230601004 and MT DF20230601005 were collected by Xiaocong Ke on 1 June 2023 from the same place as holotype.

Diagnosis

Amolops dafangensis sp. nov. resembles members of the A. mantzorum group in the absence of true dorsolateral folds and the presence of a circum-marginal groove on the disc of the first finger. The tarsal fold and tarsal glands are absent, and a nuptial pad is present on the first finger in males (Jiang et al. 2021).

Amolops dafangensis sp. nov. can be distinguished from other congeners by the following characters: (1) body size moderate (SVL 43.2 – 46.8 mm in males); (2) head length larger than head width slightly; (3) tympanum distinct, oval; (4) vocal sacs absent; (5) vomerine teeth present; (6) dorsolateral folds weak formed by series of glands; (7) nuptial pads present on base of finger I; (8) heels overlapping when thighs are positioned at right angles to the body; tibiotarsal articulation reaching the level far beyond the tip of the snout when leg stretched forward.

Description of holotype

Adult male (Figs 3, 4), body size moderate, SVL 44.7 mm. head length larger than head width slightly (HDL: HDW = 1.02); snout short, rounded in dorsal view, projecting beyond lower jaw; eye large and convex, eye diameter 0.74× of snout length; nostril rounded, between to tip of snout and eyes; internasal distance larger than interorbital distance; tympanum circular, distinct, 0.56× of eye diameter; loreal region slightly concave; nares oval; pineal ocellus visible; supratympanic fold extends from back of eye to above shoulder; vomerine teeth present; tongue deeply notched posteriorly; vocal sac absent.

Figure 3.

Photographs of the holotype MT DF20230601002 of Amolops dafangensis sp. nov. in life A dorsal view B ventral view C dorsal view of hand D ventral view of hand E ventral view of foot.

Figure 4.

The holotype specimen MT DF20230601002 of Amolops dafangensis sp. nov. A dorsal view B ventral view C lateral view D dorsal view of hand E ventral view of hand F ventral view of foot.

Forelimbs robust (LW/SVL=0.08); lower arm and hand beyond one-second of body length (LAL/SVL=0.51); fingers slender, relative finger lengths I < II < IV < III; finger tips on II–IV dilated to wide cordiform disks with circum-marginal grooves, tip of first finger with small disk but without circum-marginal groove; all fingers without webbing and lateral fringes; subarticular tubercle prominent; supernumerary tubercle indistinct; inner metacarpal tubercle oval, elongate; outer metacarpal tubercles small round; velvety nuptial pad on finger I.

Hindlimbs long, nearly 2× SVL (HLL/SVL = 1.87); tibiotarsal articulation reaching the level far beyond the tip of the snout when leg stretched forward; tibias longer than thigh length, heels overlapped; toes slender, relative lengths I < II < III < V < IV; toes entirely webbed; tips of toes expanded into disc with circum-marginal grooves; outer metatarsal tubercle absent; inner metatarsal tubercle small but well developed.

Skin on dorsum and dorsal surfaces of limbs smooth; dorsolateral folds weak, formed by series of glands been an incomplete line, extending from above shoulder to vent; weak dorsolateral glandular lines; ventral surface of bell and limbs smooth except a few small tubercles on posterior surface of thigh and around vent.

Coloration in life

In life, iris pale brown with dark wash; top of head and dorsum golden brown with large rounded black brown and green spots; sides of head with a pale green stripe extending from loreal region to region behind and below eye along upper lip; a black brown band from the tip of the snout through the nostril to an anterior border of the eye, continuing behind the eye to the shoulder; temporal region black brown with green blotches; the flank green with some back brown spots; limbs dorsally golden brown with black brown bands; chest and venter white, throat white with pale brown; ventral surface of anterior forelimbs brown with green spots; finger I and II fresh-colored, finger III and IV brown; ventral surface of hindlimbs fresh-colored (Fig. 3).

Color in preservative

Dorsal surface fade to pale brown with beige brown and black spots on head, flank and on limbs; ventral surface fade to creamy white, marbled with brown on throat and chest (Fig. 4).

Variation

Measurements of all specimens are listed in Table 3. All specimens were very similar in morphology, but in MT DF20230601001 the dorsum was golden brown with few green spots (Fig. 5A); in MT DF20230601003 the dorsum and dorsal surfaces of limbs were green with brown spots (Fig. 5B); in the juvenile specimen MT DF20230601004 the flank was mainly green with black spots and the ventral surface of the throat and chest were white with pale brown spots (Fig. 5C, D).

Figure 5.

Color variation in Amolops dafangensis sp. nov. A dorsolateral view of the male specimen MT DF20230601001 B dorsolateral view of the male specimen MT DF20230601003 C dorsolateral view of the juvenile specimen MT DF20230601004 D ventral view of the male specimen juvenile specimen MT DF20230601004

Secondary sexual characteristics

Adult males lack vocal sacs. In breeding, pale yellow glandular nuptial pads are present on finger I in males.

Morphological comparisons

The molecular phylogenetic results placed the new species as an independent clade into A. marmoratus group. Within the A. mantzorum group, the new species can be distinguished from A. ailao by having a larger body size (adult males SVL 43.2–46.8 mm vs 33.0–35.1 mm); by vomerine teeth present (vs absent), and by tibiotarsal articulation reaching the level far beyond the tip of the snout when leg stretched forward (vs reaching beyond anterior corner of eye); differs from A. granulosus by having a smooth dorsum skin (vs rough with spinules in males) and the absence of vocal sacs in males (vs present); differs from A. lifanensis by having a smaller body size (adult males SVL 43.2–46.8 mm vs 52.0–56.0) and having distinct tympanum (vs indistinct); differs from A. mantzorum by having a smaller body size (adult males SVL 43.2 – 46.8 mm vs 49.0–57.0 mm), head length about equal to or larger than head width (vs head length smaller than head width); differs from A. minutus by having a larger body size (adult males SVL 43.2–46.8 mm vs 29.70–36.42 mm), and the absence of vocal sacs and gular pouches in males (vs well developed); differs from A. ottorum by the presence of vomerine teeth (vs absent); differs from A. shuichengicus by having a larger body size in males (adult males SVL 43.2–46.8 mm vs 34.6–39.6 mm), and having weak dorsolateral glandular lines (vs strong dorsolateral folds); differs from A. tuberodepressus by having a smaller body size (adult males SVL 43.2–46.8 mm vs 48–56mm), and by having weak dorsolateral glandular lines (vs absent); differs from A. jinjiangensis by having distinct tympanum (vs indistinct).

Amolops dafangensis sp. nov. is phylogenetically most closed to A. loloensis and A. sangzhiensis, and the new species could be distinguished from A. loloensis by having a smaller body size in males (adult males SVL 43.2–46.8 mm vs 55–62 mm), having distinct tympanum (vs indistinct), tibiotarsal articulation reaching the level far beyond the tip of the snout when leg stretched forward (vs just reaching eye or nostrils), spots on head and dorsum irregular (vs spots on head and dorsum round or oval); differs from A. sangzhiensis by having a larger body size in males (adult males SVL 43.2–46.8 mm vs 40.3–40.9 mm), having distinct tympanum (vs indistinct),tibiotarsal articulation reaching the level far beyond the tip of the snout when leg stretched forward (vs just reaching nostrils), mouth corner smooth (vs with dense spiny tubercles around the mouth corner).

Amolops dafangensis sp. nov. differs from the species of the A. monticola group namely A. adicola, A. akhaorum, A. aniqiaoensis, A. archotaphus, A. bellulus, A. binchachaensis, chakrataensis, A. chaochin, A. chunganensis, A. compotrix, A. cucae, A. daorum, A. deng, A. iri, A. kohimaensis, A. mengdingensis, A. mengyangensis, A. monticola, A. nyingchiensis, A. putaoensis, A. truongi, A. tuanjieensis, A. vitreus, and A. wenshanensis by dorsolateral folds weak formed by series of glands (vs truth dorsolateral folds present), further distinguished from A. adicola, A. akhaorum, A. aniqiaoensis, A. archotaphus, A. chaochin, A. chunganensis, A. compotrix, A. cucae, A. daorum, A. iriodes, A. kohimaensis, A. mengdingensis, A. mengyangensis, A. monticola, A. putaoensis, A. truongi, A. tuanjieensis, A. vitreus, and A. wenshanensis by vocal sac absent (vs present).

Amolops dafangensis sp. nov. differs from A. chayuensis, the sole member of the A. chayuensis group, by dorsolateral folds weak formed by series of glands (vs truth dorsolateral folds present), and vocal sacs absent (vs present).

Amolops dafangensis sp. nov. differs from the A. viridimaculatus group contains 14 species, namely A. beibengensis, A. chanakya, A. formosus, A. himalayanus, A. kaulbacki, A. longimanus, A. medogensis, A. nidorbellus, A. pallasitatus, A. senchalensis, A. tawang, A. wangyali, A. wangyufani, and A. viridimaculatus by dorsolateral folds weak formed by series of glands (vs dorsolateral folds absent) and smaller body size (vs male SVL 75.8 mm in A. beibengensis, male SVL 76.4 mm in A. chanakya, males SVL 61.3–63.1 mm in A. formosus, male SVL 80 mm in A. himalayanus, males SVL 70–72 mm in A. kaulbacki, male SVL 95 mm in A. medogensis, males SVL 76.4–82.3 mm in A. nidorbellus, male SVL 46.2 mm in A. senchalensis, male SVL 82.5 mm in A. tawang, males SVL 71.4–76.7 mm in A. wangyali, males SVL 68.3–69.0 mm in A. wangyufani, and males SVL 72.7–82.3 mm in A. viridimaculatus).

Amolops dafangensis sp. nov. differs from the A. marmoratus group of 13 species (A. afghanus, A. assamensis, A. gerbillus, A. indoburmanensis, A. jaunsari, A. latopalmatus, A. mahabharatensis, A. marmoratus, A. nepalicus, A. panhai, A. siju, and A. terraorchis) by circum-marginal groove on disc of finger I absent (vs present), and vocal sac absent (vs present with the exception of A. siju).

Amolops dafangensis sp. nov. differs from A. spinapectoralis, the sole member of the A. spinapectoralis group, by circum-marginal groove on disc of finger I absent (vs present), and vocal sac absent (vs present).

Amolops dafangensis sp. nov. differs from the A. larutensis group with eight species, namely A. attiguus, A. australis, A. cremnobatus, A. gerutu, A. kottelati, A. larutensis, A. sengae, and A. tanfuilianae by circum-marginal groove on disc of finger I absent (vs present), and vocal sac absent (vs present).

Amolops dafangensis sp. nov. differs from the A. ricketti group that contains eight species (A. shihaitaoi, A. sinensis, A. ricketti, A. wuyiensis, A. yunkaiensis, A. albispinus, A. yatseni, and A. tonkinensis) by circum-marginal groove on disc of finger I absent (vs present), dorsolateral glandular folds present (vs absent), and nuptial pad without conical or papillate nuptial spines (vs present).

Amolops dafangensis sp. nov. differs from the A. daiyunensis group of three species, namely A. daiyunensis, A. teochewiensis and A. teochew, by circum-marginal groove on disc of finger I absent (vs present), vomerine teeth present (vs absent) and and vocal sac absent (vs present).

Amolops dafangensis sp. nov. differs from the A. hainanensis group (A. hainanensis and A. torrentis) by vomerine teeth present (vs absent) and further differs from A. hainanensis by having a smaller body size (adult males SVL 43.2–46.8 mm vs 71–93 mm) and circum-marginal groove on disc of finger I absent (vs present); further differs from A. torrentis by having a larger body size (adult males SVL 43.2–46.8 mm vs 28–33 mm) and vocal sac absent (vs present).

Distribution and ecology

At present, Amolops dafangensis sp. nov. was only found on vegetation in a mountain stream in Dafang County, Guizhou Province, China at approximately 1600 m elevation. The rocks of this stream are covered with moss, and low vegetation grows out of the cracks (Fig. 6). We did not find eggs, nor Amolops dafangensis sp. nov. tadpoles or females, and advertisement calls were not recorded, but we observed distinct nuptial pad in the males. Based on our surveys, we speculate that the breeding season is probably in early June. Boulenophrys jiangi (Liu, Li, Wei, Xu, Cheng, Wang & Wu, 2020), Boulenophrys qianbeiensis (Su, Shi, Wu, Li, Yao, Wang & Li, 2020), and Leptobrachella jinshaensis Cheng, Shi, Li, Liu, Li & Wang, 2021were also found in the type locality.

Figure 6.

Habitat of Amolops dafangensis sp. nov. in the type locality, Dafang County, Guizhou Province, China.

Etymology

The specific epithet dafangensis refers to the distribution of this species, Dafang County, Guizhou Province, China. We propose the common English name “Dafang cascade frogs” for this species and Chinese name as “Da Fang Tuan Wa (大方湍蛙)”.

Discussion

In this study, we describe a new species based on morphological comparisons and molecular phylogenetic analyses; although the genetic distance between the new species and its most closely-related congeners is 0.7% for the 16S gene, the morphological characters differ from those of other species of the genus Amolops. This small genetic difference is likely due to the limited phylogenetic information content in this particular gene fragment (Chan et al. 2022). Speciation usually begins with spatial isolation or adaptation to unique environments without strict isolation (Schilthuizen 2000). Significant spatial isolation and subsequent formation of unique lineages may be due to isolation or long-range dispersal across barriers such as mountains, rivers, or other intervening unsuitable habitats (Mayr 1963; Avise 2000; Rundle and Nosil 2005; Schluter 2009). The geographical distances between Amolops dafangensis sp. nov. and its closely-related congeners A. sangzhiensis and A. loloensis are more than 800 km and 370 km, respectively, and the type locality of the three species are in different mountains: the new species is distributed in Dalou Mountains, A. sangzhiensis in easternmost Wuling Mountains, and A. loloensis in the Daliangshan Mountains, with significantly different biota. Therefore, we speculate that isolation is likely to have promoted speciation between the lineages and led to the evolution of different morphologies between the new species, A. sangzhiensis, and A. loloensis.

In the last five years, 25 new frog species have been described in Guizhou Province, China (Frost 2023). Dafang County is in the northwest of Guizhou Province, China, and there have been few surveys of amphibians in the area over the years. From 2020 to 2023 we conducted five surveys in this region. Only in June 2023 was the new species discovered, and only three adult males and two juveniles were found in a range of ~ 100 meters below the source of the stream. Therefore, we infer that the population of the new species is small. We recommend the new species be assigned as vulnerable (VU) according to the evaluation criteria of the IUCN Red List of threatened Species (IUCN 2012). Future research should focus on determining the distribution and elevational range of the species.

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Funding

This work was supported by the Projects from the West Light Foundation of The Chinese Academy of Sciences (Grant No. 2021XBZG_XBQNXZ_A_006), the National Natural Science Foundation of China (Nos. 32270498, 31960099, 32260136, and 32070426), Guizhou Provincial Science and Technology Projects (Nos. ZK[2022]540 and [2023] 099), Forestry Science and Technology Research Project of Guizhou Forestry Department (No. [2020]13, [2020]04); Guizhou Provincial Department of Education Youth Science and Technology Talents Growth Project (Nos. KY[2020]234 and KY[2020]237), and High-level personnel research start-up funding projects of Moutai Institute (Nos. mygccrc[2022]055, mygccrc[2022]067, mygccrc[2022]083).

Author contributions

Funding acquisition: GC. Investigation: JL, XCK. Writing - original draft: SZL. Writing - review and editing: BW.

Author ORCIDs

Bin Wang https://orcid.org/0000-0001-6036-5579

Data availability

All of the data that support the findings of this study are available in the main text or Supplementary Information.

References

Ahl E (1927) [1925] Ueber neue oder seltene Froschlurche aus dem Zoologischen Museum Berlin Sitzungsberichte der Gesellschaft Naturforschender Freunde zu Berlin, 111–117.

Amphibia China (2023) The database of Chinese amphibians. Electronic Database. Kunming Institute of Zoology (CAS), Kunming, Yunnan, China. http://www.amphibiachina.org/

Anderson J (1871) A list of the reptilian accession to the Indian Museum, Calcutta from 1865 to 1870, with a description of some new species. Journal of the Asiatic Society of Bengal 40: 12–39.

Andersson LG (1939) [1938] Batrachians from Burma collected by Dr. R. Malaise, and from Bolivia and Ecuador collected by Dr. C. Hammarlund. Arkiv för Zoologi 30(23): 1–24.

Annandale (1912) Zoological results of the Abor Expedition, 1911–1912. I. Amphibia. Records of the Indian Museum 8: 7–36. https://doi.org/10.5962/bhl.part.1186

Avise JC (2000) Phylogeography: the history and formation of species. Harvard University Press, London, 447 pp. https://doi.org/10.2307/j.ctv1nzfgj7

Bain RH, Nguyen TQ (2004) Herpetofauna diversity of Ha Giang Province in northeastern Vietnam, with descriptions of two new species. American Museum Novitates 3453: 1–42. https://doi.org/10.1206/0003-0082(2004)453<0001:HDOHGP>2.0.CO;2

Bain RH, Lathrop A, Murphy RW, Orlov NL, Ho C (2003) Cryptic species of a cascade frog from Southeast Asia: Taxonomic revisions and descriptions of six new species. American Museum Novitates 3417: 1–60. https://doi.org/10.1206/0003-0082(2003)417<0001:CSOACF>2.0.CO;2

Bain RH, Stuart BL, Orlov NL (2006) Three new Indochinese species of cascade frogs (Amphibia: Ranidae) allied to Rana archotaphus. Copeia 2006(1): 43–50. https://doi.org/10.1643/0045-8511(2006)006[0043:TNISOC]2.0.CO;2

Biju SD, Mahony S, Kamei RG (2010) Description of two new species of torrent frog, Amolops Cope (Anura: Ranidae) from a degrading forest in the northeast Indian state of Nagaland. Zootaxa 2408(1): 31–46. https://doi.org/10.11646/zootaxa.2408.1.2

Blyth E (1855) Report of the Curator; Zoological Department, for March meeting. Journal of the Asiatic Society of Bengal 24: 187–188.

Boulenger G (1882) Catalogue of the Batrachia Salientias. Ecaudata in the Collection of the British Museum (2^nd еdn. ) Taylor and Francis, Oxford, 503 pp. https://doi.org/10.5962/bhl.title.8307

Boulenger G (1888) Descriptions of two new Indian species of Rana. Annals and Magazine of Natural History Series 6 2(12): 506–508. https://doi.org/10.1080/00222938809487521

Boulenger G (1899a) Descriptions of new batrachians in the collection of the British Museum (Natural History). Annals and Magazine of Natural History Series 7 3(16): 273–277. https://doi.org/10.1080/00222939908678122

Boulenger G (1899b) On a collection of reptiles and batrachians made by Mr. J. D. Latouche in N.W. Fokien, China. Proceedings of the Zoological Society of London 1899: 159–172. https://doi.org/10.1111/j.1469-7998.1899.tb06855.x

Boulenger G (1900) [1899] On the reptiles, batrachians, and fishes collected by the late Mr. John Whitehead in the interior of Hainan. Proceedings of the Zoological Society of London 1899: 956–962.

Chan KO, Abraham RK, Grismer LL (2018) Elevational size variation and two new species of torrent frogs from Peninsular Malaysia (Anura: Ranidae: Amolops Cope). Zootaxa 4434: 250–264. https://doi.org/10.11646/zootaxa.4434.2.2

Chan KO, Hertwig ST, Neokleous DN, Flury JM, Brown RM (2022) Widely used, short 16S rRNA mitochondrial gene fragments yield poor and erratic results in phylogenetic estimation and species delimitation of amphibians. BMC Evolutionary Biology 22(1): 37. https://doi.org/10.1186/s12862-022-01994-y

Chanda SK (1987) [1986] On a collection of anuran amphibians from Darjeeling and Sikkim Himalayas, with description of a new species of Rana (Ranidae). Journal of the Bengal Natural History Society. New Series 5: 140–151.

Che J, Chen HM, Yang JX, Jin JQ, Jiang K, Yuan ZY, Murphy RW, Zhang YP (2012) Universal COI primers for DNA barcoding amphibians. Molecular Ecology Resources 12(2): 247–258. https://doi.org/10.1111/j.1755-0998.2011.03090.x

Che J, Jiang K, Yan F, Zhang YP (2020) Amphibians and Reptiles in Tibet–Diversity and Evolution. Science Press, Beijing, 836 pp.

David A (1872) [1871] Rapport adressé a MM. les Professeurs-Administráteurs du Museum d’histoire naturelle. Nouvelles Archives du Muséum d’Histoire Naturelle Paris 7: 75–100.

Dever JA, Fuiten AM, Konu Ö, Wilkinson JA (2012) Cryptic Torrent frogs of Myanmar: An examination of the Amolops marmoratus species complex with the resurrection of Amolops afghanus and the identification of a new species. Copeia 2012(1): 57–76. https://doi.org/10.1643/CH-10-180

Fei L, Ye CY, Huang YZ, Liu MY (1999) Atlas of Amphibians of China. Henan Science and Technology Press, Zhengzhou, 432 pp.

Fei L, Hu SQ, Ye CY, Huang YZ (2009) Fauna Sinica. Amphibia Vol. 2 Anura. Science Press, Beijing, 957 pp.

Fei L, Ye CY, Jiang JP (2012) Colored atlas of Chinese amphibians and their distributions. Sichuan Publishing House of Science & Technology, Chengdu, 619 pp.

Frost DR (2023) Amphibian Species of the World: an Online Reference. Version 6.1. Electronic Database. American Museum of Natural History, New York, USA. http://research.amnh.org/herpetology/amphibia/index.html [Accessed 28 August 2023]

Gan YL, Yu GH, Wu ZJ (2020a) A new species of the genus Amolops (Anura: Ranidae) from Yunnan, China. Zoological Research 41: 1–6. https://doi.org/10.24272/j.issn.2095-8137.2020.125

Gan YL, Qin T, Lwin YH, Li GG, Quan RC, Liu S, Yu GH (2020b) A new species of Amolops (Anura: Ranidae) from northern Myanmar. Zoological Research 41(6): 733–739. https://doi.org/10.24272/j.issn.2095-8137.2020.125

Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O (2010) New algorithms and methods to estimate maximum-likelihood phylogenies: Assessing the performance of PhyML 3.0. Systematic Biology 59(3): 307–321. https://doi.org/10.1093/sysbio/syq010

Günther ACLG (1858) Neue Batrachier in der Sammlung des britischen Museums. Archiv für Naturgeschichte 24: 319–328. https://doi.org/10.5962/bhl.part.5288

Günther ACLG (1876) [1875] Third report on collections of Indian reptiles obtained by the British Museum. Proceedings of the Zoological Society of London 1875: 567–577.

Hall TA (1999) BIOEDIT: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41(41): 95–98.

Inger RF, Chan-ard T (1997) A new species of ranid frog from Thailand, with comments on Rana livida (Blyth). The Natural History Bulletin of the Siam Society 45: 65–70.

Inger RF, Kottelat M (1998) A new species of ranid frog from Laos. The Raffles Bulletin of Zoology 46: 29–34.

Inger RF, Orlov N L, Darevsky IS (1999) Frogs of Vietnam: A report on new collections. Fieldiana Zoology New Series 92: 1–46.

IUCN (2012) IUCN Red List Categories and Criteria: Version 3.1, 2^nd edn. Cambridge, Gland, 16 pp.

Jiang YM (1983) A new species of the genus Staurois (Ranidae), Staurois viridimaculatus. Acta Herpetologica Sinica. New Series. Chengdu 2(3): 71.

Jiang K, Wang K, Xie J, Zou DH, Liu WL, Jiang JP, Li C, Che J (2016) A new species of the genus Amolops (Amphibia: Ranidae) from southeastern Tibet, China. Zoological Research 37: 31–40.

Jiang K, Ren JL, Lyu ZT, Wang D, Wang Z, Lv K, Wu JW, Li JT (2021) Taxonomic revision of Amolops chunganensis (Pope, 1929) (Amphibia: Anura) and description of a new species from southwestern China, with discussion on Amolops monticola group and assignment of species groups of the genus Amolops. Zoological Research 42(5): 574–591. https://doi.org/10.24272/j.issn.2095-8137.2021.107

Khatiwada JR, Shu GC, Wang B, Zhao T, Xie F, Jiang JP (2020) Description of a new species of Amolops Cope, 1865 (Amphibia: Ranidae) from Nepal and nomenclatural validation of Amolops nepalicus Yang, 1991. Asian Herpetological Research 11: 71–95. https://doi.org/10.16373/j.cnki.ahr.190052

Lanfear R, Calcott B, Ho SYW, Guindon S (2012) PartitionFinder: Combined selection of partitioning schemes and substitution models for phylogenetic analyses. Molecular Biology and Evolution 29(6): 1695–1701. https://doi.org/10.1093/molbev/mss020

Liu CC (1945) New frogs from West China. Journal of the West China Border Research Society, Series B 15: 28–44.

Liu CC (1950) Amphibians of western China. Fieldiana. Zoology Memoirs 2: 353–356. https://doi.org/10.5962/bhl.part.4737

Liu CC, Hu SQ (1961) Tailless Amphibians of China. Science Press, Beijing, 233–235.

Liu CC, Hu SQ (1975) Report on three new species of Amphibia from Fujian Province. Dong Wu Xue Bao 21: 265–271.

Liu WZ, Yang DT (2000) A new species of Amolops (Anura: Ranidae) from Yunnan, China, with a discussion of karyological diversity in Amolops. Herpetologica 56: 231–238. https://doi.org/10.1643/0045-8511(2000)000[0536:ABANSO]2.0.CO;2

Liu WZ, Yang DT, Ferraris C, Matsui M (2000) Amolops bellulus: a new species of stream-breeding frog from western Yunnan, China (Anura: Ranidae). Copeia 2000(2): 536–541. https://doi.org/10.1643/0045-8511(2000)000[0536:ABANSO]2.0.CO;2

Lu B, Bi K, Fu JZ (2014) A phylogeographic evaluation of the Amolops mantzorum species group: Cryptic species and plateau uplift. Molecular Phylogenetics and Evolution 73: 40–52. https://doi.org/10.1016/j.ympev.2014.01.008

Lyu ZT, Wu J, Wang J, Sung Y-H, Liu Z-Y, Zeng Z-C, Wang X, Li Y-Y, Wang Y-Y (2018) A new species of Amolops (Anura: Ranidae) from southwestern Guangdong, China. Zootaxa 4418(6): 562–576. https://doi.org/10.11646/zootaxa.4418.6.4

Lyu ZT, Huang LS, Wang J, Li YQ, Chen HH, Qi S, Wang YY (2019a) Description of two cryptic species of the Amolops ricketti group (Anura, Ranidae) from southeastern China. ZooKeys 812: 133–156. https://doi.org/10.3897/zookeys.812.29956

Lyu ZT, Zeng ZC, Wan H, Yang JH, Li YL, Pang H, Wang YY (2019b) A new species of Amolops (Anura: Ranidae) from China, with taxonomic comments on A. liangshanensis and Chinese populations of A. marmoratus. Zootaxa 4609(2): 247–268. https://doi.org/10.11646/zootaxa.4609.2.3

Mahony S, Nidup T, Streicher JW, Teeling EC, Kamei RG (2022) A review of torrent frogs (Amolops: Ranidae) from Bhutan, the description of a new species, and reassessment of the taxonomic validity of some A. viridimaculatus group species aided by archival DNA sequences of century-old type specimens. The Herpetological Journal 32(3): 142–175. https://doi.org/10.33256/32.3.142175

Matsui M, Nabhitabhata J (2006) A new species of Amolops from Thailand (Amphibia, Anura, Ranidae). Zoological Science 23(8): 727–732. https://doi.org/10.2108/zsj.23.727

Mayr E (1963) Animal species and evolution. Belknap Press of Harvard University Press, London, 797 pp. https://doi.org/10.4159/harvard.9780674865327

Orlov NL, Ho CT (2007) Two new species of cascade ranids of Amolops genus (Amphibia: Anura: Ranidae) from Lai Chau Province (Northwest Vietnam). Russian Journal of Herpetology 14: 211–229.

Patel NG, Garg S, Das A, Stuart BL, Biju SD (2021) Phylogenetic position of the poorly known montane cascade frog Amolops monticola (Ranidae) and description of a new closely related species from Northeast India. Journal of Natural History 55(21–22): 1403–1440. https://doi.org/10.1080/00222933.2021.1946185

Pham AV, Sung NB, Pham CT, Le MD, Ziegler T, Nguyen TQ (2019) A new species of Amolops (Anura: Ranidae) from Vietnam. The Raffles Bulletin of Zoology 67: 363–377.

Pham AV, Pham CT, Ngo HT, Sung NB, Ziegler T, Le MD (2023) A new species of Amolops (Anura: Ranidae) from Son La Province, northwestern Vietnam. The Raffles Bulletin of Zoology 71: 59–69. https://doi.org/10.26107/RBZ-2023-0004

Pope CH (1929) Four new frogs from Fukien Province, China. American Museum Novitates 352: 1–5.

Pope CH, Romer JD (1951) A new ranid frog (Staurois) from the Colony of Hongkong. Fieldiana. Zoology 31: 609–612.

Qi S, Zhou ZY, Lyu ZT, Lu YY, Wan H, Hou M, Guo K, Li PP (2019) Description of a New Species of Amolops (Anura: Ranidae) from Tibet, China. Asian Herpetological Research 10: 219–229. https://doi.org/10.16373/j.cnki.ahr.190016

Qian TY, Xiang JJ, Jiang JP, Yang DD, Gui J (2023) A new species of the Amolops mantzorum group (Anura: Ranidae: Amolops) from northwestern Hunan Province, China. Asian Herpetological Research 14: 54–64.

Ray P (1992) Two new hill-stream frogs of the genus Amolops Cope (Amphibia: Anura: Ranidae) from Uttar Pradesh (India). Indian Journal of Forestry 15: 346–350.

Ronquist FR, Huelsenbeck JP (2003) MrBayes3: Bayesian phylogenetic inference under mixedmodels. Bioinformatics 19(12): 1572–1574. https://doi.org/10.1093/bioinformatics/btg180

Rundle HD, Nosil P (2005) Ecological speciation. Ecology Letters 8(3): 336–352. https://doi.org/10.1111/j.1461-0248.2004.00715.x

Saikia B, Laskar MA, Dinesh KP, Shabnam A, Sinha B (2022a) Description of two new species of Amolops (Anura: Ranidae) from Arunachal Pradesh, Northeast India under the morphological ‘Viridimaculatus species group’. Records of the Zoological Survey of India 122: 247–266.

Saikia B, Sinha B, Laskar MA, Shabnam A, Dinesh KP (2022b) A new species of Amolops (Anura: Ranidae) representing the morphological ‘Marmoratus species group’ from Sessa Orchid Sanctuary, Arunachal Pradesh, Northeast India. Records of the Zoological Survey of India 122: 303–322.

Saikia B, Sinha B, Shabnam A, Dinesh KP (2023) Description of a new species of Amolops Cope (Anura: Ranidae) from a cave ecosystem in Meghalaya, Northeast India. Journal of Animal Diversity 5(1): 36–54. https://doi.org/10.61186/JAD.5.1.36

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York, 125 pp.

Schilthuizen M (2000) Dualism and conflicts in understanding speciation. BioEssays 22(12): 1134–1141. https://doi.org/10.1002/1521-1878(200012)22:12<1134::AID-BIES11>3.0.CO;2-5

Schluter D (2009) Evidence for ecological speciation and its alternative. Science 80(323): 737–741. https://doi.org/10.1126/science.1160006

Sengupta S, Hussain B, Choudhury PK, Gogoi J, Ahmed MF, Choudhury NK (2008) A new species of Amolops (Anura: Ranidae) from Assam, north-eastern India. Hamadryad Madras 32: 5–12.

Sheridan JA, Phimmachak S, Sivongxay N, Stuart BL (2023) Systematics of the Lao torrent frog, Amolops cremnobatus Inger & Kottelat, 1998 (Anura: Ranidae), with descriptions of four new species. Vertebrate Zoology 73: 931–956. https://doi.org/10.3897/vz.73.e102475

Simon CF, Frari F, Beckenbach A, Crespi B, Liu H, Flook P (1994) Evolution, weighting and Phylogenetic utility of mitochondrial gene sequences and a compilation of conserved Polymerase chain reaction Primers. Annals of the Entomological Society of America 87(6): 651–701. https://doi.org/10.1093/aesa/87.6.651

Smith MA (1923) On a collection of reptiles and batrachians from the Island of Hainan. The Journal of the Natural History Society of Siam 6: 195–212.

Smith MA (1940) The amphibians and reptiles obtained by Mr. Ronald Kaulback in Upper Burma. Records of the Indian Museum 42: 465–486. https://doi.org/10.26515/rzsi/v42/i3/1940/162431

Stuart BL, Bain RH, Phimmachak S, Spence K (2010) Phylogenetic systematics of the Amolops monticola group (Amphibia: Ranidae), with description of a new species from northwestern Laos. Herpetologica 66(1): 52–66. https://doi.org/10.1655/08-073.1

Su CY, Yang DT, Li SM (1986) A new species of Amolops from the Hengduan Shan Mountains. Acta Herpetologica Sinica 5(3): 204–206.

Sun GZ, Luo WX, Sun HY, Zhang GY (2013) A new species of Cascade Frog from Tibet: China. Forestry Construction 20: 14–16.

Sung YH, Hu P, Wang J, Liu HJ, Wang YY (2016) A new species of Amolops (Anura: Ranidae) from southern China. Zootaxa 4170(3): 525–538. https://doi.org/10.11646/zootaxa.4170.3.6

Tamura K, Stecher G, Peterson D, Fiipski A, Kumar S (2013) MEGA6: Molecular evolutionary genetics analysis, version 6.0. Molecular Biology and Evolution 30(12): 2725–2729. https://doi.org/10.1093/molbev/mst197

Tang SJ, Sun T, Liu S, Luo SD, Yu GH, Du LN (2023) A new species of cascade frog (Anura: Ranidae: Amolops) from central Yunnan, China. Zoological Letters 9(15): 1–19. https://doi.org/10.1186/s40851-023-00214-9

Wang J, Li J, Du L, Hou M, Yu GH (2022) A cryptic species of the Amolops ricketti species group (Anura, Ranidae) from China-Vietnam border regions. ZooKeys 1112: 139–159. https://doi.org/10.3897/zookeys.1112.82551

Wu GF, Tian WS (1995) A new Amolops species from southern Yunnan. In: Zhao EM (Ed.) Amphibian Zoogeographic Division of China. A Symposium Issued to Celebrate the Second Asian Herpetological Meeting Held at Ashgabat, Turkmenistan, 6 to 10 September 1995. Sichuan Journal of Zoology, Supplement, 51–52.

Wu YH, Yan F, Stuart BL, Prendini E, Suwannapoom C, Dahn HA, Zhang BL, Cai HX, Xu YB, Jiang K, Chen HM, Lemmon EM, Raxworthy CJ, Orlov NL, Murphy RW, Che J (2020) A combined approach of mitochondrial DNA and anchored nuclear phylogenomics sheds light on unrecognized diversity, phylogeny, and historical biogeography of the torrent frogs, genus Amolops (Anura: Ranidae. Molecular Phylogenetics and Evolution 144(106701): 1–13. https://doi.org/10.1016/j.ympev.2020.106789

Yu GH, Wu ZJ, Yang JX (2019) A new species of the Amolops monticola group (Anura: Ranidae) from southwestern Yunnan, China. Zootaxa 4577(3): 548–560. https://doi.org/10.11646/zootaxa.4577.3.8

Yuan ZY, Jin JQ, Li J, Stuart BL, Wu J (2018) A new species of cascade frog (Amphibia: Ranidae) in the Amolops monticola group from China. Zootaxa 4415(3): 498–512. https://doi.org/10.11646/zootaxa.4415.3.5

Zeng Z, Liang D, Li JX, Lyu ZT, Wang YY, Zhang P (2020) Phylogenetic relationships of the Chinese torrent frogs (Ranidae: Amolops) revealed by phylogenomic analyses of AFLP-Capture data. Molecular Phylogenetics and Evolution 146: 106753. https://doi.org/10.1016/j.ympev.2020.106753

Zeng ZC, Wang J, Lyu ZT, Wang YY (2021) A new species of Torrent frog (Anura, Ranidae, Amolops) from the Coastal Hills of Southeastern China. Zootaxa 5004(1): 151–166. https://doi.org/10.11646/zootaxa.5004.1.6

Zhao WG, Rao DQ, Lü SQ, Dong BJ (2005) Herpetological surveys of Xizang autonomous region 2. Medog. Sichuan Journal of Zoology 24: 250–253.

Zhu JG, Rao D (2022) Atlas of Wildlife in Southwest China: Amphibian. Beijing Publishing Group, Beijing, 295 pp.

Supplementary materials

Supplementary material 1

Uncorrected p-distances between species in the Amolops mantzorum group based on the 16S gene sequences

Shi-Ze Li, Jing Liu, Xiao-Cong Ke, Gang Cheng, Bin Wang

Data type: xlsx

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Download file (10.29 kb)

Supplementary material 2

Uncorrected p-distances between species in the Amolops mantzorum group based on the COI gene sequences

Shi-Ze Li, Jing Liu, Xiao-Cong Ke, Gang Cheng, Bin Wang

Data type: xlsx

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Download file (10.23 kb)

﻿Abstract

Key words

﻿Introduction

﻿Materials and methods

﻿Sampling

﻿Collection of molecular data

﻿Phylogenetic analyses and genetic distance

﻿Morphological comparisons

﻿Results

﻿Phylogenetic analyses

﻿Morphological comparisons

﻿Taxonomic account

﻿ Amolops dafangensis sp. nov.

Material examined

Diagnosis

Description of holotype

Coloration in life

Color in preservative

Variation

Secondary sexual characteristics

Morphological comparisons

Distribution and ecology

Etymology

﻿Discussion

﻿Additional information

Conflict of interest

Ethical statement

Funding

Author contributions

Author ORCIDs

Data availability

﻿References

Supplementary materials

Abstract

Introduction

Materials and methods

Sampling

Collection of molecular data

Phylogenetic analyses and genetic distance

Morphological comparisons

Results

Phylogenetic analyses

Morphological comparisons

Taxonomic account

Amolops dafangensis sp. nov.

Discussion

Additional information

References