Research Article |
Corresponding author: Susana Carvalho ( susana.carvalho@kaust.edu.sa ) Academic editor: Andrew Davinack
© 2024 Marcos A. L. Teixeira, Chloé Julie Loïs Fourreau, Juan Sempere-Valverde, Susana Carvalho.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Teixeira MAL, Fourreau CJL, Sempere-Valverde J, Carvalho S (2024) Two new records and description of a new Perinereis (Annelida, Nereididae) species for the Saudi Arabian Red Sea region. ZooKeys 1196: 331-354. https://doi.org/10.3897/zookeys.1196.115260
|
Annelid biodiversity studies in the Red Sea are limited and integrative taxonomy is needed to accurately improve reference libraries in the region. As part of the bioblitz effort in Saudi Arabia to assess the invertebrate biodiversity in the northern Red Sea and Gulf of Aqaba, Perinereis specimens from intertidal marine and lagoon-like rocky environments were selected for an independent assessment, given the known taxonomic ambiguities in this genus. This study used an integrative approach, combining molecular with morphological and geographic data. Our results demonstrate that specimens found mainly in the Gulf of Aqaba are not only morphologically different from other five similar Perinereis Group I species reported in the region, but phylogenetic analysis using available COI sequences from GenBank revealed different molecular operational taxonomic units, suggesting an undescribed species, P. kaustiana sp. nov. The new species is genetically close and shares a similar paragnath pattern to the Indo-Pacific distributed P. helleri, in particular in Area III and Areas VII–VIII. Therefore, we suggest it may belong to the same species complex. However, P. kaustiana sp. nov. differs from the latter mainly in the shorter length of the postero-dorsal tentacular cirri, median parapodia with much longer dorsal Tentacular cirri, posteriormost parapodia with much wider and greatly expanded dorsal ligules. Additionally, two new records are reported for the Saudi Neom area belonging to P. damietta and P. suezensis, previously described only for the Egyptian coast (Suez Canal) and are distributed sympatrically with the new species, but apparently not sympatric with each other.
Gulf of Aqaba, mtCOI-5P, NEOM, north-eastern Red Sea, Polychaeta, Saudi Arabia, taxonomy
Based on genetic databases (i.e., BOLD and GenBank), and despite the recent advances in integrative studies focused on polychaetes (i.e.,
The Egyptian side of the Red Sea has been the focus of an increasing amount of polychaete studies either reviewing existing species groups (i.e.,
The NEOM bioblitz sampling campaign surveyed 38 shallow and coral reef sites up to 25 meters depth and some intertidal habitats, along the northern region of the Saudi Arabian Red Sea and Gulf of Aqaba (Neom area). This initiative aims to initiate a biodiversity inventory of marine benthic invertebrates (mainly mobile) and cryptobenthic fish in the Red Sea using DNA barcoding and metabarcoding. Only intertidal marine and lagoon-like rocky environments were considered for the purpose of this study, in order to perform an independent assessment within Perinereis, given the known taxonomic ambiguities in several species within the genus from this particular habitat.
A total of 36 Perinereis specimens (atokous) were hand-collected on rocky shores, in coarse-grained sediments under cobbles and rocks. Specimens were found in Magna (centre of Gulf of Aqaba; 28°26'57.3"N, 34°45'35.4"E), Shushah Island (27°56'13.7"N, 34°54'36.1"E) and lagoon-like environments at Almojawah Bay (South of Gulf of Aqaba; 28°10'18.1"N, 34°38'57.6"E) and Duba (Al Muwaileh; 27°37'04.4"N, 35°31'26.7"E), in May 2023. Two specimens collected in the northern region of Portugal (Canto Marinho, 41°44'13.2"N, 8°52'33.6"W) belonging to Perinereis oliveirae (Horst, 1889), were previously collected by the first author of this work, and due to misidentifications with the P. cultrifera morphotype in genetic databases, were used in this study for comparison purposes.
Table
Species, number of sequences (n), geographic location, and their respective GenBank COI accession numbers for the original material and sequence data used from other studies.
Species | GenBank COI | Region | Location | n | Reference |
---|---|---|---|---|---|
Perinereis kaustiana sp. nov. | PP279005, PP279009, PP279010, PP279017–PP279020, PP279029, PP279035 | Red Sea | Saudi Arabia, Gulf of Aqaba (Magna) | 9 | This study |
PP279008, PP279025 | Saudi Arabia, Shushah Island | 2 | |||
PP279004 | Saudi Arabia, Duba (Al Muwaileh) | 1 | |||
Perinereis suezensis | PP279006, PP279007, PP279015, PP279016, PP279021, PP279023, PP279024, PP279026–PP279028, PP279036, PP279038, PP279039 | Saudi Arabia, Shushah Island | 13 | ||
OP612968–OP612972 | Egypt, Gulf of Suez | 5 |
|
||
Perinereis damietta | PP279034 | Saudi Arabia, Gulf of Aqaba (Magna) | 1 | This study | |
PP279014, PP279037 | Saudi Arabia, Duba (Al Muwaileh) | 2 | |||
PP279002, PP279011–PP279013, PP279030–PP279033 | Saudi Arabia, Gulf of Aqaba (Almojawah Bay) | 8 | |||
OP610122–OP610126 | Egypt, Gulf of Suez | 5 |
|
||
Perinereis fayedensis | OP605759–OP605763 | Egypt, Gulf of Suez | 5 | ||
Perinereis oliveirae | PP279003, PP279022 | NE Atlantic | Portugal, Canto Marinho | 2 | This study |
“Perinereis cultrifera” | KR916909–KR916912 | Portugal, Areosa Beach | 5 |
|
|
Perinereis helleri | JX420256 | Malaca Strait | Malaysia, Port Dickson | 1 |
|
“Perinereis nuntia” | MH337359 | Andaman Sea | India, Adaman and Nicobar Islands | 1 | Sivaraj and Thivikaran, unpublished |
JX420257 | Java Sea | Indonesia, Pari Island | 1 |
|
|
Perinereis marionii | OP347380 | NE Atlantic | Great Britain, Plymouth | 1 |
|
OP347386 | Portugal, Canto Marinho | 1 | |||
Perinereis vallata | HQ705192–HQ705196 | South Pacific Ocean | Chile, Concepción | 5 |
|
Perinereis euiini | KY249122–KY249124 | Yellow Sea | South Korea, Gusan-myeon | 3 |
|
MN256544–MN256546 | South China Sea | China, Xiamen | 3 | Xing and Zhang, unpublished | |
Perinereis anderssoni | MH143495, MH143498, MH143502, MH143503, MH143522 | NW Atlantic | Brasil, Espirito Santo | 5 |
|
Alitta virens | OP038747, OP038760, OP038799, OP038806, OP038851 | North Sea | Sweden, Tjärnö-Salto canal | 5 |
|
DNA sequences of the 5’ end of the mitochondrial cytochrome oxidase subunit I (mtCOI-5P) were obtained for all the collected Perinereis specimens and used for the main analysis. A representative number of specimens per location for the new species were also sequenced using the mitochondrial 16S rRNA and D2 region of nuclear 28S rRNA, for future reference purposes.
DNA extraction was performed using QuickExtract DNA Extraction Solution (Lucigen) with 50 µl of the reagent per Eppendorf. The tubes were then transferred to a heat block at 65 °C for 30 min and then an additional 2 min at 98 °C. Depending on the specimen size, only a small amount of tissue (i.e., a single parapodium) or the posterior end of the worm was used.
PCR reactions were performed using a premade PCR mix from VWR containing 10 µl per tube of Red Taq DNA polymerase Master Kit (2 mM, 1.1×), 0.5 µl of each primer (10 mM) and 1 µl of DNA template in a total 12 µl volume reaction. Table
Marker | Primer | Fragment | Direction (5’–3’) | PCR thermal cycling conditions | Reference |
---|---|---|---|---|---|
COI | PolyLCO | 658bp | (F) GAYTATWTTCAACAAATCATAAAGATATTGG | 1) 94 °C (1 min); 2) 5 cycles: 94 °C (40 s), 45 °C (40 s), 72 °C (1 min); 3) 35 cycles: 94 °C (40 s), 51 °C (40 s), 72 °C (1 min); 4) 72 °C (5 min). |
|
PolyHCO | (R) TAMACTTCWGGGTGACCAAA RAATCA | ||||
16S | 16SAR-L | c.365bp | (F) CGCCTGTTTATCAAAAACAT | 1) 94 °C (3 min); 2) 40 cycles: 94 °C (30 s), 52 °C (30 s), 72 °C (1 min); 3) 72 °C (7 min). |
|
16SANN-F | (F) GCGGTATCCTGACCGTRCWAAGGTA | ||||
16SBR-H | (R) CCGGTCTGAACTCAGATCACGT | ||||
28S | 28sC2 | c.500bp | (F) ACTCTCTCTTCAAAGTTCTTTTC | 1) 96 °C (4 min); 2) 45 cycles: 94 °C (30 s), 55 °C (30 s), 72 °C (1 min); 3) 72 °C (8 min). |
|
28s-D2 | (R) TCCGTGTTTCAAGACGG |
The obtained trace files were edited and aligned in MEGA software v. 11.0.10 (https://www.megasoftware.net/;
For comparison purposes, GenBank COI sequence data from P. marionii (Audouin & Milne Edwards, 1833); P. vallata (Grube, 1857); P. helleri (Grube, 1878); P. cultrifera; P. euiini Park & Kim, 2017; P. anderssoni Kinberg, 1865; P. nuntia (Lamarck, 1818); P. fayedensis Elgetany, Struck & Glasby, 2022; P. suezensis Elgetany, Struck & Glasby, 2022; P. damietta Elgetany, Struck & Glasby, 2022; and the outgroup Alitta virens (M. Sars, 1835) completed the final dataset (Table
Three delimitation methods were applied to obtain Molecular Operational Taxonomic Units (MOTUs): The Barcode Index Number (BIN), which makes use of the Refined Single Linkage (RESL) algorithm available only in BOLD (
The mean genetic distances for mtCOI (K2P;
Specimens were studied using a Leica stereo microscope (model M205 C). Stereo microscope images were taken with a Flexacam C3 camera. Compound microscope images of parapodia and chaetae were obtained with a Leica DM2000 LED imaging light microscope, equipped with a Flexacam C3 camera, after mounting the parapodia on a slide preparation using Aqueous Permanent Mounting Medium (Supermount). Parapodial and chaetal terminology in the taxonomic section follows
For measuring length of dorsal ligules, not only the lengths of the tips were considered, but the proximal part of the ligules was also included (e.g.,
Paragnath counts were performed to compare patterns with other morphologically similar Group I Perinereis species (
Terminology for molecular vouchers follows
The phylogenetic reconstruction recovered ten MOTUs of Perinereis (Fig.
Phylogenetic tree and MOTU distribution for the three sampled Red Sea Perinereis species A maximum likelihood phylogeny based on COI sequences, with information regarding the different MOTU delineation methods. Numbered MOTUs (1–4) contain original sequences from Perinereis specimens analysed in this study; MOTUs “GB” are based on Perinereis sequences mined from GenBank; MOTU “OUTG” correspond to the rooted outgroup, Alitta virens. Bootstrap values lower than 80% not displayed B Red Sea MOTU distribution; each coloured pie corresponds to a unique species and respective abundance proportion; larger pie charts indicate higher number of sympatric species. Species from the Suez Canal based on mined GenBank sequences from
In this phylogenetic tree, P. suezensis (MOTU 1) and P. fayedensis (MOTU GB1) are sister to each other, and their lineage splits early compared to the other analysed species of Perinereis. The basal node support for the six molecular groups (2, 4, GB2, and GB4–GB6) is very low. The 36 Red Sea specimens sequenced in the present study clustered into three clades that correspond to P. suezensis (MOTU 1, Fig.
Mean intra (in bold) and inter-MOTU COI genetic distances (K2P; %), for the eleven analysed species/MOTUs in Fig.
1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | |
---|---|---|---|---|---|---|---|---|---|---|---|
P. kaustiana sp. nov. (M. 3) | 1.0 ± 0.2 | ||||||||||
P. helleri (M. GB3) | 19.9 ± 2.4 | 0.5 ± 0.2 | |||||||||
P. suezensis (M. 1) | 25.8 ± 3.2 | 26.7 ± 3.2 | 1.1 ± 0.2 | ||||||||
P. damietta (M. 2) | 23.8 ± 3.2 | 25.5 ± 3.2 | 25.9 ± 3.1 | 0.8 ± 0.2 | |||||||
P. fayedensis (M. GB1) | 25.3 ± 3.2 | 25.8 ± 3.2 | 5.8 ± 1.0 | 25.0 ± 3.0 | 0.0 ± 0.0 | ||||||
P. euiini (M. GB6) | 24.6 ± 3.2 | 25.5 ± 3.2 | 27.0 ± 3.4 | 25.3 ± 3.2 | 27.2 ± 3.4 | 0.6 ± 0.2 | |||||
P. oliveirae (M. 4) | 25.8 ± 3.2 | 25.7 ± 3.2 | 25.4 ± 3.2 | 27.3 ± 3.4 | 24.8 ± 3.1 | 26.3 ± 3.3 | 0.6 ± 0.2 | ||||
P. anderssoni (M. GB5) | 26.7 ± 3.4 | 24.6 ± 3.3 | 24.9 ± 3.1 | 26.4 ± 3.3 | 23.7 ± 3.0 | 22.3 ± 2.8 | 26.6 ± 3.4 | 0.2 ± 0.1 | |||
P. vallata (M. GB2) | 23.1 ± 3.0 | 22.0 ± 2.8 | 23.2 ± 3.0 | 22.0 ± 2.8 | 22.6 ± 2.9 | 24.1 ± 3.1 | 23.6 ± 2.9 | 24.3 ± 3.2 | 0.1 ± 0.1 | ||
P. marionii (M. GB4) | 25.9 ± 3.3 | 22.8 ± 3.0 | 25.2 ± 3.2 | 27.3 ± 3.4 | 23.8 ± 3.0 | 24.0 ± 3.2 | 23.6 ± 3.0 | 23.1 ± 3.0 | 21.1 ± 2.7 | 0.3 ± 0.2 | |
A. virens (OUTG) | 29.3 ± 3.9 | 28.1 ± 3.5 | 27.5 ± 3.4 | 29.6 ± 3.6 | 27.5 ± 3.3 | 28.5 ± 3.5 | 27.6 ± 3.4 | 27.6 ± 3.5 | 26.3 ± 3.1 | 26.5 ± 3.2 | 0.2 ± 0.1 |
Family Nereididae Blainville, 1818
Genus Perinereis Kinberg, 1865
Nereis Perinereis helleri Grube, 1878: 81–82; Horst 1924: 172–173, pl 34, figs 3, 4.
Perinereis helleri
Monro, 1931: 14–15, fig. 8a–c.;
Perinereis cultrifera var. helleri
Perinereis carniguina Grube, 1878: 87, pl 4, fig. 8.
Holotype and hologenophore : NTNU-VM-86011, Saudi Arabia (Red Sea), Gulf of Aqaba, Magna, 28°26'57.3"N, 34°45'35.4"E, intertidal, rocky beach among coarse-grained sand under rocks, collected by Marcos A. L. Teixeira and Chloé Julie Loïs Fourreau, 11/05/2023, GenBank (mtCOI): PP279020.
Paratypes and paragenophores : 7 specimens, NTNU-VM-86010, NTNU-VM-86012–NTNU-VM-86017, Saudi Arabia (Red Sea), Gulf of Aqaba, Magna, 28°26'57.3"N, 34°45'35.4"E, intertidal, rocky beach under rocks among coarse-grained sand, collected by Marcos A. L. Teixeira and Chloé Julie Loïs Fourreau, 11/05/2023, GenBank (mtCOI): PP279009–PP279010, PP279017–PP279019, PP279029, and PP279035.
2 specimens, NTNU-VM-86019, NTNU-VM-86020, Saudi Arabia (Red Sea), Shushah Island, 27°56'13.7"N, 34°54'36.1"E, intertidal, rocky beach under rocks among coarse-grained sand, collected by Marcos A. L. Teixeira, 05/05/2023. 1 specimen, NTNU-VM-86018, Saudi Arabia (Red Sea), Duba, Al Muwaileh, 27°37'04.4"N, 35°31'26.7"E, lagoon environment, intertidal, under rocks among coarse-grained sand, collected by Marcos A. L. Teixeira and Chloé Julie Loïs Fourreau, 18/05/2023. 1 specimen, MTPNO009-23, Saudi Arabia (Red Sea), Gulf of Aqaba, Magna, 28°26'57.3"N, 34°45'35.4"E, intertidal, rocky beach under rocks among coarse-grained sand, collected by Marcos A. L. Teixeira and Chloé Julie Loïs Fourreau, 11/05/2023.
Four pairs of tentacular cirri, postero-dorsal one reaching chaetiger 7–9; ratio of DPCL / HL = 3.6×. Eversible pharynx with one pair of dark brown curved jaws with seven or eight denticles; two longitudinal canals emerging from the pulp cavity, both in the mid-section of the jaw. Pharynx consisting of maxillary and oral rings with conical shaped paragnaths. Maxillary ring: Area I = 2 small paragnaths arranged in a longitudinal line. Area II = Cluster of 5–7 small paragnaths. Area III = central patch of nine small paragnaths, lateral patches with two small paragnaths each. Area IV = 13 small paragnaths arranged in wedge shape without any bars. Oral ring: Area V = a triangle of three large paragnaths. Area VI (a+b) = two narrow bar-shaped paragnaths, one on each side, displayed as a straight line. Areas VII–VIII = 20–24 small paragnaths in total; Area VII, ridge region with two transverse paragnaths, furrow regions with two longitudinal paragnaths each; Area VIII, ridge regions with one paragnath each, furrow regions with two longitudinal paragnaths each. Dorsal cirrus longer than ventral cirrus throughout the body; much longer in median chaetigers, ratio DCL / VCL = 2.8–3×. Ventral Tentacular cirri of median chaetigers shorter than ventral ligule, ratio of VCL / VLL = 0.7×. Dorsal ligule oval, ending tip gradually becomes thinner throughout the body; finger-like tip in median and posterior parapodia. Dorsal ligules of median chaetigers subequal to dorsal Tentacular cirri, tips shorter than dorsal Tentacular cirri. Posteriormost dorsal ligules greatly expanded (3× the length of the ventral ligule) and visibly much wider (2.5–3× the width of median ligule) than anterior and median ones (2× the width of median ligule). Pygidial Tentacular cirri as long as last 12–14 chaetigers.
MtCOI-5P, 16S, and 28S sequences as in specimens NTNU-VM-86010–NTNU-VM-86020 and MTPNO009-23 (Table
Confined to the northeastern Red Sea (Duba, Shushah Island) and Gulf of Aqaba (Magna) so far. Type locality: Saudi Arabia, Gulf of Aqaba: Magna region (marine site), 28°26'57.3"N, 34°45'35.4"E. Specimens collected both in lagoon-like environments and fully marine sites in rocky areas, usually among coarse-grained sand under rocks. Apparently more abundant and easier to find in marine sites from the Gulf of Aqaba. Can be found in sympatry with P. damietta (Fig.
The species designation pays tribute to the King Abdullah University of Science and Technology (KAUST) in Saudi Arabia, a globally recognized graduate-level research institution. This naming honours KAUST’s substantial and enduring contributions to marine science, particularly in advancing our understanding of the Red Sea over the course of more than a decade. Through its dedicated research efforts, KAUST has significantly enriched the scientific community’s knowledge of this unique marine environment.
Specimens used: NTNU-VM-86011 (holotype) and NTNU-VM-86015 (paratype), both preserved in ethanol 96%, stored at NTNU University Museum (Norway, NTNU-VM).
Body/measurements
: Body with a prominent dorsal blood vessel (Fig.
Perinereis kaustiana sp. nov. All pictures are from the holotype (NTNU-VM-86011) if not stated otherwise A anterior end, prostomium, dorsal view B anterior end, prostomium, ventral view C jaws and respective jaw canals (JC), dorsal view D pharynx, maxillary ring (Areas III and IV), ventral view; black arrows, lateral patches with two paragnaths each E pharynx, oral ring (Areas VI), dorsal view F pharynx, maxillary ring (Areas I and II), dorsal view G pharynx, oral ring (Areas VII–VIII), ventral view; black arrows, furrow regions; white arrows, ridge regions H posterior end; white arrows, pygidial Tentacular cirri, paratype (NTNU-VM-86015) I anterior body, tentacular cirri reaching chaetiger 9, paratype (NTNU-VM-86015) J worm’s eyes, right side, paratype (NTNU-VM-86015). Abbreviations: chaet., chaetiger; Pyg., Pygidium. Scale bars: 500 μm (A, B, I); 250 μm (E, F, H); 100 μm (D, G); 125 μm (J); 75 μm (C).
Head
(Fig.
Tentacular cirri
: Tentacular cirri longer than mid body width. Tentacular cirri pattern: postero-dorsal Tentacular cirri twice longer than antero-dorsal ones; postero-dorsal reaching chaetiger 7–9 (Fig.
Pharynx
: Pair of dark brown curved jaws with 7–8 denticles; two longitudinal canals emerging from the pulp cavity, both in the mid-section of the jaw (Fig.
Notopodia
: Dorsal Tentacular cirri slender, tapering, subequal to dorsal ligule in anterior (Fig.
Perinereis kaustiana sp. nov. Parapodia and types of chaetae. All images are from the holotype (NTNU-VM-86011) A right parapodium, posterior view, chaetiger 9 B right parapodium, posterior view, chaetiger 46 C right parapodium, posterior view, chaetiger 96 D notochaetae: homogomph spiniger with lightly serrated blade, chaetiger 9 E neurochaetae, subacicular fascicle: heterogomph falcigers (centre) and heterogomph spinigers with lightly serrated blade (left), chaetiger 9 F neurochaetae, supra-acicular fascicle: homogomph spiniger with coarsely serrated blade, chaetiger 9 G neurochaetae, subacicular fascicle: heterogomph spiniger with lightly serrated blade, chaetiger 9 H neurochaetae, supra-acicular fascicle: heterogomph falciger, chaetiger 56 I posterior end, focused on chaetiger 97 and chaetiger 98. Abbreviations: DC, Dorsal Tentacular cirri; DL, Dorsal ligule; ML, Median ligule; NA, Neuroacicular ligule; VL, Ventral ligule; VC, Ventral Tentacular cirri. Scale bars: 250 μm (I); 100 μm (A–C); 10 μm (D–H).
Neuropodia
: Ventral Tentacular cirri slender with tapering tip, 1.35× shorter throughout the body (Fig.
Chaetae
: Notochaetae with homogomph spinigers; spinigers with lightly serrated blade, evenly spaced (Fig.
Pygidium
: With a pair of long cylindrical slender anal Tentacular cirri, as long as last 12–14 chaetigers (Fig.
Some nereidid species groups can have similar morphological features, including paragnath patterns, that may cause misidentifications. The new species COI clade revealed no GenBank match based on the BLAST tool. Perinereis kaustiana sp. nov. and a sequence belonging to a specimen from Malaysia identified as P. helleri (type locality: Bohol, Philippines) not only are sister to each other and phylogenetically close (Fig.
Comparison between selected characters in the most morphologically similar species to P. kaustiana sp. nov., reported for the Arabian Peninsula and Mediterranean Sea and lacking DNA data. The Indo-Pacific P. helleri is also included. Morphological details of paragnath patterns for P. cultrifera and P. rullieri species complexes also includes partial data from topotypical specimens belonging to the private collection of the first author, to be published in the forthcoming future.
Characters | P. kaustiana sp. nov. | P. helleri (Grube, 1878) | P. cultrifera (Grube, 1840) | P. rullieri Pilato, 1974 |
---|---|---|---|---|
Colouration | Yellowish to yellowish brown | Creamy pink or pale brown | Yellowish brown to dark brown; faint narrow transverse pigmented bands on several anterior chaetigers | Yellowish brown to dark brown |
Paragnaths Area I | 2 small paragnaths arranged in a longitudinal line | Usually 2 small paragnaths arranged in a longitudinal line; occasionally 1 | Usually 2 paragnaths arranged in a longitudinal line; occasionally 1 | Usually one; may have 2 paragnaths arranged in a longitudinal line |
Paragnaths Area II | Cluster of 5–7 small paragnaths | Cluster of 4–17 small paragnaths | Diagonal band of 3–15 large paragnaths | Cluster of 3–15 small paragnaths |
Paragnaths Area III | Central patch of 9 small paragnaths + lateral patches with 2 paragnaths each | Central patch of 11–20 small paragnaths + lateral patches with 2 or 3 paragnaths each | Central patch of 5–11 large paragnaths, lateral patch absent | Central patch of 5–16 small paragnaths + lateral patches (may be present only on a single side) with 1 paragnath each |
Paragnaths Area IV | 13 small paragnaths arranged in wedge shape without any bars. | 10–19 small paragnaths arranged in wedge shape, without any bars. | 6–20 paragnaths arranged in wedge shape, without any bars. | 10–25 paragnaths arranged in wedge shape without any bars. |
Paragnaths Area V | Triangle of 3 paragnaths | Triangle of 3 paragnaths | Variable. Usually a triangle of 3 paragnaths; may occasionally display a single paragnath or have 4 paragnaths arranged in rhomboid shape | Usually a triangle of 3 paragnaths; may occasionally display a single paragnath |
Paragnaths Areas VI (a+b) | 2 narrow, straight bars | 2 narrow, straight bars | Variable, usually 2 broader and straight bars; may have narrow and/or arcuate and/or short bars | Variable, usually 2 narrower and straight bars; may be very short |
Paragnaths Areas VII, VIII | Area VII, ridge region with 2 transverse paragnaths, furrow regions with 2 longitudinal paragnaths each; 20–24 total. | Area VII, ridge region with 2 transverse paragnaths, furrow regions with 2 longitudinal paragnaths each; 21–40 total | Usually arranged in two regular rows of large paragnaths; 20–50 total | Usually arranged in two irregular rows of small paragnaths; 20–40 total |
Postero-dorsal Tentacular cirri | Medium sized, reaching up to chaetiger 9 | Long sized, reaching up to chaetiger 16 | Small sized, reaching up to chaetigers 4 and 5 | Medium sized, reaching up to chaetigers 6–8 |
Homogomph spiniger serration (neurochaetal supra-acicular fascicle) | Coarsely serrated | No data | Lightly serrated | Coarsely serrated |
Heterogomph falcigers | Present with long blades | Present with long blades | Present with short blades | Present with long blades |
Parapodia | Posteriormost dorsal ligules greatly expanded (3× longer than ventral ligule) and much wider (2.5–3× wider than median ligule) than in anterior and median ones. Median dorsal Tentacular cirri much longer than ventral ones (ratio 2.8–3×) | Posteriormost dorsal ligule expanded (1.9–2× longer than ventral ligule). Dorsal Tentacular cirri subequal to ventral Tentacular cirri throughout the body | Posteriormost dorsal ligule expanded (1.5–1.8× longer than ventral ligule); may be greatly expanded (> 2×) | Posteriormost dorsal ligule expanded (1.5–1.8× longer than ventral ligule); may be greatly expanded (> 2×) |
Type locality | Gulf of Aqaba, Saudi Arabia (Red Sea) | Philippines, Bohol (Pacific) | Naples, western Italy (Mediterranean) | Sicily, Eastern Italy (Mediterranean) |
Reference | This study |
|
|
|
Other species with similar paragnath patterns are Perinereis anderssoni (
Apart from the above-mentioned species, based on WoRMS (https://www.marinespecies.org/;
Comparison between selected characters in the most morphologically similar species to P. kaustiana sp. nov., reported for the Arabian Peninsula and Mediterranean Sea and lacking DNA data.
Characters |
P. iranica |
P. perspicillata Grube, 1878 | P. macropus (Claparède, 1870) | P. floridana (Ehlers, 1868) |
---|---|---|---|---|
Colouration | Creamy with orange pigmentation in anterior body | No data | Greenish; white pigmented dots in prostomium and anterior region (based on the drawings) | No data |
Paragnaths Area I | Cluster of 4–6 paragnaths | Cluster of 6–8 paragnaths | Cluster of 4 paragnaths | 1 large paragnath. |
Paragnaths Area II | 12–15 paragnaths | Cluster of paragnaths | 20–25 paragnaths arranged in wedge shape | Group of paragnaths in three oblique rows |
Paragnaths Area III | Central patch of 30–45 paragnaths, lateral patch absent | Central patch, lateral patch absent | Central patch of 30–35 paragnaths + lateral patches with 4 paragnaths each | Group of very small paragnaths in three parallel rows |
Paragnaths Area IV | 40–47 paragnaths arranged in wedge shape without any bars. | Cluster of very dark paragnaths | 25–27 paragnaths arranged in an inverse triangle | Group of paragnaths in four parallel rows, the last shorter than the others and ending in a cluster in the central corner |
Paragnaths Area V | 5 paragnaths in one row, median one larger than others | Triangle of 3 paragnaths | 5 paragnaths in one row + single middle paragnath on top of the row | 1 large paragnath |
Paragnaths Area VI (a+b) | 2 long, arcuate bars | 2 large transversal bars | 2 slightly arcuate transversal bars | 1 single, broad, flat, somewhat triangular paragnath |
Paragnaths Areas VII and VIII | 3 rows, two distal most rows composed of large paragnaths and proximal row comprising small paragnaths; 25–31 total | Central group with three rows, lateral ones with one row | Band of 50–55 paragnaths | Group of large paragnaths in two distinct rows |
Postero-dorsal Tentacular cirri | Very small, reaching up to chaetiger 2 | No data | Very small, reaching up to chaetiger 2 | Extend back to chaetiger 5 |
Homogomph spiniger serration (neurochaetal supra-acicular fascicle) | No data | No data | No data | No data |
Heterogomph falcigers | Present with short blades | No data | Short blades | Present with short, sickle-shaped blades |
Parapodia | Posteriormost dorsal ligule greatly expanded | No data | Posteriormost dorsal ligule not expanded | No data |
Type locality | Iran (Persian Gulf) | Philippines (Pacific) | Naples, western Italy (Mediterranean) | Caribbean Sea |
Reference |
|
Fauvel 1911; |
|
Wesenberg-Lund 1949; |
1 | Area V, usually a triangle of 3 paragnaths or more | 2 |
– | Area V, a single paragnath or absence | 8 |
2 | Area I, a small cluster of 4–8 paragnaths | 3 |
— | Area I, 1 to 3 paragnaths; if more than 1, arranged in a longitudinal line | 4 |
3 | Area III, cluster of paragnaths, lateral patches absent; Area VI, a large transversal bar | P. perspicillata |
— | Area III, cluster of paragnaths, lateral patches present, 4 paragnaths each; Area VI, a short arcuate bar | P. macropus |
4 | Large paragnath sizes; Area III, lateral patches absent. Short heterogomph falcigers | 5 |
— | Small paragnath sizes; Area III, lateral patches with 1 or 2 paragnaths each. Long heterogomph falcigers | 6 |
5 | Area V, one row of 5 paragnaths, median one larger than others; Area VI, a long clear arcuate bar | P. iranica |
— | Area V, a triangle of 3 paragnaths; Area VI, a short straight bar, may be slightly arcuate | P. cultrifera (complex) |
6 | Area III, lateral patches with 1 paragnath each (may be present only on a single side) | P. rullieri (complex) |
— | Area III, lateral patches with 2 paragnaths each | 7 |
7 | Length of postero-dorsal Tentacular cirri extends back to chaetiger 16 (range 8–16). Dorsal Tentacular cirri subequal to slightly longer than ventral one throughout the body. Posteriormost dorsal ligules expanded. Indo-Pacific variant | P. helleri |
— | Length of postero-dorsal Tentacular cirri extends back to chaetigers 7–9. Dorsal Tentacular cirri of median segments much longer than ventral Tentacular cirri (DCL / VCL = 2.8–3×). Posteriormost dorsal ligules greatly expanded. Red Sea variant | P. kaustiana sp. nov. |
8 | Area V, absence of paragnaths. Homogomph falcigers present; heterogomph falcigers absent | P. tenuisetis |
— | Area V, a single paragnath. Homogomph falcigers absent; heterogomph falcigers usually present |
9 |
9 | Area I, 1 large paragnath | P. floridana |
— | Area I, a small cluster of 3–9 paragnaths | 10 |
10 | Tentacular cirri reaching backwards to chaetiger 1 | P. obfuscata |
— | Tentacular cirri reaching backwards to chaetigers 6 and 7 | P. striolata |
Our molecular data provides compelling evidence for the existence of a new, deeply divergent, and completely sorted species within the Perinereis species Group I in the Red Sea. At first glance, P. kaustiana sp. nov. can be easily misidentified as the well-known and allegedly cosmopolitan P. cultrifera, due to the classic two bar shaped paragnaths in Areas VI and proximity with the Mediterranean Sea. This might be the reason the latter is usually reported for the Red Sea (
The new species is so far unique to the northern Red Sea and apparently easy to find in the rocky beaches of the Gulf of Aqaba. Considering the high rate of endemism in the Red Sea (
Thanks are due to the remaining NEOM bioblitz 2023 expedition Team: Gustav Paulay (Team Leader), Robert Lasley, Diana Noto, Morgan Bennett-Smith, Daisuke Uyeno, Eléfanti Soma, Viktor Peinemann, Matthew David Tietbohl, and the crew of Al Azizi. Thanks are due to the Biodiversity & Ecosystem Management Lab (BEM, at KAUST) Team members: Fern Lyne-Temple, Gloria L. Gil Ramos, Ronald C. Cadiz, Rodrigo Villalobos, Norah Almutairi, João Gabriel Duarte Rosado, and João Cúrdia for helping to organise the sampling campaign. We are also in debt to current and previous members of the NEOM Environmental Authority Department and Education, Research, and Innovation Foundation (ERIF), namely Ameer Eweida, Flor Torres, Ana Manjua, Deborah Colbourne, Abdulqader Khamis, and Vibeke Svensson. Furthermore, we would like to thank the reviewers, including Christopher J. Glasby, the Copy Editor Nathalie Yonow and the Subject Editor Andrew Davinack for the reviewing process of our manuscript.
The authors have declared that no competing interests exist.
Sampling of marine invertebrates followed the Institutional Biosafety and Bioethics Committee (IBEC; reference 22IBEC073) and approved by the Saudi National Committee of Bio-Ethics (NCBE; IBEC Registration Number with NCBE, Kingdom of Saudi Arabia: HAP-02-J-042)
This study was funded by the NEOM research grant #5209 “Biodiversity baseline assessment and monitoring” (RGC/3/5209-01-01) and King Abdullah University of Science and Technology baseline grant to Susana Carvalho (BAS/1/1109-01-01).
Conceptualization: MALT, CJLF, JSV, SC. Data curation: MALT. Formal analysis: MALT. Funding acquisition: SC. Investigation: CJLF, MALT. Methodology: MALT, JSV. Project administration: SC. Resources: SC. Supervision: SC. Visualization: CJLF. Writing – original draft: MALT. Writing – review and editing: JSV, SC, CJLF.
Marcos A. L. Teixeira https://orcid.org/0000-0002-2228-2673
Chloé Julie Loïs Fourreau https://orcid.org/0000-0002-0062-2876
Juan Sempere-Valverde https://orcid.org/0000-0001-5856-9214
Susana Carvalho https://orcid.org/0000-0003-1300-1953
New sequence data and specimen metadata were uploaded in the project “Perinereis Saudi NEOM (DS-MTPNO)” within BOLD (https://v4.boldsystems.org/) and in the following link: https://dx.doi.org/10.5883/DS-MTPNO. The COI alignments (FASTA and NEXUS formats) are publicly available online at Figshare (DOI: https://www.doi.org/10.6084/m9.figshare.25097756). GenBank accession numbers: PP279002–PP279039 (mtCOI- 5P); PP264567–PP264572, PP264574, PP264575 (16S); PP264613, PP264614, PP264616 (28SD2). See Suppl. material
Supplementary data
Data type: xlsx
Explanation note: Voucher data, origin of the specimens and GenBank accession numbers for each of the analysed genetic markers original to this study and molecular metadata used for comparison purposes or as outgroups.