Research Article
Print
Research Article
A new odorous frog species of Odorrana (Amphibia, Anura, Ranidae) from Guizhou Province, China
expand article infoShi-Ze Li‡§, Ji-Jun Chen|, Hai-Jun Su, Jing Liu‡, Xiu-Jun Tang|, Bin Wang§
‡ Moutai Institute, Renhuai, China
§ Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu, China
| Leigongshan National Nature Reserve Administration, Leishan, China
¶ Guizhou University, Guiyang, China

Corresponding author: Xiu-Jun Tang ( tangxiujun1030@126.com )

Corresponding author: Bin Wang ( wangbin@cib.ac.cn )

Academic editor: Angelica Crottini
© 2024 Shi-Ze Li, Ji-Jun Chen, Hai-Jun Su, Jing Liu, Xiu-Jun Tang, Bin Wang.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Li S-Z, Chen J-J, Su H-J, Liu J, Tang X-J, Wang B (2024) A new odorous frog species of Odorrana (Amphibia, Anura, Ranidae) from Guizhou Province, China. ZooKeys 1192: 57-82. https://doi.org/10.3897/zookeys.1192.114315
ZooBank: urn:lsid:zoobank.org:pub:FC0F8160-F924-4006-B2DA-86713FB1252B
Open Access

Abstract

The frog genus Odorrana is distributed across east and southeastern Asia. Based on morphological differences and molecular phylogenetics, a new species of the genus occurring from Leigong Mountain in Guizhou Province, China is described. Phylogenetic analyses based on DNA sequences of the mitochondrial 12S rRNA, 16S rRNA, and ND2 genes supported the new species as an independent lineage. The uncorrected genetic distances between the 12S rRNA, 16S rRNA, and ND2 genes between the new species and its closest congener were 5.0%, 4.9%, and 16.3%, respectively. The new species is distinguished from its congeners by a combination of the following characters: body size moderate (SVL 39.1–49.4 mm in males, 49.7 mm in female); head width larger than head length; tympanum distinctly visible; small rounded granules scattered all over dorsal body and limbs; dorsolateral folds absent; heels overlapping when thighs are positioned at right angles to the body; tibiotarsal articulation reaching the level between eye to nostril when leg stretched forward; vocal sacs absent in male and nuptial pads present on the base of finger I.

Key words

Leigong Mountain, molecular phylogenetic analysis, morphology, new species

Introduction

The odorous frogs of the genus Odorrana Fei, Ye & Huang, 1990 inhabit mountain streams at elevations of about 200–2000 m and can also be found on rocks or branches near the riverbed, ranging from Japan, southern China and Indochina, northeastern India, Myanmar and Thai-Malay Peninsula, Java, Sumatra, and Borneo (Frost 2024). Phylogenetic studies indicate that Odorrana is monophyletic (Chen et al. 2013). The genus currently consists of 65 species (Frost 2024), of which 42 occur in China and 27 species are endemic to China (Fei et al. 2012; Amphibia China 2024; Frost 2024).

Systematic arrangements in this genus have been controversial. Ye and Fei (2001) suggested four species groups (O. andersonii, O. kuangwuensis, O. schmackeri, and O. livida species groups) based on a morphological study. Fei et al. (2005) established two subgenera (Odorrana Fei, Ye & Huang, 1990 and Bamburana Fei, Ye, Huang, Jiang & Xie, 2005) within Odorrana. Molecular phylogenetic studies support the division of species groups within Odorrana but not the two subgenera (Che et al. 2007). Subsequently, Fei et al. (2009) divided the Chinese Odorrana species into six species groups (O. tormota, O. taiwaniana, O. graminea, O. margaretae, O. schmackeri, and O. andersonii species groups). These divisions have been accepted by some researchers (Pham et al. 2016a, b; Li et al. 2018a) but others have rejected the monophyly of the O. margaretae, O. schmackeri, and O. andersonii species groups (Chen et al. 2013). The species diversity in the genus is also indicated as underestimated in these phylogenetic frameworks.

Guizhou Province is one of the areas of the most abundant amphibians in China, and in the last five years a series of new frog species have been described from this region (Frost 2024; Amphibia China 2024). During fieldwork in Leigongshan Nature Reserve, Leishan County, Guizhou Province, China, between March to October 2023, seven Odorrana specimens were collected. Morphologically, these specimens most closely O. huanggangensis Chen, Zhou & Zheng, 2010, and O. wuchuanensis (Xu, 1983), but differs from these two species by the presence of small, rounded granules scattered all over the dorsal body and limbs, and the vocal sacs are absent in the male. To further distinguish these specimens, we conducted phylogenetic analyses based on mitochondrial DNA and morphological comparisons. All analyses consistently indicated that the specimens from Leigongshan Nature Reserve are a new taxon, described herein as a new species.

Materials and methods

Sampling

Seven specimens (♀ n = 1; ♂ n = 6) of the unnamed taxon were collected by hand from Leigongshan Nature Reserve, Guizhou Province, China (Fig. 1) and the field work was approved by the Management Office of the Leigongshan Nature Reserve (project number: P5226002023000019). The Animal Care and Use Committee of Guizhou University provided full approval for this research (Number: EAE-GZU-2022-T115). All specimens were fixed in 10% buffered formalin for 10 h, and then later transferred to 75% ethanol. Tissue samples were preserved separately in 95% prior to fixation. Specimens collected in this work were deposited in Moutai Institute (MT), Guizhou Province, China. In addition, 12 tissue samples containing two Odorrana fengkaiensis Wang, Lau, Yang, Chen, Liu, Pang & Liu, 2015, one O. hainanensis Fei, Ye & Li, 2001, one O. bacboensis (Bain, Lathrop, Murphy, Orlov & Ho, 2003), three O. ichangensis Chen, 2020, and two O. hejiangensis (Deng & Yu, 1992) were used (Table 1).

Table 1.
Download as
CSV
XLSX

Information of samples used in molecular phylogenetic analyses in this study; a slash (/) indicates information absent.

ID Species Locality Voucher number GenBank accession number Citation
12s 16s ND2
1 Odorrana leishanensis sp. nov. Leigongshan Nature Reserve, Leishan, Guizhou, China MT LS20230806010 OR879770 OR879754 OR863727 this study
2 Odorrana leishanensis sp. nov. Leigongshan Nature Reserve, Leishan, Guizhou, China MT LS20230805001 OR879771 OR879755 OR863728 this study
3 Odorrana leishanensis sp. nov. Leigongshan Nature Reserve, Leishan, Guizhou, China MT LS20230811024 OR879772 OR879756 OR863729 this study
4 Odorrana leishanensis sp. nov. Leigongshan Nature Reserve, Leishan, Guizhou, China MT LS20230729013 OR879773 OR879757 OR863730 this study
5 Odorrana leishanensis sp. nov. Leigongshan Nature Reserve, Leishan, Guizhou, China MT LS20230806018 OR879774 OR879758 OR863731 this study
6 Odorrana leishanensis sp. nov. Leigongshan Nature Reserve, Leishan, Guizhou, China MT LS20230711020 OR879775 OR879759 OR863732 this study
7 Odorrana leishanensis sp. nov. Leigongshan Nature Reserve, Leishan, Guizhou, China MT LS20230717001 OR879776 OR879760 OR863733 this study
8 Odorrana fengkaiensis Heishiding Nature Reserve, Fengkai, Guangdong, China SYS a002262 KT315354 KT315375 OR863743 Wang et al. 2015; this study
9 Odorrana fengkaiensis Heishiding Nature Reserve, Fengkai, Guangdong, China SYS a002263 KT315355 KT315376 OR863744 Wang et al. 2015; this study
10 Odorrana fengkaiensis Heishiding Nature Reserve, Fengkai, Guangdong, China SYS a002273 KT315356 KT315377 / Wang et al. 2015
11 Odorrana hainanensis Wuzhishan city, Hainan, China HNNU0606105 KF184996 KF185032 / Wang et al. 2015
12 Odorrana hainanensis Diaoluoshan Forest Park, Lingshui, Hainan, China SYS a002260 KT315362 KT315383 OR863741 this study
13 Odorrana bacboensis Bainan village, Napo, Guangxi, China SYS a001046 KT315364 KT315385 OR863742 this study
14 Odorrana bacboensis Khe Moi, Nghe An,Vietnam ROM 13044 AF206099 DQ650569 / Chen et al. 2005
15 Odorrana bacboensis Hekou, Yunnan, China HNNU HK001 KF185008 KF185044 / Chen et al. 2013
16 Odorrana schmackeri Songtao, Guizhou, China MT ST20210622001 OR879782 OR879768 OR863745 this study
17 Odorrana schmackeri Yichang City, Hubei, China HNNU0908II349 KF185011 KF185047 / Chen et al. 2013
18 Odorrana schmackeri Songtao, Guizhou, China MT ST20210622002 OR879782 OR879769 OR863746 this study
19 Odorrana kweichowensis Lengshuihe Nature Reserve, Jinsha, Guizhou, China CIBjs20150803008 MH193538 MH193552 MH193606 Li et al. 2018
20 Odorrana kweichowensis Lengshuihe Nature Reserve, Jinsha, Guizhou, China CIBjs20171014001 MH193539 MH193551 MH193605 Li et al. 2018
21 Odorrana sangzhiensis Sangzhi, Hunan, China CSUFT 4308220046 MW465705 MW464864 / Zhang et al. 2021
22 Odorrana sangzhiensis Sangzhi, Hunan, China CSUFT 4308220051 MW465701 MW464865 / Zhang et al. 2021
23 Odorrana sangzhiensis Sangzhi, Hunan, China CSUFT 4308220048 MW465702 MW464861 / Zhang et al. 2021
24 Odorrana ichangensis Zhijin, Guizhou, China MT ZJ20210814003 / OR879766 OR863739 this study
25 Odorrana ichangensis Zhijin, Guizhou, China MT ZJ20210814004 / OR879767 OR863740 this study
26 Odorrana ichangensis Yichang City, Hubei, China SYS a005475 OR879781 OR879765 OR863738 this study
27 Odorrana hejiangensis Chishui, Guizhou, China MT CS20200605007 OR879779 OR879763 OR863736 this study
28 Odorrana hejiangensis Chishui, Guizhou, China MT CS20200605008 OR879780 OR879764 OR863737 this study
29 Odorrana hejiangensis Hejiang, Sichuan, China HNNU1007I202 KF185016 KF185052 / Chen et al. 2013
30 Odorrana tianmuii Lin’an, Zhejiang, China HNNU707071 KF185004 KF185040 / Chen et al. 2013
31 Odorrana tianmuii Lin’an, Zhejiang, China SYS a002680 OR879777 OR879761 OR863734 this study
32 Odorrana tianmuii Lin’an, Zhejiang, China SYS a002681 OR879778 OR879762 OR863735 this study
33 Odorrana huanggangensis Fanjingshan Nature Reserve, Jiangkou, Guizhou, China CIBFJS20150502002 MH193532 MH193565 MH193614 Li et al. 2018
34 Odorrana huanggangensis Leigongshan Nature Reserve, Leishan, Guizhou, China CIBLS20140818005 MH193530 MH193564 MH193612 Li et al. 2018
35 Odorrana huanggangensis Wuyishan Nature Reserve, Fujian, China HNNU0607001 KF185023 KF185059 / Chen et al. 2013
36 Odorrana versabilis Leigongshan Nature Reserve, Leishan, Guizhou, China HNNU003 KF185019 KF185055 / Chen et al. 2013
37 Odorrana nasuta Wuzhishan, Hainan, China HNNU051119 KF185017 KF185053 / Chen et al. 2013
38 Odorrana exiliversabilis Wuyishan, Fujian, China HNNU0607032 KF185020 KF185056 / Chen et al. 2013
39 Odorrana yentuensis Guangxi, China NHMG1401035 MH665669 MH665675 / Mo et al. 2015
40 Odorrana nasica HaTinh, Vietnam AMNH A161169 DQ283345 DQ283345 / Frost et al. 2006
41 Odorrana tormota Huangshan, Anhui, China AM04005 DQ835616 DQ835616 DQ835616 Su et al. 2007
42 Odorrana narina Okinawa Island, Japan / AB511287 AB511287 AB600990 Kurabayashi et al. 2010
43 Odorrana amamiensis Tokunoshima, Ryukyu, Japan KUHE:24635 AB200923 AB200947 AB600991 Matsui et al. 2006
44 Odorrana supranarina Iriomotejima, Ryukyu KUHE:12898 AB200926 AB200950 / Matsui et al. 2006
45 Odorrana swinhoana Nantou, Taiwan, China HNNUTW9 KF185010 KF185046 / Chen et al. 2013
46 Odorrana utsunomiyaorum Iriomotejima, Ryukyu KUHE:12896 AB200928 AB200952 / Matsui et al. 2006
47 Odorrana hosii Kuala Lumpur, Malaysia IABHU 21004 AB511284 AB511284 / Kurabayashi et al. 2010
48 Odorrana graminea Wuzhishan, Hainan, China HNNU0606123 KF185002 KF185038 / Chen et al. 2013
49 Odorrana chloronota Ha Giang, Vietnam AMNH A163935 DQ283394 DQ283394 / Frost et al. 2006
50 Odorrana livida Prachuap Kirikhan, Thailand FMNH 263415 KF771294 DQ650613 DQ650546 Stuart et al. 2006b
51 Odorrana leporipes Shaoguan, Guangdong, China HNNU1008I099 KF185000 KF185036 / Chen et al. 2013
52 Odorrana aureola Phu Rua, Loei, Thailand FMNH 265919 / DQ650564 DQ650500 Stuart et al. 2006
53 Odorrana morafkai Tram Lap, Vietnam ROM 7446 AF206103 AF206484 / Chen et al. 2005
54 Odorrana banaorum Tram Lap, Vietnam ROM 7472 AF206106 AF206487 / Chen et al. 2005
55 Odorrana junlianensis Junlian, Sichuan, China HNNU002JL KF185022 KF185058 / Chen et al. 2013
56 Odorrana grahami Kunming, Yunnan, China HNNU1008II016 KF185015 KF185051 / Chen et al. 2013
57 Odorrana hmongorum Lao Cai, Vietnam ROM 38605 / EU861556 EU861585 Bain et al. 2009
58 Odorrana daorum Sa Pa, Vietnam ROM 19053 AF206101 AF206482 / Chen et al. 2005
59 Odorrana andersonii Longchuan County, Yunnan, China HNNU001YN KF185021 KF185057 / Chen et al. 2013
60 Odorrana jingdongensis Jingdong, Yunnan, China 20070711017 KF185014 KF185050 / Chen et al. 2013
61 Odorrana margaretae Mt. Emei, Sichuan, China HNNU20050032 KF184999 KF185035 / Chen et al. 2013
62 Odorrana kuangwuensis Nanjiang, Sichuan, China HNNU0908II185 KF184998 KF185034 / Chen et al. 2013
63 Odorrana dulongensis Dulongjiang, Yunnan, China KIZ035027 / MW128102 / Liu et al. 2021
64 Odorrana wuchuanensis Maolan National Nature Reserve, Libo County, Guizhou, China GZNU20180608018 MW481342 MW481353 MW481364 Luo et al. 2021
65 Odorrana wuchuanensis Wuchuan, Guizhou Prov., China HNNU019L KF185007 KF185043 / Chen et al. 2013
66 Odorrana mutschmanni Cao Bang, Vietnam IEBR 3725 KU356762 KU356766 / Pham et al. 2016b
67 Odorrana yizhangensis Nanling Nature Reserve, Ruyuan County, Guangdong, China CIBHN201108149 MH193540 MH193560 MH193615 Li et al. 2018
68 Odorrana yizhangensis Yizhang, Hunan HNNU1008I075 KF185012 KF185048 / Chen et al. 2013
69 Odorrana lungshengensis Longsheng, Guangxi HNNU70028 KF185018 KF185054 / Chen et al. 2013
70 Odorrana lungshengensis Leigongshan Nature Reserve, Leishan, Guizhou, China. CIBLS20140616006 MH193534 MH193554 MH193608 Li et al. 2018
71 Odorrana anlungensis Anlong, Guizhou, China HNNU1008I109 KF185013 KF185049 / Chen et al. 2013
72 Odorrana chapaensis Lai Chau, Vietnam AMNH A161439 DQ283372 DQ283372 / Frost et al. 2006
73 Odorrana geminata Ha Giang, Vietnam AMNH 163782 / EU861546 EU861572 Bain et al. 2009
74 Odorrana ishikawae Amami Island, Japan IABHU 5275 AB511282 AB511282 AB511282 Kurabayashi et al. 2010
75 Odorrana absita Xe Kong, Laos FMNH 258107 / EU861542 EU861568 Bain et al. 2009
76 Odorrana liboensis Maolan National Nature Reserve, Libo, Guizhou, China GZNU20180608007 MW481339 MW481350 / Luo et al. 2021
77 Odorrana lipuensis Lipu, Guangxi, China NHMG1303018 MH665670 MH665676 / Mo et al. 2015
78 Odorrana concelata Longlinchang Village, Qingyuan, Guangdong,China GEP a050 OP137167 OP137161 / Lin et al. 2022
79 Babina adenopleura / A-A-WZ001 NC_018771 NC_018771 NC_018771 Yu et al. 2012
80 Nidirana daunchina Emeishan, Sichuan, China HNNU20060103 KF185029 KF185065 / Chen et al. 2013
81 Amolops loloensis Shimian, Sichuan, China SM-ZDTW-01 NC_029250 NC_029250 NC_029250 Xue et al. 2016
82 Amolops ricketti Wugongshan, Jiangxi, China AM13988 NC_023949 NC_023949 NC_023949 Li et al. 2016
83 Glandirana tientaiensis Huangshan, Anhui, China SCUM0405192CJ KX269222 KX269222 KX269435 Yuan et al. 2016
84 Sylvirana guentheri Fuzhou City, Fujian, China SCUM-H002CJ KX269219 KX269219 / Yuan et al. 2016
85 Pelophylax nigromaculata Hongya, Sichuan, China SCUM045199CJ KX269216 KX269216 KX269431 Yuan et al. 2016
86 Rana weiningensis Weining County, Guizhou, China SCUM0405171 KX269217 KX269217 KX269432 Yuan et al. 2016
Figure 1. 

Geographical location of the type locality of Odorrana leishanensis sp. nov., Leigongshan Nature Reserve, Leishan County, Guizhou Province, China.

Molecular data and phylogenetic analyses

DNA was extracted from muscle tissue using a DNA extraction kit from Tiangen Biotech Co., Ltd. (Beijing). All samples were sequenced for three mitochondrial genes, partial 12S ribosomal RNA gene (12S rRNA), 16S ribosomal RNA gene (16S rRNA), and NADH dehydrogenase subunit 2 (ND2). The primers used for 12S rRNA were P1 (5’- CCAGGCTTTACACTTTATGC -3’) and P2 (5’- GCGATTAAGTTGGGTAACGC -3’) following Kocher et al. (1989); for 12S rRNA were P7 (5’- CGCCTGTTTACCAAAAACAT -3’) and P8 (5’- CCGGTCTGAACTCAGATCACGT’) following Simon et al. (1994); and for ND2 were Gln-LND2 (5’-CCCTTTGCACTTCCTTTATGC-3’) and Ala-HND2 (5’-GGCCTGAGTTGCATTCATG-3’) following Li et al. (2015). PCR amplification reactions were performed in a 30 μl volume contains 1× High-Fidelity Master Mix (Chengdu TSINGKE Biological Technology Co. Ltd.) 15 μl, ddH2O 10 μl, 0.5 μM Forward primer 2 μl, 0.5 μM Revers primer 2 μl and 4.25 μg/μl DNA 1 μl, reaction with the following cycling conditions: an initial denaturing step at 95 °C for 4 min; 36 cycles of denaturing at 95 °C for 40 s, annealing at 47 °C (for ND2)/57 °C (for 12S and 16S) for 40 s and extending at 72 °C for 70 s, and a final extending step of 72 °C for 10 min. PCR products were purified with spin columns and then were sequenced with both forward and reverse primers, same as for the PCR. Sequencing was conducted using an ABI Prism 3730 automated DNA sequencer in Chengdu TSINGKE Biological Technology Co. Ltd. (Chengdu, China). All sequences were deposited in GenBank (see Table 1 for GenBank accession numbers). For phylogenetic analyses and genetic divergence analyses, we downloaded available corresponding sequence data for all related species from GenBank according to previous studies (Chen et al 2013; Li et al 2018a; for GenBank accession no. refer to Table 1).

86 Sequences were assembled and aligned using the Clustalw module in BioEdit v. 7.0.9.0 (Hall 1999) with default settings. The datasets were checked by eye and revised manually if necessary. Based on the 12S rRNA, 16S rRNA, ND2, and 12S rRNA +16S rRNA + ND2 concatenated dataset, phylogenetic analyses were conducted using maximum likelihood (ML) and Bayesian inference (BI) methods, implemented in PhyML 3.0 (Guindon et al. 2010) and MrBayes 3.12 (Ronquist and Huelsenbeck 2003), respectively, and the best-fit model was obtained by the Bayesian inference criteria (BIC) computed with PartitionFinder 2 (Lanfear et al. 2012). The analysis suggested that the best partition scheme was 12S rRNA/16S rRNA/ND2 genes. We selected GTR+R as the best model for 12S rRNA and 16S rRNA and the TN93 + I + G as the best model for the ND2 gene. For ML analyses conducted in PhyML 3.0, the bootstrap consensus tree inferred from 1000 replicates was used to estimate nodal supports of inferred relationships on phylogenetic trees. For Bayesian analyses conducted in MrBayes 3.12, four Markov chains were run for 50 million generations with sampling every 1000 generations until the trees reach convergence (split frequency < 0.05). The first 25% of trees were removed as the “burn-in” stage followed by calculation of Bayesian posterior probabilities and the 50% majority-rule consensus of the post burn-in trees sampled at stationarity. Finally, uncorrected p-distances (1000 replicates) between species based on 12S rRNA (45 species), 16S rRNA (51 species), and ND2 (23 species) were calculated in MEGA 6.06 (Tamura et al. 2013).

Morphological comparisons

Morphological measurements were made with dial calipers to nearest 0.1 mm (Wenzhou Weidu Electronics Co. Ltd., China). Twenty morphometric characters of 76 adults specimens were measured containing seven specimens of the undescribed taxon, 15 Odorrana hejiangensis, eight O. huanggangensis, 13 O. ichangensis, nine O. kweichowensis Li, Xu, Lv, Jiang, Wei & Wang, 2018, ten O. schmackeri (Boettger, 1892), and 14 O. wuchuanensis following Fei et al. (2009) and Li et al. (2018a), abbreviated as follows:

ED eye diameter (distance from the anterior corner to the posterior corner of the eye);

FL foot length (distance from tarsus to the tip of fourth toe);

HDL head length (distance from the tip of the snout to the articulation of jaw);

HDW maximum head width (greatest width between the left and right articulations of jaw);

HLL hindlimb length (maximum length from the vent to the distal tip of the Toe IV);

IND internasal distance (minimum distance between the inner margins of the external nares);

IOD interorbital distance (minimum distance between the inner edges of the upper eyelids);

LAL length of lower arm and hand (distance from the elbow to the distal end of the Finger IV);

ML manus length (distance from tip of third digit to proximal edge of inner palmar tubercle);

NED nasal to eye distance (distance between the nasal and the anterior corner of the eye);

NSD nasal to snout distance (distance between the nasal the posterior edge of the vent);

LW lower arm width (maximum width of the lower arm);

SVL snout-vent length (distance from the tip of the snout to the posterior edge of the vent);

SL snout length (distance from the tip of the snout to the anterior corner of the eye);

TFL length of foot and tarsus (distance from the tibiotarsal articulation to the distal end of the Toe IV);

THL thigh length (distance from vent to knee);

TL tibia length (distance from knee to tarsus);

TW maximal tibia width;

TYD maximal tympanum diameter;

UEW upper eyelid width (greatest width of the upper eyelid margins measured perpendicular to the anterior-posterior axis).

To reduce the impact of allometry, a size-corrected value from the ratio of each character to SVL was calculated for the following morphometric analyses. Principal component analysis (PCA) of size-corrected variables and simple bivariate scatterplots was used to explore and reflect the morphometric differences between the undescribed taxon and the phylogenetic relationships closely and sympatric species contains Odorrana hejiangensis, O. huanggangensis, O. ichangensis, O. kweichowensis, O. schmackeri, and O. wuchuanensis. One-way analysis of variance (ANOVA) was used to test the significance of differences on morphometric characters between the undescribed taxon and O. hejiangensis, O. huanggangensis, O. ichangensis, O. kweichowensis, O. schmackeri, and O. wuchuanensis in the males. The statistical analyses were performed using SPSS 21.0 (SPSS, Inc., Chicago. IL, USA), and differences were considered to be significant at p < 0.05.

Sex was determined by direct observation of calling behavior and the presence of internal vocal sac openings for males, as well as the presence of eggs on the abdomen for females. The presence or absence of nuptial pads/spines was examined by optical microscopy.

We compared the morphological characters of the undescribed taxon with other species of Odorrana. Comparative data were obtained from the literature for 65 species of Odorrana (all of the authorities of the 65 species were shown in Table 2). For comparison, we examined the type and/or topotype materials for O. hejiangensis, O. huanggangensis, O. ichangensis, O. kweichowensis, O. schmackeri, and O. wuchuanensis (Suppl. material 1).

Table 2.
Download as
CSV
XLSX

References for morphological characters for congeners of the genus Odorrana.

ID Odorrana species Citation
1 O. absita (Stuart & Chan-ard, 2005) Stuart and Chan-ard 2005
2 O. amamiensis (Matsui, 1994) Matsui 1994
3 O. andersonii (Boulenger, 1882) Boulenger 1882
4 O. anlungensis (Liu & Hu, 1973) Hu et al. 1973
5 O. arunachalensis Saikia, Sinha & Kharkongor, 2017 Saikia et al. 2017
6 O. aureola Stuart, Chuaynkern, Chan-ard & Inger, 2006 Stuart et al. 2006a
7 O. bacboensis (Bain, Lathrop, Murphy, Orlov & Ho, 2003) Bain et al. 2003; Wang et al. 2015
8 O. banaorum (Bain, Lathrop, Murphy, Orlov & Ho, 2003) Bain et al. 2003
9 O. bolavensis (Stuart & Bain, 2005) Stuart and Bain 2005
10 O. cangyuanensis (Yang, 2008) Yang 2008
11 O. chapaensis (Bourret, 1937) Bourret 1937
12 O. chloronota (Günther, 1876) Günther 1876; Che et al. 2020
13 O. concelata Wang, Zeng & Lin, 2022 Lin et al. 2022
14 O. confusa Song, Zhang, Qi, Lyu, Zeng & Wang, 2023 Song et al. 2023
15 O. damingshanensis Chen, Mo, Lin & Qin, 2024 Chen et al. 2024
16 O. dulongensis Liu, Che & Yuan, 2021 Liu et al. 2021
17 O. exiliversabilis Li, Ye & Fei, 2001 Fei et al. 2001b
18 O. fengkaiensis Wang, Lau, Yang, Chen, Liu, Pang & Liu, 2015 Wang et al. 2015
19 O. geminata Bain, Stuart, Nguyen, Che & Rao, 2009 Bain et al. 2009
20 O. gigatympana (Orlov, Ananjeva & Ho, 2006) Orlov et al. 2006
21 O. grahami (Boulenger, 1917) Boulenger 1917
22 O. graminea (Boulenger, 1900) Boulenger 1900
23 O. hainanensis Fei, Ye & Li, 2001 Fei et al. 2001a
24 O. heatwolei (Stuart & Bain, 2005) Stuart and Bain 2005
25 O. hosii (Boulenger, 1891) Boulenger 1891
26 O. hejiangensis (Deng & Yu, 1992) Deng and Yu 1992
27 O. huanggangensis Chen, Zhou & Zheng, 2010 Chen et al. 2010a
28 O. ichangensis Chen, 2020 Shen et al. 2020
29 O. ishikawae (Stejneger, 1901) Stejneger 1901
30 O. indeprensa (Bain & Stuart, 2006) Bain and Stuart 2006
31 O. jingdongensis Fei, Ye & Li, 2001 Fei et al. 2001a
32 O. junlianensis Huang, Fei & Ye, 2001 Ye and Fei 2001
33 O. khalam (Stuart, Orlov & Chan-ard, 2005) Stuart and Chan-ard 2005
34 O. kuangwuensis (Liu & Hu, 1966) Hu et al. 1966
35 O. kweichowensis Li, Xu, Lv, Jiang, Wei & Wang, 2018 Li et al. 2018
36 O. livida (Blyth, 1856) Blyth 1856
37 O. liboensis Luo, Wang, Xiao, Wang & Zhou, 2021 Luo et al. 2021
38 O. lipuensis Mo, Chen, Wu, Zhang & Zhou, 2015 Mo et al. 2015; Pham et al. 2016a
39 O. leporipes (Werner, 1930) Werner 1930
40 O. lungshengensis (Liu & Hu, 1962) Liu and Hu 1962
41 O. macrotympana (Yang, 2008) Yang 2008
42 O. margaretae (Liu, 1950) Liu 1950
43 O. mawphlangensis (Pillai & Chanda, 1977) Pillai and Chanda 1977; Mahony 2008
44 O. mutschmanni Pham, Nguyen, Le, Bonkowski & Ziegler, 2016 Pham et al. 2016a
45 O. monjerai (Matsui & Jaafar, 2006) Matsui and Jaafar 2006
46 O. morafkai (Bain, Lathrop, Murphy, Orlov & Ho, 2003) Bain et al. 2003
47 O. nasica (Boulenger, 1903) Boulenger 1903
48 O. nasuta Li, Ye & Fei, 2001 Fei et al. 2001b
49 O. narina (Stejneger, 1901) Stejneger 1901
50 O. nanjiangensis Fei, Ye, Xie & Jiang, 2007 Fei et al. 2007a
51 O. orba (Stuart & Bain, 2005) Stuart and Bain 2005
52 O. sangzhiensis Zhang, Li, Hu & Yang, 2021 Zhang et al. 2021
53 O. schmackeri (Boettger, 1892) Boettger (1892); Shen et al. (2020)
54 O. sinica (Ahl, 1927) Ahl 1927 “1925”; Bain et al. 2003
55 O. swinhoana (Boulenger, 1903) Boulenger 1903
56 O. supranarina (Matsui, 1994) Matsui 1994
57 O. splendida Kuramoto, Satou, Oumi, Kurabayashi & Sumida, 2011 Kuramoto et al. 2011
58 O. tianmuii Chen, Zhou & Zheng, 2010 Chen et al. 2010b
59 O. tiannanensis (Yang & Li, 1980) Yang and Li 1980
60 O. tormota (Wu, 1977) Wu 1977
61 O. utsunomiyaorum (Matsui, 1994) Matsui 1994
62 O. versabilis (Liu & Hu, 1962) Liu and Hu 1962
63 O. wuchuanensis (Xu, 1983) Wu et al. 1983
64 O. yentuensis Tran, Orlov & Nguyen, 2008 Tran et al. 2008; Lu et al. 2016
65 O. yizhangensis Fei, Ye & Jiang, 2007 Fei et al. 2007b

Results

Phylogenetic analyses

The ML and BI phylogenetic trees were constructed based on 12S rRNA (400 bp), 16S rRNA (484 bp), ND2 (915 bp), and 12S rRNA +16S rRNA + ND2 concatenated dataset. Both the independent dataset and concatenated dataset of ML and BI analyses resulted in essentially identical topologies with high node supporting values. The specimens of the undescribed taxon were clustered into an independent clade, sharing a sister relationship with the clade containing Odorrana schmackeri, O. kweichowensis, O. fengkaiensis, O. hainanensis, O. bacboensis, O. ichangensis, O. hejiangensis, O. tianmuii Chen, Zhou & Zheng, 2010, and O. huanggangensis with high node support values (0.99 in BI and 78% in ML, Fig. 2; 0.98 in BI and 92% in ML, Suppl. material 5; 0. 80 in BI and 50% in ML, Suppl. material 6; 0.99 in BI and 70% in ML, Suppl. material 7).

Figure 2. 

Maximum likelihood (ML) tree of the genus Odorrana reconstructed based on the 12S rRNA, 16S rRNA, and ND2 gene sequences. ML bootstrap supports (BS)/Bayesian posterior probability (BPP) are denoted beside each node, and “-” denotes BS < 50% or BPP < 0.60. Samples 1–86 refer to those listed in Table 1.

The mean genetic distance between the undescribed taxon and its closely related species is 5.0%, 4.9%, and 16.3% on 12S, 16S, and ND2, respectively, much higher than that between many pairs of species in the genus Odorrana (Suppl. materials 2–4).

Morphological analyses

The results of ANOVA indicated that in male, the undescribed taxon was significantly different from Odorrana hejiangensis, O. huanggangensis, O. ichangensis, O. kweichowensis, O. schmackeri, and O. wuchuanensis in many morphometric characters (all P values < 0.05; Table 3). In PCA for males, the total variation of the first two principal components was 43.3%, on the two-dimensional plots of PC1 vs PC2, the undescribed taxon could be separated from O. hejiangensis, O. huanggangensis, O. ichangensis, O. kweichowensis, O. schmackeri, and O. wuchuanensis (Fig. 3). Detailed morphological comparisons revealed discrete diagnostic characters between the undescribed taxon and its congeners. Therefore, adopt integrative taxonomy approaches with evidence from molecular and morphology to take the decision to describe the unidentified taxon as new species described herein.

Table 3.
Download as
CSV
XLSX

The results of the one-way ANOVA with P-values for morphometric comparisons between males of Odorrana leishanensis sp. nov., O. hejiangensis, O. huanggangensis, O. ichangensis, O. kweichowensis, O. schmackeri, and O. wuchuanensis.

OL vs OHG OL vs OHJ OL vs OI OL vs OK OL vs OS OL vs OW
SVL 0.841 0.000** 0.006** 0.193 0.193 0.000**
HDL 0.001** 0.020* 0.000** 0.003** 0.003** 0.001**
HDW 0.643 0.967 0.599 0.469 0.469 0.000**
SL 0.192 0.577 0.044* 0.495 0.495 0.011*
NED 0.364 0.313 0.185 0.394 0.394 0.094
NSD 0.002** 0.067 0.011* 0.145 0.145 0.002**
IND 0.054 0.000** 0.000** 0.000** 0.000** 0.157
ED 0.005** 0.015* 0.067 0.015* 0.015* 0.128
IOD 0.164 0.002** 0.586 0.016* 0.016* 0.409
UEW 0.006** 0.018* 0.223 0.009** 0.009** 0.934
TYD 0.000** 0.000** 0.000** 0.000** 0.000** 0.000**
LAL 0.016* 0.007** 0.000** 0.001** 0.001** 0.000**
LW 0.163 0.000** 0.007** 0.001** 0.001** 0.009**
ML 0.801 0.237 0.000** 0.029* 0.029* 0.852
HLL 0.197 0.022* 0.001** 0.230 0.230 0.660
THL 0.406 0.021* 0.020* 0.745 0.745 0.450
TL 0.524 0.224 0.283 0.173 0.173 0.049*
TW 0.272 0.000** 0.005** 0.036* 0.036* 0.414
FL 0.003** 0.007** 0.036* 0.025* 0.025* 0.001**
TFL 0.505 0.812 0.343 0.583 0.583 0.622

Notes: OL, Odorrana leishanensis sp. nov.; OHG, O. huanggangensis; OHJ, O. hejiangensis; OI, O. ichangensis; OK, O. kweichowensis; OS, O. schmackeri; OW, O. wuchuanensis. Significance level: * p < 0.05; ** p < 0.01. Abbreviations for the morphometric characters refer to Materials and methods section.
Figure 3. 

Plots of the first principal component (PC1) versus the second (PC 2) for Odorrana leishanensis sp. nov., O. hejiangensis, O. huanggangensis, O. ichangensis, O. kweichowensis, O. schmackeri, and O. wuchuanensis in males from a principal component analysis.

Taxonomic accounts

Odorrana leishanensis sp. nov.

https://zoobank.org/D51EC9FE-C269-4189-9815-AB65D3FBE0B6
Figs 4, 5, 6

Material examined

Holotype. MT LS20230729013, adult male, collected by Jing Liu on 29 July 2023 in the Leigongshan Nature Reserve (26.3833°N, 108.1967°E; elevation 1830 m a.s.l.), Leishan County, Guizhou Province, China. Paratype. Two males MT LS20230711020 and MT LS20230717001, collected by Jing Liu on 11 and 17 July 2023; one male MT LS20230805001 collected by Chaobo Feng on 5 August 2023; two males MT LS20230806010, MT LS20230806018 and one female MT LS20230811024 collected by Shize Li on 6 and 8 August 2023 from the same place as holotype.

Diagnosis

Odorrana leishanensis sp. nov. can be distinguished from its congeners by the following characters: (1) body size moderate (SVL♂ (n = 6) = 39.1–49.4 mm, SVL♀ (n = 1) = 49.7 mm in female); (2) head width larger than head length; (3) tympanum distinctly visible; (4) small rounded granules scattered all over dorsal body and limbs; (5) dorsolateral folds absent; (6) heels overlapping when thighs are positioned at right angles to the body; tibiotarsal articulation reaching the level between eye to nostril when leg stretched forward; (7) vocal sacs in male absent, and nuptial pads in male present on base of finger I.

Description of holotype

(Figs 4, 5). Adult male, body size moderate (SVL 49.4 mm); head width larger than head length (HDW/HDL = 1.14); snout short, rounded in dorsal view, projecting beyond lower jaw; eye large and convex, ED 0.73 SL; nostril rounded, closer to tip of snout than to eye; internasal distance larger than interorbital distance; tympanum distinct, approximately 0.68 ED; vomerine teeth on well-developed ridges; tongue deeply notched posteriorly; pupil horizontally oval; vocal sac absent.

Figure 4. 

Photographs of the holotype MTLS20230729013 of Odorrana leishanensis sp. nov. in life A dorsal view B ventral view C dorsal view of hand D ventral view of hand E ventral view of foot.

Figure 5. 

The holotype specimen MTLS20230729013 of Odorrana leishanensis sp. nov. (preserved) in A dorsal view B ventral view C lateral view D dorsal view of hand E ventral view of hand F ventral view of foot.

Forelimbs slender (LW/SVL = 0.09); lower arm and hand not reach one-second of body length (LAL/SVL = 0.42); fingers slender, relative finger lengths II < I < IV < III; finger tips on I–IV dilated to wide cordiform disks with circum-marginal grooves, without webbing and lateral fringes; subarticular tubercle prominent; supernumerary tubercle indistinct; inner metacarpal tubercle oval, elongate; outer metacarpal tubercles absent; light yellow glandular nuptial pad on finger I.

Hindlimbs long; tibio-tarsal articulation reaching between eye to nostril when hindlimb adpressed along the side of the body; heels overlapped; tibia longer than thigh length; toes slender, relative lengths I < II < III < V < IV; toes entirely webbed; tips of toes expanded into disc with circummarginal grooves; outer metatarsal tubercle absent; inner metatarsal tubercle present.

Dorsal rough, there are small, rounded granules scattered all over dorsal body and limbs, ventral surfaces of the head, body, and limbs smooth; weak supratympanic fold from the posterior edge of the eye to the posterior edge of the tympanum; dorsolateral folds absent.

Coloration of holotype in life

(Fig. 4). Dorsum grass-green with a small amount of brown spots; flanks pale yellow with several black spots; dorsal surfaces of anterior forelimbs pale yellow, anterior forelimbs olive-brown, with black bands and irregular grass-green spots; dorsal surfaces of hindlimbs grass-green with black bands; upper jaw with a ring of brown spots; lower jaw yellow with black spots; grass-green and black spotted mosaic on the loreal region; tympanum brown-black; ventral surface of throat and chest brown, belly pale yellow.

Coloration of holotype in preservation

(Fig. 5). After three months in 75% ethanol, the dorsal surface of the body faded to dark olive; the dorsal surface of the head changed to darker; the transverse bands on limbs and digits were not distinct; ventral surface of throat brown, gradually dark brown on chest, the belly was pale yellow; palm color faded to white.

Variation

Morphological measurements of all specimens are presented in Table 4 and Suppl. material 1. All specimens were very similar in morphology and color pattern, but in MT LS20230805001 the skin from the corner of the eye to the base of the thigh was noticeably pale brown with green patches mixed in and the flank of the ventral surface was white with dark brown spots (Fig. 6A, B); in MT LS20230806010 the dorsum was green and the ventral surface of the throat and chest darker (Fig. 6C, D); in MT LS20230811024 the granulation on the dorsolateral surface was covered with black spots and the ventral surface of the throat and chest were white with darker spots (Fig. 6E, F).

Table 4.
Download as
CSV
XLSX

Measurements of the adult specimens of Odorrana leishanensis sp. nov. Units are given in mm. See abbreviations for the morphological characters in Materials and methods section.

Character Holotype Males (n = 6) Female (n = 1)
Range Mean ± SD
SVL 49.43 39.1–49.4 42.3 ± 4.0 49.7
HDL 15.13 11.6–17.8 13.7 ± 2.2 17.2
HDW 17.23 13.3–17.2 14.6 ± 1.4 17.7
SL 6.73 5.6–6.7 6.2 ± 0.5 7.7
NED 3.57 2.4–3.6 3.2 ± 0.4 4.1
NSD 2.92 1.6–2.9 2.4 ± 0.5 3.4
IND 6.02 4.8–6.0 5.3 ± 0.5 6.3
ED 4.94 4.1–4.9 4.5 ± 0.3 5.8
IOD 3.76 3.4–4.4 4.0 ± 0.3 5.1
UEW 4.04 2.9–4.0 3.4 ± 0.4 4.8
TYD 3.36 2.3–3.4 2.5 ± 0.4 2.5
LAL 20.52 17.4–20.5 18.7 ± 1.2 24.6
LW 4.38 2.9–4.4 3.3 ± 0.6 4.7
ML 12.19 10.5–12.2 11.3 ± 0.6 14.9
HLL 82.28 67.8–82.3 72.3 ± 5.2 87.3
THL 24.57 19.9–24.6 21.2 ± 1.7 28.3
TL 27.65 22.8–27.7 24.5 ± 1.75 29.7
TW 5.77 3.5–5.8 4.4 ± 0.7 6.9
TFL 38.43 31.3–38.4 33.8 ± 2.6 39.6
FL 26.66 22.7–26.7 23.9 ± 1.5 28.2
Figure 6. 

Color variation in Odorrana leishanensis sp. nov. A dorsolateral view of the male specimen MTLS20230805001 B ventral view of the male specimen MTLS20230805001 C dorsolateral view of the male specimen LS20230806010 D ventral view of the male specimen MTLS20230806010 E dorsolateral view of the female specimen LS20230811024 F ventral view of the female specimen MTLS20230811024.

Secondary sexual characters

Adult females slightly larger than adult males; adult males lack vocal sacs. During breeding season, pale yellow glandular nuptial pads in males present on finger I (Figs 4C, 5D).

Comparisons

The molecular phylogenetic analyses placed the new species in an independent clade and sharing a sister relationship with the clade composed of O. schmackeri, O. kweichowensis, O. fengkaiensis, O. hainanensis, O. bacboensis, O. ichangensis, O. hejiangensis, O. tianmuii, and O. huanggangensis. Odorrana leishanensis sp. nov. differs from the aforementioned species by having a similar body size in males and females, SVL♂ = 39.1–49.4 mm, ♀ = 49.7 mm) (vs female size larger than males); vocal sac in males absent (vs present).

Odorrana leishanensis sp. nov. differs from O. amamiensis, O. andersonii, O. aureola, O. bacboensis, O. cangyuanensis, O. chapaensis, O. chloronota, O. damingshanensis, O. geminata, O. grahami, O. ishikawae, O. indeprensa, O. jingdongensis, O. junlianensis, O. kuangwuensis, O. leporipes, O. lungshengensis, O. mutschmanni, O. nanjiangensis, O. narina, O. splendida, O. supranarina, O. tiannanensis, O. versabilis, and O. wuchuanensis in having a medium body size (maximum SVL < 50.0 mm in males vs minimum SVL > 50.0 mm in all other species).

Odorrana leishanensis sp. nov. differs from O. absita, O. amamiensis, O. andersonii, O. anlungensis, O. aureola, O. bacboensis, O. banaorum, O. bolavensis, O. chapaensis, O. chloronota, O. dulongensis, O. fengkaiensis, O. geminata, O. grahami, O. graminea, O. hainanensis, O. heatwolei, O. hejiangensis, O. hosii, O. huanggangensis, O. ichangensis, O. indeprensa, O. jingdongensis, O. junlianensis, O. khalam, O. kuangwuensis, O. kweichowensis, O. liboensis, O. livida, O. lungshengensis, O. macrotympana, O. margaretae, O. monjerai, O. morafkai, O. mutschmanni, O. nanjiangensis, O. narina, O. orba, O. sangzhiensis, O. schmackeri, O. sinica, O. splendida, O. supranarina, O. swinhoana, O. tiannanensis, O. tormota, O. versabilis, O. wuchuanensis, O. yentuensis, O. yizhangensis, and O. yunnanensis by having medium female body size (SVL < 50.0 mm vs minimum SVL > 50.0 mm in the other species).

Odorrana leishanensis sp. nov. differs from O. absita, O. amamiensis, O. banaorum, O. bolavensis, O. chloronota, O. confusa, O. damingshanensis, O. exiliversabilis, O. gigatympana, O. graminea, O. heatwolei, O. hosii, O. khalam, O. leporipes, O. livida, O. macrotympana, O. margaretae, O. monjerai, O. narina, O. nasica, O. nasuta, O. orba, O. supranarina, O. tormota, O. utsunomiyaorum, O. versabilis and O. yentuensis by lacking dorsolateral folds (vs present in the other species).

Odorrana leishanensis sp. nov. differs from O. bacboensis, O. jingdongensis, O. lungshengensis, O. margaretae, O. mutschmanni, O. nanjiangensis, O. narina, O. orba, O. sinica, O. swinhoana, O. tormota, and O. yizhangensis by the tibiotarsal articulation reaching to between the eye and the nostril when the leg is stretched forward (vs reaching the tip of the snout), from O. nasica and O. nasuta (vs reaching the tip of the snout or a little beyond), from O. hainanensis (vs reaching the tip of the snout or the anterior corner of eye), from O. junlianensis (vs reaching the tip of the snout or between the nostril and the snout), from O. cangyuanensis, O. exiliversabilis, O. fengkaiensis, O. gigatympana, O. grahami, O. graminea, O. tiannanensis, O. versabilis, and O. yentuensis (vs reaching to or beyond the tip of the snout), from O. amamiensis (vs reaching far beyond the tip of the snout), from O. amamiensis, O. anlungensis, O. huanggangensis, O. kuangwuensis, O. macrotympana, O. wuchuanensis, and O. ichangensis (vs reaching the nostril or beyond the tip of the snout), from O. lipuensis, O. splendida, and O. supranarina (vs reaching the anterior corner of the eye), and from O. utsunomiyaorum (vs reaching between the anterior corner of the eye and the nostril).

Odorrana leishanensis sp. nov. differs from O. absita, O. amamiensis, O. andersonii, O. anlungensis, O. aureola, O. bacboensis, O. banaorum, O. bolavensis, O. cangyuanensis, O. chapaensis, O. chloronota, O. dulongensis, O. exiliversabilis, O. fengkaiensis, O. geminata, O. gigatympana, O. grahami, O. graminea, O. hainanensis, O. heatwolei, O. hejiangensis, O. huanggangensis, O. ichangensis, O. indeprensa, O. ishikawae, O. jingdongensis, O. junlianensis, O. khalam, O. kweichowensis, O. lungshengensis, O. macrotympana, O. morafkai, O. nanjiangensis, O. nasica, O. nasuta, O. orba, O. sinica, O. swinhoana, O. tianmuii, O. tiannanensis, O. tormota, O. utsunomiyaorum, O. versabilis, O. yentuensis and O. yizhangensis by vocal sacs absent in male (vs present in the other species).

The congeners O. graminea, O. huanggangensis, and O. lungshengensis have sympatric distribution with Odorrana leishanensis sp. nov. (Fei et al. 2012; Amphibia China 2024). The new species can be distinguished from these species by a series of morphological characters as follows. This new species differs from O. graminea by the presence of vocal sacs in male and dorsolateral folds absent (vs vocal sacs in male and dorsolateral folds present in the latter) and small, rounded but rough dorsal granules scattered all over dorsal body and limbs (vs dorsum smooth in the latter). It differs from O. huanggangensis and O. lungshengensis by vocal sacs in male absent (vs vocal sacs present in male in the latter) and small, rounded but rough dorsal granules scattered all over dorsal body and limbs (vs dorsum smooth the other species).

Distribution and habitats

At present, Odorrana leishanensis sp. nov. is only known from Leigongshan National Nature Reserve, Leishan County, Guizhou Province, China. The population inhabits mountain forest at elevations between 1600–1800 m and is often found on bamboo and encountered in forest nearby streams (Fig. 7). Boulenophrys leishanensis Li, Xu, Liu, Jiang, Wei & Wang, 2018, B. spinata Liu & Hu, 1973, O. lungshengensis Liu & Hu, 1962, Leptobrachella wulingensis Qian, Xia, Cao, Xiao & Yang, 2020, Paramesotriton caudopunctatus Liu & Hu, 1973 and Leptobrachium leishanensis Liu & Hu, 1973, were also found in the type locality of the new species.

Figure 7. 

Habitats of Odorrana leishanensis sp. nov. at the type locality, Leishan County, Guizhou Province, China (inset: the holotype on bush stems beside the stream).

Etymology

The specific epithet leishanensis refers to the distribution of this species, Leishan County, Guizhou Province, China. We propose the common English name “Leishan Odorous Frog” and the Chinese name as “Lei Shan Chou Wa (雷山臭蛙)” for this species.

Discussion

In recent years, new species of Odorrana have been discovered almost every year (Frost 2024). Within the genus, O. schmackeri has been considered as the most widespread species in China, covering Henan, Sichuan, Chongqing, Guizhou, Hubei, Anhui, Jiangsu, Zhejiang, Hunan, Fujian, Guangdong, and Guangxi provinces (Fei et al. 2012). In recent years O. schmackeri was indicated as a complex of species, probably containing some cryptic species (Chen et al. 2013; Li et al. 2015; Zhu 2016), and have been described one after another (Wang et al. 2015; Li et al. 2018a; Shen et al. 2020; Zhang et al. 2021). Molecular phylogenetic analyses indicated that Odorrana leishanensis sp. nov. was revealed as the sister to the clade corresponding to the O. schmackeri complex, and is morphologically distinct from the latter (vocal sacs absent, and smaller body size in female). This may indicate that the new species has probably experienced an independent evolutionary history.

Leigong Mountain in Guizhou Province, China is the main summit of the Miaoling mountain range. Since the 1980s, many scholars have investigated the amphibians in this area and several species were described, i.e., Paramesotriton caudopunctatus (Liu & Hu, 1973), Boulenophrys spinata, Leptobrachium leishanense (Liu & Hu, 1973), B. leishanensis, and Nidirana leishanensis Li, Wei, Xu, Cui, Fei, Jiang, Liu & Wang, 2019. Among them, B. leishanensis and N. leishanensis had previously been misidentified as B. minor (Stejneger, 1926) and N. adenopleura (Boulenger, 1909)(Hu et al. 1973; Li et al. 2018b; Li et al. 2019). From 2014 to July 2023 we conducted several surveys in this region but the new species has only just been discovered, with only seven adult specimens found in a small area at elevations of 1600–1800 m. Therefore, we infer that the population of the new species is small, and we recommend classifying the new species as vulnerable (VU) according to the evaluation criteria of the IUCN Red List of threatened Species (IUCN 2012). Future research should focus on determining the distribution and elevational range of the species.

Acknowledgements

We thank Prof. Yingyong Wang and Dr Zhitong Lyu for the tissue samples of some species and thanks Chaobo Feng, Tuo Shen, Junjian Zhou and Lyu Zhou for their help in collecting data and specimens.

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Funding

This work was supported by the Projects from the National Natural Science Foundation of China (Nos. 32270498, 31960099, 32260136, and 32070426), the West Light Foundation of The Chinese Academy of Sciences (Grant No. 2021XBZG_XBQNXZ_A_006), Guizhou Provincial Science and Technology Projects (Nos. ZK[2022]540), Forestry Science and Technology Research Project of Guizhou Forestry Department (No. [2020]13, [2020]04); Guizhou Provincial Department of Education Youth Science and Technology Talents Growth Project (No. KY[2020]234), and High-level personnel research start-up funding projects of Moutai Institute (Nos. mygccrc[2022]055, mygccrc[2022]067, mygccrc[2022]083); Survey of Amphibian and Reptile Resources in Leigongshan Nature Reserve (P5226002023000019).

Author contributions

Investigation: JL, JJC. Methodology: HJS. Project administration: XJT. Visualization: BW. Writing – original draft: SZL.

Author ORCIDs

Bin Wang https://orcid.org/0000-0001-6036-5579

Data availability

All of the data that support the findings of this study are available in the main text or Supplementary Information.

References

  • Ahl E (1927 [1925]) Über vernachlässigte Merkmale bei Fröschen. Sitzungsberichte der Gesellschaft Naturforschender Freunde zu Berlin, 40–47.
  • Amphibia China (2024) The database of Chinese amphibians. Electronic Database. Kunming Institute of Zoology (CAS), Kunming, Yunnan. http://www.amphibiachina.org/ [Accessed 24 January 2024]
  • Bain RH, Stuart BL, Nguyen TQ, Che J, Rao DQ (2009) A new Odorrana (Amphibia: Ranidae) from Vietnam and China. Copeia 2(2): 348–362. https://doi.org/10.1643/CH-07-195
  • Blyth E (1856) Report for October Meeting, 1855. Journal of the Asiatic Society of Bengal 24: 711–723.
  • Boettger O (1892) Katalog der Batrachier-Sammlung im Museum der Senckenbergischen Naturforschenden Gesellshaft in Frankfurt am Main. Gebrüder Knauer, Frankfurt am Main, 11 pp.
  • Boulenger GA (1882) Calalogue of the Batrachia Salientias. Ecaudata in the collection of the British Museum, London, 55 pp.
  • Boulenger GA (1900) On the reptiles, batrachians, and fishes collected by the late Mr. John Whitehead in the interior of Hainan. Proceedings of the Zoological Society of London 1899: 956–962.
  • Bourret R (1937) Notes herpétologiques sur l’Indochine française. XIV. Les batraciens de la collection du Laboratoire des Sciences naturelles de l’Université. Descriptions de quinze espèces ou variétés nouvelles. Annexe au Bulletin Général de l’Instruction Publique 4: 5–56.
  • Che J, Pang JF, Zhao H, Wu GF, Zhao EM, Zhang YP (2007) Phylogeny of Raninae (Anura: Ranidae) inferred from mitochondrial and nuclear sequences. Molecular Phylogenetics and Evolution 43(1): 1–13. https://doi.org/10.1016/j.ympev.2006.11.032
  • Che J, Jiang K, Yan F, Zhang YP (2020) Amphibians and Reptiles in Tibet – Diversity and Evolution. Science Press, Beijing, 238–243.
  • Chen LQ, Murphy RW, Lathrop A, Ngo A, Orlov NL, Ho CT, Somorjai I (2005) Taxonomic chaos in Asian ranid frogs: An initial phylogenetic resolution. The Herpetological Journal 15: 231–243.
  • Chen XH, Zhou KY, Zheng GM (2010a) A new species of the genus Odorrana from China (Anura, Ranidae). Dong Wu Fen Lei Xue Bao 35(1): 206–211.
  • Chen XH, Zhou KY, Zheng GM (2010b) A new species of odorous frog from China (Anura: Ranidae). Journal of Beijing Normal University 46(5): 606–609.
  • Chen XH, Chen Z, Jiang JP, Qiao L, Lu YQ, Zhou KY, Zheng GM, Zhai XF, Liu JX (2013) Molecular phylogeny and diversification of the genus Odorrana (Amphibia, Anura, Ranidae) inferred from two mitochondrial genes. Molecular Phylogenetics and Evolution 69(3): 1196–1202. https://doi.org/10.1016/j.ympev.2013.07.023
  • Chen WC, Mo YM, Lin L, Qin K (2024) A new species of Odorrana Fei, Ye & Huang, 1990 (Amphibia, Anura, Ranidae) from central Guangxi, China with a discussion of the taxonomy of Odorrana (Bamburana). ZooKeys 1190: 131–152. https://doi.org/10.3897/zookeys.1190.109886
  • Deng QX, Yu ZW (1992) A new species of the genus Rana form China. Journal of Sichuan Teacher College 13(4): 323–326.
  • Fei L, Ye CY, Huang YZ (1990) Key to Chinese Amphibians. Publishing House for Scientific and Technological Literature, Chongqing, 364 pp.
  • Fei L, Ye CY, Li C (2001a) Descriptions of two new species of the genus Odorrana in China (Anura: Ranidae). Dong Wu Fen Lei Xue Bao 26(1): 108–114.
  • Fei L, Ye CY, Li C (2001b) Taxonomic studies of Odorrana versabilis in China II. Descriptions of two new species (Amphibia: Ranidae). Dong Wu Fen Lei Xue Bao 26(4): 601–607.
  • Fei L, Ye CY, Jiang JP, Xie F, Huang YZ (2005) An Illustrated Key to Chinese Amphibians. Sichuan Publishing House of Science and Technology, Chongqing, 123 pp.
  • Fei L, Ye CY, Jiang JP (2007a) A new Ranidae frog species China Odorrana (Odorrana) yizhangensis (Ranidae: Anura). Dong Wu Fen Lei Xue Bao 32(4): 989–992.
  • Fei L, Ye CY, Xie F, Jiang JP (2007b) A new Ranidae frog species from Sichuan, China Odorrana (Odorrana) nanjiangensis (Ranidae: Anura). Zoological Research 28(5): 551–555.
  • Fei L, Hu SQ, Ye CY, Huang YZ (2009) Fauna Sinica. Amphibia (Vol. 2) Anura. Science Press, Beijing, 957 pp.
  • Fei L, Ye CY, Jiang JP (2012) Colored Atlas of Chinese Amphibians and Their Distributions. Sichuan Publishing House of Science & Technology, Chengdu, 619 pp.
  • Frost DR, Grant T, Faivovich J, Bain RH, Haas A, Haddad CFB, de Sá RO, Channing A, Wilkinson M, Donnellan SC, Raxworthy CJ, Campbell JA, Blotto BL, Moler PE, Drewes RC, Nussbaum RA, Lynch JD, Green DM, Wheeler WC (2006) The amphibian tree of life. Bulletin of the American Museum of Natural History 297: 1–370. https://doi.org/10.1206/0003-0090(2006)297[0001:TATOL]2.0.CO;2
  • Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O (2010) New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Systematic Biology 59(3): 07–321. https://doi.org/10.1093/sysbio/syq010
  • Günther A (1876) Tird report on collections of Indian reptiles obtained by the British Museum. Proceedings of the Zoological Society of London 1875: 567–577.
  • Hall TA (1999) BIOEDIT: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41(41): 95–98.
  • Hu SX, Zhao EM, Liu CZ (1966) A herpetological survey of the Tsinling and Ta-pa shan Regions. Acta Zoological Sinica 18(1): 57–89.
  • Hu SX, Zhao EM, Liu CZ (1973) A survey of amphibians and reptiles in Kweichow Province, including a herpetofauna analysis. Acta Zoological Sinica 19(2): 149–171.
  • IUCN (2012) IUCN Red List Categories and Criteria: Version 3.1, (2nd edn.). Cambridge, Gland, 16 pp.
  • Kocher TD, Thomas WK, Meyer A, Edwards SV, Paabo S, Villablanca FX, Wilson AC (1989) Dynamics of mitochondrial DNA evolution in mammals: Amplification and sequencing with conserved Primers. Proceedings of the National Academy of Sciences of the United States of America 86(16): 6169–6200. https://doi.org/10.1073/pnas.86.16.6196
  • Kurabayashi A, Natsuhiko Y, Naoki S, Yoko H, Shohei O, Tamotsu F, Masayuki S (2010) Complete mitochondrial DNA sequence of the endangered frog Odorrana ishikawae (family Ranidae) and unexpected diversity of mt gene arrangements in ranids. Molecular Phylogenetics and Evolution 56(2): 543–553. https://doi.org/10.1016/j.ympev.2010.01.022
  • Kuramoto M, Satou N, Oumi S, Kurabayashi A, Sumida M (2011) Inter-and intra-Island divergence in Odorrana ishikawae (Anura, Ranidae) of the Ryukyu Archipelago of Japan, with description of a new species. Zootaxa 2767(1): 25–40. https://doi.org/10.11646/zootaxa.2767.1.3
  • Lanfear R, Calcott B, Ho SYW, Guindon S (2012) PartitionFinder: Combined selection of partitioning schemes and substitution models for phylogenetic analyses. Molecular Biology and Evolution 29(6): 1695–1701. https://doi.org/10.1093/molbev/mss020
  • Li YM, Wu XY, Zhang HB, Yan P, Xue H, Wu XB (2015) Vicariance and its impact on the molecular ecology of a Chinese Ranid frog species-complex (Odorrana schmackeri, Ranidae). PLOS ONE 10(9): e0138757. https://doi.org/10.1371/journal.pone.0138757
  • Li YM, Wu XY, Zhang HB, Yan P, Xue H, Wu XB (2016) The complete mitochondrial genome of Amolops ricketti (Amphidia, Anura, Ranidae). Mitochondrial DNA. Part A, DNA Mapping, Sequencing, and Analysis 27(1): 242–243. https://doi.org/10.3109/19401736.2014.883606
  • Li SZ, Xu N, Lv JC, Jiang JP, Wei G, Wang B (2018a) A new species of the odorous frog genus Odorrana (Amphibia, Anura, Ranidae) from southwestern China. PeerJ 6: e5695. https://doi.org/10.7717/peerj.5695
  • Li SZ, Xu N, Liu J, Jiang JP, Wei G, Wang B (2018b) A new species of the Asian toad genus Megophrys sensu lato (Amphibia: Anura: Megophryidae) from Guizhou Province, China. Asian Herpetological Research 9(4): 224–239. https://doi.org/10.16373/j.cnki.ahr.180072
  • Li SZ, Wei G, Xu N, Cui JG, Fei L, Jiang JP, Liu J, Wang B (2019) A new species of the Asian music frog genus Nidirana (Amphibia, Anura, Ranidae) from Southwestern China. PeerJ 7: e7157. https://doi.org/10.7717/peerj.7157
  • Lin SS, Li YH, Su HL, Yi H, Pan Z, Sun YJ, Zeng ZC, Wang J (2022) Discovery of a new limestone karst-restricted odorous frog from northern Guangdong, China (Anura, Ranidae, Odorrana). ZooKeys 1120: 47–66. https://doi.org/10.3897/zookeys.1120.87067
  • Liu CZ, Hu SQ (1962) A survey of amphibians and reptiles in Guangxi Province. Acta Zoological Sinica 14: 73–104.
  • Liu XL, He YH, Wang YF, Beukema W, Hou SB, Li YC, Che J, Yuan ZY (2021) A new frog species of the genus Odorrana (Anura: Ranidae) from Yunnan, China. Zootaxa 4908(2): 263–275. https://doi.org/10.11646/zootaxa.4908.2.7
  • Luo T, Wang SW, Xiao N, Wang YL, Zhou J (2021) A new species of odorous frog genus Odorrana (Anura, Ranidae) from southern Guizhou Province, China. Asian Herpetological Research 12(4): 381–398. https://doi.org/10.16373/j.cnki.ahr.200122
  • Mahony S (2008) Redescription and generic reallocation of Rana mawphlangensis Pillai & Chanda, 1977 (Amphibia: Ranidae). Hamadryad Madras 33(1): 1–12.
  • Matsui M, Tomohiko S, Hidetoshi OT, Tanaka U (2005) Multiple invasions of the Ryukyu Archipelago by Oriental frogs of the subgenus Odorrana with phylogenetic reassessment of the related subgenera of the genus Rana. Molecular Phylogenetics and Evolution 37(3): 733–742. https://doi.org/10.1016/j.ympev.2005.04.030
  • Mo YM, Chen WC, Wu HY, Zhang W, Zhou SC (2015) A new species of Odorrana inhabiting complete darkness in a karst cave in Guangxi, China. Asian Herpetological Research 6(1): 11–17. https://doi.org/10.16373/j.cnki.ahr.140054
  • Orlov NL, Natalia B, Cuc HT (2006) A new cascade frog (Amphibia: Ranidae) from central Vietnam. Russian Journal of Herpetology 13(2): 155–163.
  • Pham CT, Nguyen TQ, Bernardes M, Nguyen TT, Ziegler T (2016a) First records of Bufo gargarizans Cantor, 1842 and Odorrana lipuensis Mo, Chen, Wu, Zhang et Zhou, 2015 (Anura: Bufonidae, Ranidae) from Vietnam. Russian Journal of Herpetology 23(2): 103–107.
  • Pillai RS, Chanda SK (1977) Two new species of frogs (Ranidae) from Khasi Hills, India. Journal of the Bombay Natural History Society 74: 136–140.
  • Saikia B, Sinha B, Kharkongor IJ (2017) Odorrana arunachalensis: A new species of Cascade Frog (Anura: Ranidae) from Talle Valley Wildlife Sanctuary, Arunachal Pradesh, India. Journal of Bioresources 4: 30–41.
  • Shen HJ, Zhu YJ, Li Z, Chen Z, Chen XH (2020) Reevaluation of the holotype of Odorrana schmackeri Boettger, 1892 (Amphibia: Anura: Ranidae) and characterization of one cryptic species in O. schmackeri sensu lato through integrative approaches. Asian Herpetological Research 11(4): 297–311. https://doi.org/10.16373/j.cnki.ahr.200097
  • Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook P (1994) Evolution, weighting andphylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America 87(6): 651–701. https://doi.org/10.1093/aesa/87.6.651
  • Song HM, Zhang SY, Qi S, Lyu ZT, Zeng ZC, Zhu YH, Huang MH, Luan FC, Shu ZF, Gong Y, Liu ZF, Wang YY (2023) Redefinition of the Odorrana versabilis Group, with a New Species from China (Anura, Ranidae, Odorrana). Asian Herpetological Research 14(4): 283–299. https://doi.org/10.3724/ahr.2095-0357.2023.0019
  • Stejneger L (1901) Diagnoses of eight new batrachians and reptiles from the Riu Kiu Archipelago, Japan. Proceedings of the Biological Society of Washington 14: 189–191.
  • Stuart BL, Bain RH (2005) Tree new species of spinule-bearing frogs allied to Rana megatympanum Bain, Lathrop, Murphy, Orlov & Ho, 2003 from Laos and Vietnam. Herpetologica 61(4): 478–492. https://doi.org/10.1655/05-06.1
  • Stuart BL, Inger RF, Voris HK (2006b) High level of cryptic species diversity revealed by sympatric lineages of Southeast Asian forest frogs. Biology Letters 2(3): 470–474. https://doi.org/10.1098/rsbl.2006.0505
  • Tamura K, Stecher G, Peterson D, Fiipski A, Kumar S (2013) MEGA6: Molecular evolutionary genetics analysis, version 6.0. Molecular Biology and Evolution 30(12): 2725–2729. https://doi.org/10.1093/molbev/mst197
  • Tran TT, Orlov NL, Nguyen TT (2008) A new species of Cascade frog of Odorrana Fei, Yi et Huang, 1990 genus (Amphibia: Anura: Ranidae) from Bac Giang Province (Yen Tu Mountain Range, northeast Vietnam). Russian Journal of Herpetology 15: 212–224.
  • Wang YY, Lau N, Yang JH, Chen GL, Liu ZY, Pang H, Liu Y (2015) A new species of the genus Odorrana (Amphibia: Ranidae) and the first record of Odorrana bacboensis from China. Zootaxa 3999(2): 235–254. https://doi.org/10.11646/zootaxa.3999.2.4
  • Werner F (1930) Rana leporipes, a new species of frog from South China, with field notes by R. Mell. Lingnan Science Journal 9: 45–47.
  • Wu GF (1977) A new species of frogs from Huang-Shan, Anhui, Amolops tormotus Wu. Dong Wu Xue Bao 23: 113–115.
  • Wu L, Xu RH, Dong Q, Li DJ, Liu JS (1983) A new species of Rana and records of amphibians from Guizhou province. Dong Wu Fen Lei Xue Bao 29(1): 66–70.
  • Xue R, Liu JB, Yu JJ, Yang JD (2016) The complete mitogenome of Amolops loloensis and related phylogenetic relationship among Ranidae. Mitochondrial DNA. Part A, DNA Mapping, Sequencing, and Analysis 27(6): 4629–4630. https://doi.org/10.3109/19401736.2015.1101589
  • Yang DT (2008) Amphibia and Reptilia of Yunnan. Yunnan Science and Technology Press, Kunming, 65–81.
  • Yang DT, Li SM (1980) A new species of the genus Rana from Yunnan. Zoological Research 1(2): 261–264.
  • Ye CY, Fei L (2001) Phylogeny of genus Odorrana (Amphibian: Ranidae) in China. Dong Wu Fen Lei Xue Bao 47(5): 528–534.
  • Yuan ZY, Zhou WW, Chen X, Poyarkov N, Chen HM, Liaw NHJ, Chou WH, Matzke H, Iizuka K, Min MS, Kuzmin S, Zhang YP, Che J (2016) Spatiotemporal Diversification of the True Frogs (Genus Rana): A Historical Framework for a Widely Studied Group of Model Organisms. Systematic Biology 65(5): syw055. https://doi.org/10.1093/sysbio/syw055
  • Zhu YJ (2016) Genetic Differentiation of Odorrana schmackeri Species Complex. Henan Normal University, Henan.

Supplementary materials

Supplementary material 1 

Measurements of the adult specimens of Odorrana leishanensis sp. nov., O. hejiangensis, O. huanggangensis, O. ichangensis, O. kweichowensis, O. schmackeri, and O. wuchuanensis

Shi-Ze Li, Ji-Jun Chen, Hai-Jun Su, Jing Liu, Xiu-Jun Tang, Bin Wang

Data type: xlsx

Explanation note: Units in mm. See abbreviations for the morphological characters in Materials and methods section.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (23.39 kb)
Supplementary material 2 

Uncorrected p-distances between the Odorrana species based on the 12S rRNA gene sequences

Shi-Ze Li, Ji-Jun Chen, Hai-Jun Su, Jing Liu, Xiu-Jun Tang, Bin Wang

Data type: xlsx

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (20.74 kb)
Supplementary material 3 

Uncorrected p-distances between the Odorrana species based on the 16S rRNA gene sequences

Shi-Ze Li, Ji-Jun Chen, Hai-Jun Su, Jing Liu, Xiu-Jun Tang, Bin Wang

Data type: xlsx

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (22.32 kb)
Supplementary material 4 

Uncorrected p-distances between the Odorrana species based on the ND2 gene sequences

Shi-Ze Li, Ji-Jun Chen, Hai-Jun Su, Jing Liu, Xiu-Jun Tang, Bin Wang

Data type: xls

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (31.50 kb)
Supplementary material 5 

Maximum likelihood (ML) tree of the genus Odorrana reconstructed based on the 12S rRNA gene sequences

Shi-Ze Li, Ji-Jun Chen, Hai-Jun Su, Jing Liu, Xiu-Jun Tang, Bin Wang

Data type: jpg

Explanation note: ML bootstrap supports (BS)/Bayesian posterior probability (BPP) are denoted beside each node, and “-” denotes BS < 50% or BPP < 0.60. Samples 1–86 refer to those listed in Table 1.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (7.61 MB)
Supplementary material 6 

Maximum likelihood (ML) tree of the genus Odorrana reconstructed based on the 16S rRNA gene sequences

Shi-Ze Li, Ji-Jun Chen, Hai-Jun Su, Jing Liu, Xiu-Jun Tang, Bin Wang

Data type: jpg

Explanation note: ML bootstrap supports (BS)/Bayesian posterior probability (BPP) are denoted beside each node, and “-” denotes BS < 50% or BPP < 0.60. Samples 1–86 refer to those listed in Table 1.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (12.41 MB)
Supplementary material 7 

Maximum likelihood (ML) tree of the genus Odorrana reconstructed based on the ND2 gene sequences

Shi-Ze Li, Ji-Jun Chen, Hai-Jun Su, Jing Liu, Xiu-Jun Tang, Bin Wang

Data type: jpg

Explanation note: ML bootstrap supports (BS)/Bayesian posterior probability (BPP) were denoted beside each node, and “-” denotes BS < 50% or BPP < 0.60. Samples 1–86 refer to those listed in Table 1.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (12.57 MB)
login to comment