Research Article |
|
Corresponding author: Chong Rui Wang ( hunanfish@163.com ) Corresponding author: Da Pan ( dapan@njnu.edu.cn ) Academic editor: Frank Köhler
© 2024 Hui Chen, Yue Ming He, Chong Rui Wang, Da Pan.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Chen H, He YM, Wang CR, Pan D (2024) A new species of freshwater snail of Fenouilia (Gastropoda, Pomatiopsidae) from northern Guangxi, China, based on morphological and DNA evidence. ZooKeys 1196: 271-283. https://doi.org/10.3897/zookeys.1196.113856
|
A new species of pomatiopsid freshwater snail, Fenouilia undata Chen & He, sp. nov., is described from Guangxi, China, based on morphological and molecular evidence. The new species can be distinguished from its congeners by the following combination of characters: shell with low, prosocline, rounded axial ribs and fine spiral striae, broader than high; aperture broader than shell height; radula with lateral teeth have only two or three faint, wavy ridges on inner side. A molecular analysis of partial mitochondrial COI and 16S DNA sequences supports the systematic position of the new taxon.
Diversity, southern China, taxonomy, Triculinae
Pomatiopsidae Stimpson, 1865 is a family of minute snails with shells usually 1–10 mm high. However, a few species can reach up to 20 mm in high. Typically, pomatiopsids inhabit rivers and streams, while some species also occur in brackish water or even in damp places on land (
The tropical hills and rivers of China have rich biodiversity and are home to many species of freshwater snails. With at least 18 genera, China has the highest species richness of Pomatiopsidae in the world (
In China, Pomatiopsidae are mainly distributed in the southwestern region (
In a recent survey in the Longjiang River, Hechi City, Guangxi, China, a new species of freshwater snail belonging to the genus Fenouilia Heude, 1889 was discovered. On comparison of its morphological traits with those of other freshwater snails known from this area, we conclude that this species is indeed undescribed. The new species can be distinguished from its congener Fenouilia kreitneri (Neumayr, 1880) by having low, rounded axial ribs on its shell, which is unique to this species. Molecular phylogenetic analyses, based on partial sequences of the mitochondrial 16S rRNA (16S) and COI genes, provide additional evidence supporting the novelty of this species. Our study contributes to a better understanding of pomatiopsid diversity in China and encourages the further exploration of freshwater gastropods in the region.
All specimens were collected by hand in August 2022 and March 2023 on the Longjiang River, Yizhou District, Hechi City, Guangxi Province, China (Fig.
Before taking any action, preserved samples were soaked overnight in a saline solution. The tissue was extracted using anatomical needles. The shell and operculum were cleaned with a fine brush and then flushed with distilled water and photographed under a Nikon SMZ645 stereomicroscope. For traditional morphometrics, we measured five shell characteristics to the nearest 0.01 mm for each individual using digital calipers as follows: (1) shell height (H), which is the maximum dimension parallel to the axis of coiling; (2) shell width (W), the maximum dimension perpendicular to H; (3) length of aperture (LA), the maximum dimension from the junction of the outer lip with the penultimate whorl to the anterior lip; (4) width of aperture (WA), the maximum dimension perpendicular to LA; and (5) height of the body whorl (BW), the dimension from the lower margin of the aperture to the upper suture delimiting the first whorl. Other terminology used follows
Radulae were dissected from the buccal masses of three specimens and cleaned enzymatically with proteinase K following
Total genomic DNA was extracted from foot tissue of three ethanol-preserved specimens using a Trelief TM Animal Genomic DNA kit (Tsingke®). Partial sequences of 16S rDNA were amplified using the universal primer set 16Sar CGCCTGTTTATCAAAAACAT and 16Sbr CCGGTCTGAACTCAGATCACGT (
Each PCR reaction was performed in a total volume of 20 μL, including 9 μL of PCR mix, 8 μL of double distilled water, 1 μL of each primer and 1 μL of the DNA template. The PCR conditions were as follows: initial denaturation at 95 °C for 3 min; 35 cycles of denaturation at 95 °C for 40 s, annealing at 55 °C for 30 s and extension at 72 °C for 30 s; and final extension at 72 °C for 7 min. Both ends of sequences were obtained by automated sequencing using Applied Biosystems 3730 in Sangon Biotech Co. Ltd (Shanghai, China). In addition, two individuals of Lithoglyphopsis modesta (Gredler, 1886) and one of Fenouilia kreitneri (Neumayr, 1880) had their 16S rDNA extracted in this study.
To clarify the generic relationship of the new species, we included 16 sequences generated in this study with addition of 16S and COI gene sequences of 49 specimens representing 26 genera and 41 species, which were downloaded from GenBank (Table
Nucleotide compositions of partial 16S rDNA and COI sequences of specimens investigated in this study.
| Genus | Species | GenBank | References | |
|---|---|---|---|---|
| 16S | COI | |||
| Lithoglyphus | Lithoglyphus naticoides | AF445341 | AF445332 |
|
| Bythinella | Bythinella austriaca | FJ028832 | FJ028942 |
|
| Bythinella austriaca | FJ028831 | FJ028943 | ||
| Bythinella carinulata | FJ028884 | FJ029100 | ||
| Paludinella | Paludinella minima | AB822685 | AB822663 |
|
| Paludinella minima | AB822686 | AB822664 | ||
| Paludinella kuzuuensis | AB822695 | AB822675 | ||
| Erhaia | Erhaia jianouensis | AF212894 | AF213340 |
|
| Erhaia wangchuki | KY798003 | MT237715 |
|
|
| Akiyoshia | Akiyoshia kobayashii | AB611822 | AB611823 |
|
| Bithynia | Bithynia tentaculata | FJ160288 | JX970605 |
|
| Pomatiopsis | Pomatiopsis lapidaria | AY676118 | AF367636 |
|
| Robertsiella | Robertsiella sp. | AF531548 | AF531550 |
|
| Pachydrobia | Pachydrobia munensis | KC832721 | KC832700 |
|
| Pachydrobia sp. | KC832711 | KC832690 | ||
| Jullienia | Jullienia rolfbrandti | KC832718 | KC832697 | |
| Hubendickia | Hubendickia schuetti | KC832709 | KC832688 | |
| Hubendickia spiralis | KC832710 | KC832689 | ||
| Jinghongia | Jinghongia jinghongensis | KC832728 | KC832707 | |
| Manningiella | Manningiella velimirovici | KC832716 | KC832695 | |
| Manningiella conica | KC832719 | KC832698 | ||
| Manningiella polita | KC832715 | KC832694 | ||
| Tricula | Tricula bambooensis | KC832720 | KC832699 | |
| Tricula ludongbini | KC832717 | KC832696 | ||
| Tricula hudiequanensis | KC832712 | KC832691 | ||
| Tricula hongshanensis | EF394876 | EF394896 |
|
|
| Oncomelania | Oncomelania hupensis robertsoni | DQ212900 | DQ212855 |
|
| Oncomelania hupensis robertsoni | DQ212901 | DQ212856 | ||
| Oncomelania minima | AB611790 | AB611795 |
|
|
| Blanfordia | Blanfordia integra | AB611722 | AB611723 | |
| Blanfordia japonica japonica | AB611726 | AB611727 | ||
| Cecina | Cecina manchurica | AB611746 | AB611747 | |
| Cecina manchurica | AB611742 | AB611743 | ||
| Neotricula | Neotricula burchi | AF531542 | AF531544 |
|
| Neotricula aperta | MF663277 | MF663265 |
|
|
| Gammatricula | Gammatricula fujianensis | AF212896 | AF213342 |
|
| Gammatricula shini | AB611798 | AB611799 |
|
|
| Gammatricula chinensis | EU573993 | AF253067 |
|
|
| Lacunopsis | Lacunopsis munensis | KC832726 | KC832705 |
|
| Delavaya | Delavaya dianchiensis | KC832713 | KC832692 | |
| Paraprososthenia | Paraprososthenia levayi | KC832708 | KC832687 | |
| Lithoglyphopsis | Lithoglyphopsis modesta | OR515659 | PP327217 | This study |
| Lithoglyphopsis modesta | OR515660 | PP327222 | ||
| Fenouilia | Fenouilia kreitneri | OR515658 | PP340173 | |
| Fenouilia undata sp. nov. | OR515661 | PP333612 | ||
| Fenouilia undata sp. nov. | OR515662 | PP333613 | ||
| Fenouilia undata sp. nov. | OR515663 | PP333614 | ||
| Kunmingia | Kunmingia kunmingensis | OR784230 | OR780554 | |
| Kunmingia kunmingensis | OR784231 | OR780555 | ||
The best-substitution model was selected using the corrected Bayesian information criterion (BIC) in MODELFINDER v. 2.2.0 (
Furthermore, to investigate the behavior of the new species, six individuals were maintained in an artificial field environment within the laboratory of Hunan Fisheries Science Institute for one year.
Family Pomatiopsidae Stimpson, 1865
Subfamily Pomatiopsinae Stimpson, 1865
Genus Fenouilia Heude, 1889
Holotype
: China • Guangxi Province, Hechi City, Yizhou District, Longjiang River; 24.4927°N, 108.6851°E; August 2022; Xu Cheng Wei & Yue Ming He leg.; NNU230701 (Fig.
Measurements of Fenouilia undata sp. nov. (in mm). Abbreviations: W, shell width; BW, height of the body whorl; H, shell height; LA, length of aperture; WA, width of aperture.
| Number | H | W | LA | WA | BW | |
|---|---|---|---|---|---|---|
| Holotype | NNU230701 | 3.39 | 4.95 | 3.63 | 2.64 | 2.84 |
| Paratype 1 | NNU230702 | 3.25 | 4.67 | 3.44 | 2.43 | 3.07 |
| Paratype 2 | NNU230703 | 3.44 | 4.68 | 3.49 | 2.61 | 2.92 |
| Paratype 3 | NNU230704 | 3.07 | 4.37 | 3.22 | 2.49 | 2.81 |
| Paratype 4 | NNU230705 | 3.04 | 4.01 | 3.06 | 2.26 | 2.74 |
Shell small, thin but solid, with rounded, rather flattened shape, and width greater than height; sculptured with low, rounded axial ribs and fine spiral striae; whorls 4–5; body whorl swollen and large. Suture shallow; umbilicus narrow, crescent-shaped or closed. Aperture large, its length greater than shell height. Operculum ovate, corneous, slightly transparent, yellowish.
Shell small, 3.04–3.44 mm high, thin but solid, with a rounded, rather flattened shape; whorls 4–5; body whorl swollen and large, taking up most (about 84–94%) of shell; whorls of spire rapidly expanding. Shell width longer than shell height (Fig.
Operculum ovate, smaller than aperture, corneous, thin, slightly transparent, yellowish, length 1.86–2.12 mm, width 1.53–1.72 mm; surface, including nucleus, of operculum smooth; nucleus located at bottom left third (Fig.
Radula small; ribbon approximately 0.88 mm long. Central tooth with one large, triangular, pointed major cusp without serrations, with two small, sharp cusps on either side at base. Inner side of lateral teeth with two or three faint, wavy ridges; outer side smooth. Inner marginal teeth with five or six small cusps. Outer marginal teeth with 6–8 small cusps (Fig.
Tentacles short, white; snout stubby, white, black pigmented. Mantle smooth, light gray, with small black spots. Intestine wider than base of tentacle; digestive gland milky white. Penis translucent white, thin, coiled, located behind right tentacle in neck area (Fig.
In the laboratory aquarium, the new species fed on algae present on the surface of stones or watergrass. Snails reproduced many times during their year in captivity. Each brownish egg was laid 1.5 mm from the next. Eggs were affixed to the surfaces of rocks with a secretion. In some months, some individuals were observed to occasionally perform a “dance” in which they repeatedly twisted their shells clockwise or counterclockwise. They were more active at night.
The genus Fenouilia was established by
The concatenation of COI and 16S rDNA yielded 1229 sites. The GTR+F+R5 model was selected as the best-fit of nucleotide substitution by BIC. Phylogenetic analyses revealed BI and ML trees with largely consistent topologies (Figs
From the Latin adjective undata (wavy or wave-like form). We suggest the Chinese common name 波浪龙骨螺.
The phylogenetic relationships and morphological traits found in this study support the placement of the new species in the genus Fenouilia. The prosocline axial ribs on the shell of the new species resemble the prominent, rough, raised prosocline growth lines present in F. kreitneri, and the radular of both species has a triangular central tooth without serrated cusps. The molecular phylogenies based on ML and BI analyses show that Fenouilia undata sp. nov. and F. kreitneri are nested in a monophyletic group with strong support (BS = 94%, BPP = 0.93) and sister to Lithoglyphopsis modesta.
Our phylogenetic tree includes all the genera in China except Guoia Davis & Chen, 1992, Wuconchona Kang, 1983, and Parapyrgula Annandale & Prashad, 1919. The new species can be distinguished from Wuconchona niuzhuangensis (Kang, 1983) and Parapyrgula cogginiii (Annandale & Prashad, 1919) by the rounded, flattened shell with its width greater than height. The new species can be distinguished from Guoia viridulula (Möllendorff, 1888) by the presence of axial ribs on the shell and the aperture being longer than the shell height.
The hydrological environment is complex and heterogeneous in southern China. There are still many gaps in surveys for freshwater snails, and more new species have to be discovered. However, the freshwater-snail fauna has been given little attention, especially the small species. With the environmental destruction and habitat modifications, many freshwater snails are gradually disappearing or becoming extinct (
We acknowledge Xu Cheng Wei from Guangxi for assistance in obtaining samples for this study. We are grateful to Kai Rui Jiao and Long Jie Xia from Nanjing Normal University for their help in image processing. We also extend our thanks to Yang Yang Li from Nanjing Normal University for assistance in DNA extraction.
The authors have declared that no competing interests exist.
No ethical statement was reported.
This research was funded by the Jiangsu Key Laboratory for Biodiversity and Biotechnology, College of Life Sciences, Nanjing Normal University, and the Hunan Fisheries Science Institute. Financial support from the National Natural Science Foundation of China (No. 32200356 to PD) and from the Natural Science Foundation of the Jiangsu Higher Education Institutions (No. 22KJB180018 to PD) is acknowledged.
All authors have contributed equally.
Hui Chen https://orcid.org/0009-0004-5222-3975
Yue Ming He https://orcid.org/0009-0002-9849-7977
Chong Rui Wang https://orcid.org/0009-0009-2315-6941
All of the data that support the findings of this study are available in the main text.