Research Article |
Corresponding author: Svetlana A. Maslakova ( svetlana@uoregon.edu ) Academic editor: Andreas Schmidt-Rhaesa
© 2023 Irina Cherneva, Christina I. Ellison, Eduardo E. Zattara, Jon L. Norenburg, Megan L. Schwartz, Juan Junoy, Svetlana A. Maslakova.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Cherneva I, Ellison CI, Zattara EE, Norenburg JL, Schwartz ML, Junoy J, Maslakova SA (2023) Seven new species of Tetranemertes Chernyshev, 1992 (Monostilifera, Hoplonemertea, Nemertea) from the Caribbean Sea, western Pacific, and Arabian Sea, and revision of the genus. ZooKeys 1181: 167-200. https://doi.org/10.3897/zookeys.1181.109521
|
The marine ribbon worm genus Tetranemertes Chernyshev, 1992 currently includes three species: the type species T. antonina (Quatrefages, 1846) from the Mediterranean Sea, T. rubrolineata (Kirsteuer, 1965) from Madagascar, and T. hermaphroditica (Gibson, 1982) from Australia. Seven new species are described: T. bifrost sp. nov., T. ocelata sp. nov., T. majinbuui sp. nov., and T. pastafariensis sp. nov. from the Caribbean Sea (Panamá), and three species, T. unistriata sp. nov., T. paulayi sp. nov., and T. arabica sp. nov., from the Indo-West Pacific (Japan and Oman). As a result, an amended morphological diagnosis of the genus is offered. To improve nomenclatural stability, a neotype of Tetranemertes antonina is designated from the Mediterranean. The newly described species, each characterized by features of external appearance and stylet apparatus, as well as by DNA-barcodes, form a well-supported clade with T. antonina on a molecular phylogeny of monostiliferan hoplonemerteans based on partial sequences of COI, 16S rRNA, 18S rRNA, and 28S rRNA. Six of the seven newly described species, as well as T. rubrolineata, possess the unusual character of having a central stylet basis slightly bilobed to deeply forked posteriorly in fully grown individuals, a possible morphological synapomorphy of the genus. In addition, an undescribed species of Tetranemertes is reported from the Eastern Tropical Pacific (Panamá), increasing the total number of known species in the genus to eleven.
Belize, description, histology-free, Nemertea, Oman, Panamá, revision, ribbon worm
The monostiliferan hoplonemertean genus Tetranemertes is little-known even among the nemertean taxonomists, and currently includes only three valid species, two of which, T. rubrolineata (Kirsteuer, 1965) and T. hermaphroditica (Gibson, 1982), have not been seen since their original discovery in Madagascar and Australia, respectively. The third, and the type species of the genus, T. antonina (Quatrefages, 1846), has been recollected by one of us from the Mediterranean Sea (the type region), and DNA-barcoded by
The name Tetranemertes was proposed by
The original description of Tetranemertes antonina is very brief, noting that the specimens are uniformly wine-red in color, have cephalic furrows, and four longitudinal rows of ocelli;
Here we describe four new species of Tetranemertes from the Caribbean Sea, one from the western Pacific Ocean (Japan) and Arabian Sea (Oman), and two from the Arabian Sea (Oman); we also report an additional species from the Eastern Tropical Pacific (Panamá), which at present cannot be formally described. The new species are placed into Tetranemertes based on morphological similarity to the other species of the genus, particularly to the type species T. antonina and to T. rubrolineata, the likes of which we recollected from the Arabian Sea for the first time since the original description. This placement is supported by a molecular phylogeny. We also re-evaluate the status of Ommatoplea ophiocephala Schmarda, 1859 and designate a neotype of T. antonina from material recently collected in the Mediterranean Sea.
It has been the experience of senior co-authors, over decades of study, that most nemertean species can be unambiguously identified using a combination of characters of external appearance, stylet apparatus (in case of hoplonemerteans), reproductive characters, and DNA sequence data. At the same time, traditionally used characters of internal anatomy, reconstructed using time-consuming and artifact-prone histological techniques, are typically not helpful in distinguishing between closely related species. Others have similarly pointed this out and called for a change (e.g.,
Specimens were collected from the Mediterranean, Caribbean, the Gulf of Mexico, Eastern Tropical Pacific (Panamá), western Pacific (Japan), and the Arabian Sea (southern Oman) between 1999 and 2022. Recent collections (2018–2020) in Panamá were carried out under collecting permit numbers SE/A-55-18, SE/AP-9-2019, and specimens exported to
Oregon Institute of Marine Biology, Oregon, USA (OIMB) for further study (export permit numbers SEX/A-20-2019, SEX/A-86-2019). Specimens from Oman were collected and exported to United States with permission from the Environment Authority of Oman (permit 6210/10/151). Characteristics of living specimens were documented on site with sketches and photographs, morphological vouchers were relaxed in 7.5% MgCl2, preserved in 10% buffered formalin for at least 24 h, post-fixed in Bouin’s for 48–72 h, then rinsed in tap water, and gradually transferred into 70% ethanol. Morphological vouchers for the newly described species, as well as tissue preserved for DNA barcoding are deposited at the
National Museum of Natural History (
Examined specimens of Tetranemertes species.
Species | Field ID | Collecting site | BOLD Process ID | Storing Institution and ID | Tissue description | GenBank Accession |
---|---|---|---|---|---|---|
T. antonina (Quatrefages, 1846) | TE4_DR23 | DR23 | TETRW001-21 | MCZ-IZ 132747 | 34 mm | CO1: KF935534 18S: KF935318 28S: KF935374 H3: KF935430 |
T. antonina | TE3_DR23 | DR23 | TETRW002-21 |
|
5 mm specimen preserved in Bouine’s and stored in 100% ethanol | – |
T. arabica sp. nov. | BOMAN_08050 | OM22-030B | NOMAN038-23 |
|
anterior and posterior fixed for histology; midbody in 95% ethanol | CO1: OQ321721 18S: OQ322651 28S: OQ322596 |
BOMAN_09099 | OM22-051B | NOMAN039-23 | OIMB | midbody in 95%, the rest of the specimen in RNA later | COI: OQ321713 18S: OQ322647 28S: OQ322593 | |
BOMAN_08029 | OM22-022A | NOMAN040-23 |
|
anterior and posterior fixed for histology; midbody in 95% ethanol | COI: OQ321711 | |
BOMAN_08030 | OM22-022A | NOMAN041-23 |
|
anterior and posterior fixed for histology; midbody in 95% ethanol | COI: OQ321712 | |
BOMAN_08031 | OM22-022A | NOMAN042-23 |
|
anterior and posterior fixed for histology; midbody in 95% ethanol | COI: OQ321716 | |
BOMAN_08074 | OM22-022A | NOMAN043-23 |
|
anterior and posterior fixed for histology; midbody in 95% ethanol | COI: OQ321717 | |
BOMAN_08075 | OM22-022A | NOMAN044-23 |
|
anterior and posterior fixed for histology; midbody in 95% ethanol | COI: OQ321710 | |
BOMAN_08300 | OM22-031B | NOMAN045-23 |
|
anterior and posterior fixed for histology; midbody in 95% ethanol | COI: OQ321709 | |
T. bifrost sp. nov. | 852_080203_1 | BdT03 | CARNE027-19 | N/A | N/A | CO1: MW021890 16S: MW022069 |
852_080203_2 | BdT03 | CARNE028-19 | OIMB | fragment of body in 95% ethanol | 16S: MW022070 | |
852_080203_3 | BdT03 | CARNE029-19 | OIMB | fragment of body in 95% ethanol | CO1: MW021891 16S: MW022071 | |
852_080203_4 | BdT03 | CARNE030-19 | OIMB | fragment of body in 95% ethanol | CO1: MW021892 16S: MW022072 | |
852_080203_8 | BdT03 | CARNE031-19 |
|
histological sections of head and midbody; posterior in 95% ethanol | 16S: MW022073 | |
CB057_18_01 | B2018-21 | CARNE498-21 |
|
whole body in 95% ethanol | CO1: MT578867 16S: MT581161 18S: MT581203 28S: MT581189 | |
CB057_18_03 | B2018-21 | CARNE499-21 |
|
whole body in 95% ethanol | CO1: MT578868 16S: MT581162 | |
CB057_18_04 | B2018-21 | CARNE500-21 |
|
whole body in 95% ethanol | CO1: MT578869 16S: MT581163 | |
CB057_18_05 | B2018-03B | CARNE501-21 | N/A | N/A | CO1: MT578870 16S: MT581164 | |
CB057_18_06 | B2018-21 | CARNE502-21 | N/A | N/A | CO1: MT578871 16S: MT581165 | |
CB057_18_07 | B2018-21 | CARNE503-21 |
|
anterior fixed for histology; posterior in 95% ethanol | CO1: MT578872 16S: MT581166 18S: MT581204 28S: MT581190 | |
CBdT0062 | BdT19-09 | CARNE504-21 |
|
anterior fixed for histology; posterior in 95% ethanol | CO1: MT578873 | |
CBdT0063 | BdT19-08 | CARNE505-21 |
|
anterior fixed for histology; posterior in 95% ethanol | CO1: MT578874 16S: MT581167 | |
CBdT0064 | BdT19-08 | CARNE506-21 |
|
anterior fixed for histology; posterior in 95% ethanol | CO1: MT578875 16S: MT581168 | |
852_080203_5 | BdT03 | TETRW003-21 |
|
histological sections | – | |
T. bifrost sp. nov. | 852_080203_6 | BdT03 | TETRW004-21 |
|
histological sections | – |
852_080203_7 | BdT03 | TETRW005-21 |
|
histological sections | – | |
852_080203_9 | BdT03 | TETRW006-21 |
|
histological sections | – | |
CB057_18_02 | B2018-21 | TETRW007-21 |
|
whole body in 95% ethanol | – | |
SMCP0366 | BdT19-25 | TETRW017-21 |
|
anterior and midbody fixed for histology, and posterior in 95% ethanol | – | |
SMCP0397 | BdT19-25 | TETRW018-21 |
|
anterior and midbody fixed for histology, and posterior in 95% ethanol | – | |
SMCP1970 | BdT19-19 | TETRW025-21 |
|
whole body in 95% ethanol | – | |
T. majinbuui sp. nov. | 1502 | PR | CARNE025-19 | N/A | N/A | CO1:MW021889 |
856_080303_3 | BdT03R | CARNE026-19 |
|
histological slides: frontal sections of anterior | 16S: MW022068 | |
CB056_18_01 | B2018-04 | CARNE495-21 |
|
anterior fixed for histology; posterior in 95% ethanol | CO1: MT578864 16S: MT581160 18S: MT581201 28S: MT581187 | |
CB056_18_02 | B2018-04 | CARNE496-21 |
|
whole body in 95% ethanol | CO1: MT578865 18S: MT581202 28S: MT581188 | |
CBdT0058 | BdT19-09 | CARNE497-21 |
|
anterior fixed for histology; posterior in 95% ethanol | CO1: MT578866 | |
856_080303_1 | BdT03 | TETRW008-21 |
|
histological sections | – | |
856_080303_4 | BdT03 | TETRW010-21 |
|
histological sections | – | |
SMCP0372 | BdT19-25 | TETRW016-21 |
|
anterior fixed for histology, posterior in 95% ethanol | – | |
SMCP1402 | BdT19-20 | TETRW019-21 |
|
whole body in 95% ethanol | – | |
SMCP1407 | BdT19-21 | TETRW020-21 |
|
whole body in 95% ethanol | – | |
SMCP1438 | BdT19-20 | TETRW021-21 |
|
whole body in 95% ethanol | – | |
SMCP1439 | BdT19-20 | TETRW022-21 |
|
whole body in 95% ethanol | – | |
SMCP1440 | BdT19-20 | TETRW023-21 |
|
whole body in 95% ethanol | – | |
SMCP1952 | BdT19-21 | TETRW024-21 |
|
whole body in 95% ethanol | – | |
SMCP1973 | BdT19-21 | TETRW026-21 |
|
whole body in 95% ethanol | – | |
SMCP1974 | BdT19-21 | TETRW027-21 |
|
whole body in 95% ethanol | – | |
SMCP1992 | BdT19-20 | TETRW028-21 |
|
whole body in 95% ethanol | – | |
T. ocelata sp. nov. | 685_061202_1 | CBC02 | CARNE022-19 |
|
histological sections | CO1: MW021887 16S: MW022065 |
685_061202_2 | CBC02 | CARNE023-19 |
|
transverse histological sections of anterior | CO1: MW021888 16S: MW022066 | |
685_061202_3 | CBC02 | CARNE024-19 |
|
histological sections; tissue in 95% ethanol | 16S: MW022067 | |
685_061202_4 | CBC02 | TETRW011-21 |
|
histological sections | – | |
995_070906_01 | GM06 | TETRW012-21 |
|
anterior in formalin, posterior in RNAlater | CO1: MT578863 16S: MT581159 18S: MT581200 28S: MT581186 | |
T. pastafariensis sp. nov. | CB055_18_01 | B2018-03B | CARNE524-21 |
|
whole body in 95% ethanol | CO1: MT578887 16S: MT581177 18S: MT581207 28S: MT581193 |
CB055_18_02 | B2018-03B | CARNE525-21 |
|
whole body in 95% ethanol | CO1: MT578888 16S: MT581178 18S: MT581208 28S: MT581194 | |
CB055_18_03 | B2018-03B | CARNE526-21 |
|
whole body in 95% ethanol | CO1: MT578889 16S: MT581179 | |
CB055_18_04 | B2018-03B | CARNE527-21 |
|
anterior fixed for histology; posterior in 95% ethanol | CO1: MT578890 16S: MT581180 18S: MT581209 28S: MT581195 | |
CB055_18_05 | B2018-03B | CARNE528-21 |
|
posterior in 95% ethanol | CO1: MT578891 16S: MT581181 | |
T. pastafariensis sp. nov. | CB055_18_06 | B2018-20 | CARNE529-21 |
|
anterior fixed for histology, and posterior in 95% ethanol | CO1: MT578892 18S: MT581210 28S: MT581196 |
CB055_18_07 | B2018-20 | CARNE530-21 |
|
whole body in 95% ethanol | CO1: MT578893 | |
CB055_18_08 | B2018-20 | CARNE531-21 |
|
whole body in 95% ethanol | CO1: MT578894 16S: OK073428 | |
SMCP0019 | BdT19-13 | CARNE532-21 |
|
anterior fixed for histology; posterior in 95% ethanol | CO1: MT578896 16S: MT581182 | |
CBdT0059 | BdT19-09 | CARNE573-21 |
|
anterior fixed for histology; posterior in 95% ethanol | CO1: MT578895 | |
T. paulayi sp. nov. | BOMAN_07013 | OM22-011A | NOMAN049-23 |
|
anterior and posterior fixed for histology; midbody in 95% ethanol | COI: OQ321715 18S: OQ322649 |
BOMAN_08291 | OM22-031B | NOMAN050-23 |
|
anterior and posterior fixed for histology; midbody in 95% ethanol | 18S: OQ322646 28S: OQ322592 | |
BOMAN_08284 | OM22-031B | NOMAN051-23 |
|
anterior fixed for histology, posterior in 95% ethanol | COI: OQ321720 | |
BOMAN_08302 | OM22-031B | NOMAN052-23 |
|
anterior fixed for histology, posterior in 95% ethanol | COI: OQ321722 | |
BOMAN-08289 | OM22-031C | – |
|
anterior and posterior fixed for histology; midbody in 95% ethanol | – | |
BOMAN-08301 | OM22-31B | – |
|
anterior and posterior fixed for histology; midbody in 95% ethanol | – | |
BOMAN-09064 | OM22-37B | – | OIMB | whole body in 95% ethanol, bulk | – | |
BOMAN-09065 | OM22-37B | – | OIMB | whole body in 95% ethanol, bulk | – | |
BOMAN-09066 | OM22-37B | – | OIMB | whole body in 95% ethanol, bulk | – | |
BOMAN-09067 | OM22-37B | – | OIMB | whole body in 95% ethanol, bulk | – | |
T. rubrolineata (Kirsteuer, 1965) | BOMAN_08053 | OM22-030B | NOMAN046-23 |
|
anterior fixed for histology, posterior in 95% ethanol | COI: OQ321714 |
BOMAN_08078 | OM22-022A | NOMAN047-23 |
|
anterior and posterior fixed for histology | COI: OQ321723 | |
BOMAN_08038 | OM22-022A | NOMAN048-23 |
|
anterior and posterior fixed for histology; midbody in 95% ethanol | COI: OQ321718 18S: OQ322650 28S: OQ322595 | |
T. sp. ETP001 | SMPP0632 | PP20 | NOPP001-21 | N/A | N/A | CO1: MT578897 16S: MT581183 18S: MT581211 28S: MT581197 |
T. unistriata sp. nov. | BOMAN_07032 | OM22-011A | NOMAN037-23 |
|
anterior and posterior fixed for histology | COI: OQ321719 |
490_070999_1 | JP99 | TETRW013-21 |
|
histological slides: cross sections of posterior; tissue in 95% ethanol | CO1: MT578861 16S: MT581158 18S: MT581198 28S: MT581184 | |
490_071099_2 | JP99 | TETRW014-21 |
|
histological slides: longitudinal sections of posterior; tissue in 95% ethanol | CO1: MT578862 18S: MT581199 28S: MT581185 | |
490_071099_3 | JP99 | TETRW015-21 |
|
histological sections of head and posterior | – |
Site | Date | Location | GPS | Habitat | Depth | Collectors |
---|---|---|---|---|---|---|
B2018-03B | 21 Aug 2018 | Hospital Point, Isla Solarte, Bocas del Toro, Panamá | 9.333755, -82.218583 | coral rubble | 1–2 m | Megan Schwartz et al. |
B2018-04 | 22 Aug 2018 | Wild Cane Key, Isla Bastimentos, Bocas del Toro, Panamá | 9.348691, -82.168114 | coral rubble | 5–7 m | Svetlana Maslakova, Maycol Madrid |
B2018-20 | 28 Aug 2018 | Hospital Point, Isla Solarte, Bocas del Toro, Panamá | 9.333755, -82.218583 | coral rubble | 1–2 m | Megan Schwartz et al. |
B2018-21 | 22 Aug 2018 | Mangrove Point, Isla Colon, Bocas del Toro, Panamá | 9.327247, -82.253636 | coral rubble | 1–2 m | Irina Cherneva, Eduardo Zattara, Christina Ellison |
BdT03 | 2-3 Aug 2003 | Bocas del Toro, Panamá | N/A | N/A | N/A | Jon Norenburg |
BdT03R | 3 Aug 2003 | Cayo Roldan, Bocas del Toro, Panamá | N/A | N/A | N/A | Jon Norenburg |
BdT19-08 | 8 Aug 2019 | Playa Escondida 2, Isla Colón, Bocas del Toro, Panamá | 9.379778, -82.238778 | sandy-muddy beach with rocks | 1–2 m | Christina Ellison, Maycol Madrid |
BdT19-09 | 9 Aug 2019 | Playa Boca del Drago, Isla Colón, Bocas del Toro, Panamá | 9.414639, -82.331167 | sandy beach with rocks, rubble | 1–2 m | Christina Ellison, Maycol Madrid |
BdT19-13 | 26 Aug 2019 | Cayo Coral, Isla Bastimentos, Bocas del Toro, Panamá | 9.243583, -82.111972 | very lively reef, with lots of green calcareous (and other types of) algae | 7–8 m | Svetlana Maslakova, Deyvis González, Christina Ellison |
BdT19-19 | 3 Sep 2019 | Fuerte Sherman, Colón, Panamá | 9.3532872, -79.9449529 | fossil reef, silted coral rubble, mostly solid | 3–4 m | Svetlana Maslakova, Maycol Madrid |
BdT19-20 | 4 Sep 2019 | Drake Island, Portobelo, Colón, Panamá | 9.561389, -79.685 | Live reef with lots of Agaricia rubble | 12 m | Svetlana Maslakova, Maycol Madrid |
BdT19-21 | 4 Sep 2019 | Huerta, Portobelo, Colón, Panamá | 9.561944, -79.681389 | Live reef with lots of Agaricia rubble | 8–15 m | Svetlana Maslakova, Maycol Madrid |
BdT19-25 | 10 Sep 2019 | Playa Boca del Drago, Isla Colón, Bocas del Toro, Panamá | 9.414639, -82.331167 | Sandy beach, intertidal/shallow subtidal – rocks, rubble | 1–2 m | Christina Ellison, Maycol Madrid |
CBC02 | 12 Jun 2002 | Carrie Bow Cay, Belize | N/A | coral rubble with orange sponge | 30 m | Megan Schwartz Jon Norenburg |
DR23 | 25 Sep 2011 | Alboran Island, Spain | 35.932167, -3.040333 | coralline red algae and Ulva | 25 m | Juan Junoy |
GM06 | 26 Jul 2006 | NSF III Sta. 89, Northern Gulf of Mexico | 27.9850, -91.6295 | shell riddled with sponge (collected with box dredge) | 65–71 m | Jon Norenburg |
JP99 | 9-10 Jul 1999 | Engetsu Island, Shirahama, Wakayama, Japan | 33.689, 135.336 | among calcareous algae | 1–2 m | Svetlana Maslakova, Megan Schwartz |
OM22-011A | 11 Jan 2022 | Hamdis, Mirbat, Dhofar, Oman | 16.94735, 54.76255 | coral rubble | 4–9 m | Svetlana Maslakova |
OM22-022A | 16 Jan 2022 | Hamdis, Mirbat, Dhofar, Oman | 16.94735, 54.76256 | coral rubble | 6 m | Svetlana Maslakova, Gustav Paulay |
OM22-030B | 19 Jan 2022 | Michel’s Reef, Mirbat, Dhofar, Oman | 16.94332, 54.73005 | shell hash | 30 m | Svetlana Maslakova |
OM22-031B | 20 Jan 2022 | Inshore of Chinese Wreck, Mirbat, Dhofar, Oman | 16.96612, 54.70797 | scraped sample of vermetid/coralline algae encrustation | 2 m | Svetlana Maslakova, Gustav Paulay |
OM22-031C | 20 Jan 2022 | Inshore of Chinese Wreck, Mirbat, Dhofar, Oman | 16.96612, 54.70798 | algal holdfasts | 2 m | Svetlana Maslakova, Gustav Paulay |
OM22-037B | 22 Jan 2022 | Roshan Reef, Mirbat, Dhofar, Oman | 16.96852, 54.69022 | from barnacle and algae scraping | 7–8 m | Gustav Paulay |
OM22-051B | 26 Jan 2022 | Chinese Wreck, Mirbat, Dhofar, Oman | 16.96612, 54.70797 | coral rubble | 3–5 m | Svetlana Maslakova, Gustav Paulay |
PP20 | 20 Jan 2020 | Isla Pachequilla, Panamá, Panamá | 8.67231, -79.0605 | coral rubble | 5 m | Christina Ellison, Maycol Madrid |
PR | Aug 2011 | Vieques, Puerto Rico | N/A | N/A | 0–2 m | Megan Schwartz |
Total genomic DNA was extracted using DNEasy Blood and Tissue Kit (Qiagen). DNA extracts are kept in the Maslakova lab at the Oregon Institute of Marine Biology. Partial sequences of two mitochondrial genes, Cytochrome Oxidase I (COI) and 16S rDNA, and two nuclear genes, 18S rDNA and 28S rDNA, were PCR-amplified using primers listed in Table
Gene | Primer | Sequence | Annealing T | Source |
---|---|---|---|---|
COI | LCO1490 | 5’ GGTCAACAAATCATAAAGATATTGG | 43–45 °C |
|
HCO2198 | 5’ TAAACTTCAGGGTGACCAAAAAATCA |
|
||
COI | CO1LF | 5’ TTTCAACAAATCATAAAGATAT | 43–45 °C | Norenburg, unpublished |
CO1DR | 5’ GAGAAATAATACCAAAACCAGG | Norenburg, unpublished | ||
16S rRNA | 16SARL | 5’ CGCCTGTTTATCAAAAACAT | 45–50 °C |
|
16SBRH | 5’ CCGGTCTGAACTCAGATCACGT |
|
||
16S rRNA | 16SAF | 5’ TCGTCTGTTTATCAAAAACATAGY | 45–50 °C | Norenburg unpublished |
16SKR | 5’ AATAGATAGAAACCAACCTGGC | Norenburg unpublished | ||
18S rRNA | 18SF1 | 5’ CTGGTGCCAGCAGCCGCGGYAA | 55 °C |
|
18SRC2 | 5’ TCCGTCAATTYCTTTAAGTT |
|
||
28S rRNA | LSU3 | 5’ TCCTGAGGGAAACTTCGG | 55 °C |
|
LSU5 | 5’ ACCCGCTGAAYTTAAGCA |
|
COI, 16S, 18S, and 28S sequences for the palaeonemerteans Cephalothrix bipunctata and Carinoma sp. and for the hoplonemerteans Paradrepanophorus crassus, Prostoma eilhardi, Nemertopsis bivittata, Zygonemertes albida, Ototyphlonemertes pallida, Potamonemertes percivali, Antarctonemertes riesgoae, Vieitezia luzmurubeae, Oerstedia sp., and Tetranemertes antonina were downloaded from GenBank (see Table
Species | MCZ-IZ# | CO1 | 16S | 18S | 28S | Source |
---|---|---|---|---|---|---|
Cephalothrix bipunctata | 133009 | KF935501 | KF935447 | KF935279 | KF935335 |
|
Carinoma sp. | 135341 | KF935500 | KF935446 | KF935278 | KF935334 |
|
Antarctonemertes riesgoae Taboada et al., 2013 | 134229 | KF935538 | KF935490 | KF935322 | KF935378 |
|
Nemertopsis bivittata | MK047680 | MK067304 | MK076305 | MK076426 |
|
|
Oerstedia sp. | 132740 | KF935535 | KF935487 | KF935319 | KF935375 |
|
Ototyphlonemertes pallida | 133745 | KF935545 | KF935496 | KF935329 | KF935385 |
|
Paradrepanophorus crassus | DNA104800 | HQ848603 | JF277628 | JF293008 | HQ856867 |
|
Potamonemertes percivali | 25172 | KF935532 | KF935483 | KF935316 | KF935372 |
|
Prostoma eilhardi (Montgomery, 1894) | DNA103928 | HQ848594 | JF277620 | JF293027 | HQ856875 | Andrade et al. 2011 |
Tetranemertes antonina | 132747 | KF935534 | KF935318 | KF935374 |
|
|
Tetranemertes bifrost sp. nov. | 133023 | KF935533 | KF935484 | KF935317 | KF935373 |
|
Vieitezia luzmurubeae Junoy, Andrade & Giribet, 2010 | 133740 | KF935544 | KF935495 | KF935328 | KF935384 |
|
Zygonemertes albida Coe, 1901 | MK047684 | MK067308 | MK076309 | MK076430 |
|
Alignment of four phylogenetic markers from a total of 32 specimens (13 from GenBank and 19 newly sequenced) yielded four multiple sequence alignments (MSAs; COI: 709 bp; 16S: 563 bp; 18S: 1820 bp; 28S: 3306 bp), which were concatenated into a single MSA 6380 bp long. The MSA was used as input for maximum likelihood (ML) and Bayesian (BI) phylogenetic inference. The resulting ML and BI trees are mostly congruent and well supported (Fig.
Phylogeny and species delimitation of Tetranemertes A maximum Likelihood phylogeny based on concatenated dataset of Cytochrome Oxidase I, 16S rRNA, 18S rRNA and 28S rRNA sequences. Clade support is shown as likelihood as well as posterior probability (from Bayesian analysis) B ABGD grouping tree C histogram of pairwise distances calculated from partial Cytochrome Oxidase I multiple alignment, showing intraspecific and interspecific pairs.
To test if patterns of genetic divergence agreed with morphologically defined species, additional COI sequences were obtained from Tetranemertes pastafariensis sp. nov., T. majinbuui sp. nov., T. bifrost sp. nov., T. arabica sp. nov., T. unistriata sp. nov., T. rubrolineata sp. nov., and T. paulayi sp. nov. individuals and added to the existing COI MSA. After removing all non-Tetranemertes sequences and trimming off low coverage ends, the resulting 49-sequence, 627-bp length MSA was used as input for an automated barcoding gap analysis (ABGD). ABDG analyses with and without recursion strongly supported a total of ten different groups, each of them matching morphological species hypotheses (Fig.
Averaged Jukes-Cantor distances for all possible pairwise intraspecific (diagonal, bold) and interspecific (above diagonal) comparisons of Cytochrome Oxidase I sequences of Tetranemertes species. Assignments based on morphological species hypotheses. The asterisk (*) marks species represented by sequence data for only one individual.
T. antonina | T. arabica | T. bifrost | T. majinbuui | T. ocelata | T. pastafariensis | T. paulayi | T. rubrolineata | T. ETP001 | T. unistriata | |
---|---|---|---|---|---|---|---|---|---|---|
T. antonina | * | 0.148 | 0.146 | 0.127 | 0.127 | 0.142 | 0.114 | 0.138 | 0.135 | 0.148 |
T. arabica | 0.000 | 0.133 | 0.110 | 0.113 | 0.120 | 0.129 | 0.112 | 0.101 | 0.098 | |
T. bifrost | 0.001 | 0.118 | 0.129 | 0.128 | 0.146 | 0.123 | 0.077 | 0.113 | ||
T. majinbuui | 0.015 | 0.122 | 0.129 | 0.128 | 0.136 | 0.103 | 0.126 | |||
T. ocelata | 0.002 | 0.119 | 0.132 | 0.117 | 0.123 | 0.115 | ||||
T. pastafariensis | 0.001 | 0.159 | 0.123 | 0.127 | 0.131 | |||||
T. paulayi | 0.002 | 0.143 | 0.120 | 0.163 | ||||||
T. rubrolineata | 0.000 | 0.130 | 0.103 | |||||||
T. sp. ETP001 | * | 0.125 | ||||||||
T. unistriata | 0.015 |
Class Hoplonemertea Hubrecht, 1879
Order Monostilifera Brinkmann, 1917
Family Oerstediidae Chernyshev, 1993
Tetranemertes antonina (Quatrefages, 1846), by monotypy.
Body long and thin, thread-like; head not demarcated from body; numerous ocelli arranged in four longitudinal rows (two on each side of head, the two rows almost on top of one another); cerebral organs small, located far in front of brain; a pair of shallow oblique or transverse cerebral organ furrows restricted to ventral and lateral surfaces, fused mid-ventrally forming a single furrow; cerebral commissures unusually short and wide; lateral nerve cords with a single fibrous core; longitudinal musculature anteriorly divided by a layer of connective tissue, only the inner layer contributes to proboscis insertion, i.e. precerebral septum lacking; rhynchocoel between 1/5 and 1/3 of body length; proboscis short and thin, with a neural sheath rather than distinct proboscis nerves; anterior proboscis very short, stylets located very close to head, often within a few millimeters of cerebral ganglia. The seven new species described below, as well as Tetranemertes rubrolineata, possess an unusual character of having the central stylet’s basis posteriorly slightly bilobed to deeply forked in fully grown individuals.
The genus includes ten described species: Tetranemertes antonina (Quatrefages, 1846), T. rubrolineata (Kirsteuer, 1965), T. hermaphroditica (Gibson, 1982), T. bifrost sp. nov., T. majinbuui sp. nov., T. pastafariensis sp. nov., T. unistriata sp. nov., T. ocelata sp. nov., T. paulayi sp. nov., T. arabica sp. nov., and one undescribed species (Tetranemertes sp. ETP001). Ommatoplea ophiocephala Schmarda, 1859 from South Africa, previously synonymized with T. antonina by
Mediterranean Sea (Banyuls, Trieste, Sicily, Naples, Alborán Island, Almería, Strait of Gibraltar), Caribbean Sea (Bocas del Toro, Panamá; Carrie Bow Cay, Belize; Puerto Rico, USA), western Indian Ocean (Madagascar), Arabian Sea (Dhofar Governorate, Oman), Western Pacific (Heron Island, Australia and Honshu Island, Japan), Eastern Tropical Pacific (Panamá).
The name refers to the number of times the genus Nemertes was re-defined: Nemertes Cuvier, 1817, Nemertes Johnston, 1837, Nemertes Friedrich, 1955, and Nemertes Kirsteuer, 1974.
Nemertes antonina
Quatrefages, 1846: 111;
Eunemertes antonina:
Emplectonema antonina:
Polia antonina:
Type material was never designated, and it is very unlikely that either Quatrefages’ or Bürger’s specimens exist or can be found. With the purpose of improving nomenclatural stability, we designate the following specimen examined by us as the neotype: Indemares-Alborán Campaign Sample TE3-DR23 (Fig.
Tetranemertes antonina A external appearance of T. antonina, after
Uniformly dark pink (wine) color of the body of living specimens distinguishes T. antonina from most species of the genus except T. hermaphroditica, T. arabica sp. nov. and T. majinbuui sp. nov. Tetranemertes antonina, T. majinbuui sp. nov., T. arabica sp. nov., and T. hermaphroditica are widely separated geographically, and T. antonina, T. arabica sp. nov., and T. majinbuui sp. nov. are also easily differentiated by DNA barcodes (Table
Mediterranean Sea (Banyuls, Trieste, Sicily, Gulf of Naples, Alborán Island, Almería, Strait of Gibraltar).
Unknown, but appears to be a derivative of a person’s name.
The original description (
Nemertes rubrolineata
Kirsteuer, 1965: 316;
The holotype (in the form of histological sections on slides) deposited at the American Museum of Natural History in New York, USA (AMNH 276) was not examined, as external features and stylet characteristics are not discernible in this material. It is not possible to extract DNA from this material. SAM examined several live specimens from the Arabian Sea (Mirbat, Dhofar Governorate, Oman), which conform to the description of T. rubrolineata. See Table
Body color of living specimens (white or yellowish, with a single, longitudinal, wine-red, dorsal stripe) distinguishes T. rubrolineata from all other described species of the genus except T. unistriata sp. nov. (a look-alike described below). Basis of central stylet thick and bilobed posteriorly (
At the type locality (Madagascar) relatively common on Acropora cytherea (Dana, 1846) (syn. Acropora corymbosa), Acropora pharaonis (Milne Edwards, 1860), Seriatopora hystrix Dana, 1846 (syn. Seriatopora angulata), and Porites nigrescens Dana, 1846. In southern Oman (Mirbat) among coral and shell rubble at 8–30 m depth.
Madagascar (Tanikely Island, Mozambique Channel), and Arabian Sea (southern Oman).
The species epithet refers to the color pattern of living specimens, specifically the red, mid-dorsal, longitudinal stripe.
SAM collected several specimens resembling T. rubrolineata in southern Oman (vicinity of Mirbat) in January 2022 (Fig.
Tetranemertes rubrolineata from the Arabian Sea (Oman). Individual BOMAN-8038 A external appearance in life B head in transmitted light, showing number and distribution of ocelli, as well as ventral cephalic furrow (arrowheads) C stylet armature. Abbreviations: cg — cerebral ganglion, co — cerebral organ. Scale bars: 4 mm (A); 0.25 mm (B); 50 μm (C).
Nemertes hermaphroditicus Gibson, 1982: 227.
No specimens of this species were available to us for morphological examination or DNA barcoding. Type material consists of the holotype: mature individual, full series of transverse and oblique sections, deposited at the Australian Museum, in Sydney, Australia (W.5880), collected by R. Gibson, 13 July 1975, western mid-reef flat, Heron Island, Capricorn Group.
Body color of living specimens dusky pink overall with translucent and colorless body margins, resembling T. antonina, T. arabica sp. nov., and T. majinbuui sp. nov. Tetranemertes hermaphroditica is the only species in the genus known to be a simultaneous hermaphrodite. Basis of central stylet is described to be cylindrical and rounded posteriorly, similar to that reported by
Beneath a large fragment of dead coral (Acropora sp.) partially embedded in clean coral sand.
Heron Island, Australia.
The specific name refers to the fact that specimens of this species are hermaphrodites. Note that both Nemertes and Tetranemertes are of female gender (Nemertes is a Greek nymph, daughter of the god Nereus). Consequently, the correct Latin ending of the specific epithet should be -a, not -us.
Type material in the form of histological sections, anterior end preserved for histology, and tissue in 95% ethanol is deposited with the Smithsonian Institution’s National Museum of Natural History: holotype CB057_18_07 (
Tetranemertes bifrost sp. nov. differs from all other species of this genus by its distinctive color: purple to black dorsally, with a pattern of bright iridescent longitudinal stripes and spots, which may appear blue, green, yellow and orange, depending on the type of lighting, background, and individual, and blue ventrally. Additionally, it differs from T. antonina, T. hermaphroditica, and T. paulayi sp. nov. by basis of central stylet posteriorly forked, and from the first two species by having stylets sculpted with spiral groves. At the molecular level, COI barcodes of sequenced specimens clearly differentiate it from other species of Tetranemertes (Table
External appearance of live specimens. Long, thin, thread-like body. Can stretch much more than 200 mm long, and up to 0.5 mm wide at the head; body up to 0.7 mm wide. Body slightly compressed dorso-laterally in cross-section throughout most of its length. The caudal end is rounded with no obvious modifications. Tetranemertes bifrost sp. nov. is, perhaps, the most spectacularly colored nemertean in the Caribbean, if not the world (Fig.
Tetranemertes bifrost sp. nov. A–C external appearance in life of individuals CBdT0062 (A), CB057_18_01 (B), and CB057_18_07 (C) showing variation in color D ventral view of anterior end of individual SMCP0366 showing cephalic furrow (arrowhead) E, F close up views of head in dorsal (E) and ventral (F) view of individual CB057_18_01 showing distribution of pigment, eyes, and the cephalic furrow (arrowhead on F) G anterior end of individual CB057_18_03 compressed under a glass slide to show number and distribution of eyes H, I stylets of individuals CB057_18_01 (H) and CB057_18_04 (I). Note the sculpted stylets, and the difference in basis shape (forked or rounded posteriorly). Abbreviations: cg — cerebral ganglion, pb — proboscis. Scale bars: 5 mm (A–C); 1 mm (D); 0.5 mm (E–G); 25 μm (H, I).
The head has a characteristic, narrow diamond or spearhead shape, vaguely reminiscent of a viper’s head, its anterior region demarcated from the rest of body both by width and a single ventral cephalic furrow, formed by the midventral fusion of the cerebral organ furrows. The cephalic furrow is located anterior to the cerebral ganglia, runs from the lateral sides toward the ventral midline forming a shallow forward-pointing “V”. Margins of the head are clear, translucent; the anterior-most mid-dorsal part of the head often reddish brown (Fig.
Numerous small reddish brown ocelli (10–20 on each side of head) are arranged in four longitudinal rows (Fig.
Cerebral organs are small and inconspicuous, difficult to see in living specimens, even when compressed under a glass slide and viewed under a compound microscope. Anterior to the cephalic furrow, the head is dorso-ventrally flattened; posterior to it, there is a dorsal bulge over the brain, and the body is rounder in cross-section than the anterior tip. The anterior margin of the head is bluntly pointed, indented anteriorly by the rhynchostomopore. The cerebral ganglia are clear, and are located at the base of the “spearhead”, connected by fairly wide cerebral commissures (Fig.
Rhynchocoel and proboscis. Rhynchocoel does not exceed 1/3 of body length. Proboscis transparent, with two distinctive regions separated by a stylet region. The anterior proboscis is much shorter than the posterior, and the stylet bulb has a length to width ratio of ~ 1. The proboscis is armed with a single central stylet and a pair of lateral pouches holding two accessory stylets each. The shaft of the stylet is straight, sculpted with longitudinal grooves, twisted into a slight spiral (Fig.
Reproduction. Oocytes, measuring 50–80 micron in diameter were noted in specimen CB057_18_03 collected in August 2018.
Free living, benthic marine worms inhabiting coral rubble, gravel, and shell hash. Often found stretched between nooks and crannies of the substratum.
Caribbean Sea: Bocas del Toro, Panamá, also common at Fuerte Sherman, Colon, Panamá; photographed off Puerto Rico, draped over an unknown fan coral (in 1970s by Smithsonian photographer Kjell Sandved).
The name refers to the bright, colorful iridescent stripes and spots characterizing this species. Bifrost, the rainbow bridge in the Norse mythology, reaches between Midgard, the human Earth, and Asgard, the realm of the gods. Some authors state that the name Bifrost means “shimmering path” or “the swaying road to heaven”, and that it might be inspired by the Milky Way.
Type material is deposited with the Smithsonian Institution’s National Museum of Natural History. Holotype CB056_18_01 (
Pink body color distinguishes T. majinbuui sp. nov. from T. bifrost sp. nov., T. rubrolineata, T. unistriata sp. nov., T. ocelata sp. nov., T. pastafariensis sp. nov., and T. paulayi sp. nov. It differs from T. antonina and T. hermaphroditica by having a posteriorly bilobed basis, and spirally sculpted shaft of stylet. It most resembles T. arabica sp. nov. from which it is widely separated geographically. It is currently unknown whether it has separate sexes; if so, then it would distinguish it from T. hermaphroditica, which is a simultaneous hermaphrodite. DNA barcodes characterize this species unambiguously, clearly differentiating it from all other sequenced species of the genus (Table
External appearance of live specimens. Long, thin, thread-like body. Can stretch much more than 10 cm, and is 0.3–0.5 mm wide at the head. Body rounded in cross-section throughout most of its length, but dorso-ventrally compressed in the head region anterior to the brain. The caudal end is bluntly rounded. Body color is uniform intense pink, paler towards the anterior end (Fig.
Tetranemertes majinbuui sp. nov. A external appearance in life of individual CB056_18_01 B–D Close ups of head of a living individual CBdT0058, showing eyes and cephalic furrow (arrowheads) in lateral (B) and dorsal (C) view. Note the cephalic furrow is on the ventral side, but shows through due to transparency of the body at the anterior end D Head compressed under a coverglass to show number and distribution of eyes E stylet armature of individual CB056_18_01 with a typical posteriorly bilobed basis F stylet armature of individual CBdT0058 with a less typical basis (not bilobed or forked posteriorly). Note helical sculpting of stylet shaft. Abbreviations: cg — cerebral ganglion, co — cerebral organ. Scale bars: 5 mm (A); 1 mm (B–D); 25 μm (E, F).
When placed in a dish, tangles into a writhing mass. Secretes transparent, sticky mucus when handled. Moves by ciliary gliding, often with the anterior end of the head raised at an angle from the surface, the inflection point coinciding with the lateral indentation of the transverse cephalic furrow. When mechanically perturbed, contracts forming a loose coil. The head region anterior to the cephalic furrow is less contractile, causing an obvious discontinuity in width when the animal is contracted. Regeneration ability not known. Blood is colorless.
Head is shaped like a narrow diamond or spearhead, vaguely reminiscent of a viper’s head. Anterior to the cephalic furrow, the head is dorso-ventrally compressed; posterior to it there is a dorsal bulge corresponding to the cerebral ganglia. The cerebral ganglia are clearly visible, transparent or very pale pink.
A single transverse cephalic furrow is formed by a pair of the cerebral organ furrows, fused mid-ventrally. The furrow starts laterally and continues toward the ventral midline, forming a very shallow forward-pointing “V”, anterior to cerebral ganglia (Fig.
Numerous reddish brown ocelli (~ 24 on each side of head) are arranged in four longitudinal rows (Fig.
Rhynchocoel and proboscis. Rhynchocoel does not exceed 1/3 of body length. The proboscis is translucent, with two distinctive regions separated by a stylet bulb. The anterior region is much shorter than the posterior, and the bulb has a length to width ratio of ~ 1. The proboscis is armed with a single central stylet and a pair of lateral pouches holding two accessory stylets each. The shaft of the stylet is straight, sculpted with spiral grooves (Fig.
Reproduction. No data.
Free living, benthic marine worms inhabiting coral rubble at shallow depths (1–7 m). Can be found stretching between nooks and crannies of the substratum.
Bocas del Toro, Panamá; Puerto Rico, USA.
The species is named after Majin Buu, a male (as far as we can tell) character in the anime Dragon Ball Z, due to its resemblance in color, presence of black dots at the anterior end, and behavior-dependent variability in body width.
Type material is deposited with the Smithsonian Institution’s National Museum of Natural History. Anterior ends are preserved for histology and posterior — in 95% ethanol: holotype CB055_18_04 (
Tetranemertes pastafariensis sp. nov. differs from all other described species of this genus, except T. ocelata sp. nov. by uniformly pale yellow to orangish yellow body color. It differs from T. ocelata sp. nov. by having smaller ocelli. Easily differentiated from other species with DNA sequence data (Table
External appearance of live specimens. Long, thin, thread-like body can stretch more than 10 cm in length and is up to 0.5 mm wide at the head; body up to 1 mm wide. Body rounded or slightly compressed in cross-section. The caudal end is rounded. Body color is uniform orangish yellow, paler towards the anterior end (Fig.
Tetranemertes pastafariensis sp. nov. A external appearance in life of individual CB055_18_04 B anterior end in ventral view of individual CB055_18_06 showing cephalic furrow (arrowhead, cf) C stylets of individual CB055_18_08 showing a posteriorly bilobed basis and sculpted stylets D head of individual CBdT0059 compressed under a glass slide showing number and distribution of eyes, as well as cerebral organs (arrowheads) and pinkish cerebral ganglia. Abbreviations: cg — cerebral ganglion, co — cerebral organ. Scale bars: 5 mm (A); 1 mm (B, D); 25 μm (C).
When placed in a dish, often forms a writhing tangle. When mechanically disturbed it contracts into a knot, and secretes transparent sticky mucus. Moves by ciliary gliding, often with the anterior end of the head raised from the surface, the inflection point coinciding with the lateral indentation of the anterior cephalic furrow. The head region anterior to the anterior furrow is less contractile, causing an obvious discontinuity in width when the anterior end of the animal is contracted. Regeneration ability not known.
The head is somewhat triangular, spear-shaped, resembling head of a snake. The anterior part of the head is demarcated from the body by both width and an anterior ventrolateral cephalic furrow. The body is dorso-ventrally flattened in front of the anterior cephalic furrow; and thicker posterior to it, with a dorsal bulge corresponding to the brain. The cerebral ganglia, tinged pale pinkish orange, are visible through the body wall. The anterior margin of the head is bluntly pointed, slightly indented by the rhynchostomopore.
Cerebral organ furrows are fused ventrally forming a single cephalic furrow (Fig.
Ocelli (20–40) are arranged in four longitudinal rows, two on each side of the head (Fig.
Rhynchocoel and proboscis. Rhynchocoel does not exceed 1/3 of body length. The proboscis is transparent, with two distinctive regions separated by a proboscis bulb. The anterior region is much shorter than the posterior, and the bulb has a length to width ratio of ~ 1. Proboscis armed with a single central stylet and two pouches, each holding two or three accessory stylets. The central stylet shaft is straight with spiral grooves. The stylet basis is rod-shaped, with a width to length ratio of ~ 1:4 to 1:5, with characteristic shallow fork posteriorly (Fig.
Reproduction. No data.
Free living, marine benthic species, inhabiting shallow coral reef rubble (1–7 m depth). Tends to stretch in the crannies of the substratum.
Currently only known from Bocas del Toro, Panamá.
The species is named after its resemblance to the Flying Spaghetti Monster, the deity of the Pastafarian religion.
Tetranemertes unistriata sp. nov. differs from most other described species of the genus by its color pattern: a single pale to dark pink mid-dorsal longitudinal stripe on a pale yellow to pale pinkish background. Resembles T. rubrolineata from Madagascar (
Type material in the form of histological sections and tissue in 95% ethanol is deposited with the Smithsonian Institution’s National Museum of Natural History. Holotype: 490_071099_2 (
External appearance of live specimens. Body thin, thread-like, a few centimeters in length, and less than a millimeter in width. Anterior and posterior ends are gently tapering, bluntly rounded. Color in life varies from pale yellowish orange to pale pink, with a continuous thin reddish or dark pink mid-dorsal longitudinal stripe that reaches from anterior to posterior tip of body (Fig.
Tetranemertes unistriata sp. nov. A–E based on sketches from live material (individuals 490_070999_1 through 490_070999_3) from Japan A external appearance in life B diagram of head in ventro-lateral view showing cephalic furrow C stylet and basis D, E anterior end in dorsal (D) and lateral (E) views showing number and arrangement of eyes, and cerebral ganglia E stylet and basis F, G appearance in life of individual BOMAN-07032 from Oman: body shape (F), anterior end in incident light (G) showing size and position of cerebral ganglia and eyes, stylet apparatus (H), and compressed head region in transmitted light to show eye arrangement (I). Abbreviations: cf — cephalic furrow, cg — cerebral ganglion. Scale bars: 1 cm (A); 50 μm (C); 5 mm (F); 1 mm (G); 40 μm (H); 150 μm (I).
Rhynchocoel and proboscis. Rhynchocoel length unknown, but likely restricted to anterior-most region of body. Proboscis short and thin. Stylets were examined in one ~ 8-cm long individual (paratype) from Japan, and the ~ 2 cm long individual from Oman. Central stylet with a straight spirally sculpted shaft, 20–50 μm long. Basis cylindrical, deeply forked posteriorly, 25–75 μm long (Fig.
Reproduction. No data.
Free-living, marine. Among brown and branched calcareous algae at the depths of 1–2 m in the type locality in Japan. Among coral rubble at 4–9 m depths in Oman.
Type locality is near Seto Marine Laboratory on the Pacific coast of Honshu Island, Japan. One other individual was collected by SAM in the Arabian Sea (Dhofar Governorate, Oman).
Specific epithet reflects the color pattern of living individuals.
Tetranemertes ocelata sp. nov. differs from most other species of the genus by uniformly pinkish orange body color without distinct markings. It most resembles T. pastafariensis sp. nov., from which it differs by having much larger ocelli, and more intense color (pinkish orange as opposed to pale yellow). It differs from T. paulayi sp. nov. by having larger eyes, paler body color, and colorless blood. DNA sequences also clearly differentiate this species from all other sequenced species of the genus (Table
Type material in the form of histological sections is deposited with the Smithsonian Institution’s National Museum of Natural History: holotype 685_061202_2 (USNM1156296), paratype 685_061202_4 (
External appearance of live specimens. Body long and thin, thread-like, tangles easily, up to 12 cm long at rest, but can stretch up to 50 cm. Body width varies from 0.1 mm posteriorly to 0.7 mm in the head region. Head dorso-ventrally flattened; the rest of the body cylindrical in cross-section. Most of the time the worm remains loosely and irregularly tangled and coiled. The head contracts linearly when disturbed. Background color from very pale yellow to salmon color or deep pinkish orange (Fig.
Tetranemertes ocelata sp. nov. A external appearance in life B proboscis armature showing bilobed basis and sculpted stylets C head compressed under coverslip to show number and arrangement of eyes, cerebral organs and cerebral ganglia D head in ventro-lateral view showing eyes and the cephalic furrow (arrowhead). Abbreviations: cg — cerebral ganglion, co — cerebral organ. Scale bars: 1 mm (A); 50 μm (B); 0.2 mm (C, D).
Head slightly wider than adjacent body, triangular or spear-shaped, reminiscent of the shape of a snake’s head. Anterior tip of head bluntly rounded. Head demarcated from the body by a single shallow ventro-lateral cephalic furrow, formed by a pair of cerebral organ furrows meeting mid-ventrally, and creating an anteriorly directed “V” (Fig.
Ocelli are proportionally much larger than in other species of the genus, resemble those of cratenemertids and reptant polystiliferans, reddish brown in color, arranged in four rows (two on each side of head, almost directly on top of each other). Eyes of the more lateral/ventral rows are larger than the eyes in the medial/dorsal rows (Fig.
Cerebral ganglia large, translucent, with specks of pinkish pigment, and very wide commissures. Cerebral organs anterior to the cerebral ganglia, visible on squeeze preparations of the head (Fig.
Rhynchocoel and proboscis. Length of rhynchocoel unknown. Proboscis very short (a few mm long), restricted to the anterior-most part of body. Basis of central stylet long and cylindrical, variably rounded or slightly bilobed posteriorly . Shaft of central stylet straight, sculpted with weakly spiraling groves. Two accessory stylet pouches, each with two accessory stylets (Fig.
Reproduction. Reproductive specimens collected at Carrie Bow Cay, Belize in June 2002.
Subtidal coral and shell rubble (with significant quantity of orange sponge) at the depth of 20–71 m depth.
Caribbean Sea (Belize) and the Gulf of Mexico.
Specific epithet refers to the size of the ocelli, which are larger than in the other described species of this genus.
Tetranemertes paulayi sp. nov. differs from all other known species of the genus by its orange color, and reddish orange blood vessels. Also, all examined specimens of this species, including the largest, had a pear-shaped rounded basis of central stylet, never bilobed or forked, unlike in larger individuals of most other species of the genus that we have examined. DNA barcoding clearly shows that this species is distinct from the other representatives of the genus (Table
Type material in the form of anterior and posterior preserved for histology, and midbody in 95% ethanol is deposited with the Florida Museum of Natural History. Holotype: BOMAN_07013 (UFID 1055), paratype BOMAN_08291 (UFID 1118). See Table
External appearance of live specimens. Body is orange-colored (Fig.
Tetranemertes arabica sp. nov. and Tetranemertes paulayi sp. nov. from the Arabian Sea (Oman), and Tetranemertes sp. ETP001 from Eastern Tropical Pacific A–C Tetranemertes paulayi. Individual BOMAN-07013, holotype, external appearance in life (A), and head compressed under coverglass (B) to show number and arrangement of eyes, and cephalic furrow (arrowhead). Note orange blood vessels (inset, and white arrowheads). Individual BOMAN-08291, paratype (C), stylets, viewed through the body wall of an individual compressed under coverglass (hence the orange tinge), inset emphasizes sculpted stylets (individual BOMAN-08302) D–F Tetranemertes arabica. Individual BOMAN-09099, external appearance in life (D), proboscis armature (E). Inset on E shows sculpted stylets (individual BOMAN-08030). Individual BOMAN-08050, head compressed under coverslip to show arrangement of eyes (F). Note the pink tinge to the body wall and proboscis wall, and orangish cerebral ganglia G Tetranemertes sp. ETP001 from the Pacific coast of Panamá (individual SMPP0632). Scale bars: 3 mm (A); 0.2 mm (B, F); 50 μm (C and insets on C, E); 100 μm (E); 2 mm (D); 0.5 mm (G).
Rhynchocoel and proboscis. Rhynchocoel limited to the anterior-most part of the body (~ ¼ of body length). Proboscis is very short, with stylet region found immediately posterior to the cerebral ganglia. Basis of central stylet is consistently rounded, never forked or bilobed, even in the largest individuals (4–6 cm long). The stylet shaft is spirally sculpted (Fig.
Reproduction. No data.
Coral rubble, vermetid-coralline encrustations on rocks, algal holdfasts, barnacles, and algae, at depths of 0–13 m.
Currently only known from the Arabian Sea (Mirbat, Dhofar Governorate, Oman).
Species is named after Dr. Gustav Paulay for his outstanding contributions to studies of marine invertebrate diversity of the world.
Pink body color distinguishes T. arabica sp. nov. from T. bifrost sp. nov., T. rubrolineata, T. unistriata sp. nov., T. ocelata sp. nov., T. pastafariensis sp. nov., and T. paulayi sp. nov. It differs from T. antonina and T. hermaphroditica by having a basis posteriorly bilobed, stylet spirally sculpted. It most resembles T. majinbuui sp. nov. from which it is widely separated geographically. It is currently unknown whether it has separate sexes; if so, then it would distinguish it from T. hermaphroditica, a simultaneous hermaphrodite. DNA barcodes characterize this species unambiguously, clearly differentiating it from all other sequenced species of the genus (Table
Type material is deposited with the Florida Museum of Natural History. Holotype BOMAN_08050 (UFID 1087), in the form of anterior and posterior preserved for histology, and midbody in 95% ethanol, and paratype BOMAN_08300 (UFID 1085) in the form of anterior and posterior preserved for histology, and midbody in 95% ethanol. See Table
External appearance of live specimens. Body is pale to deep pink. Larger individuals have deeper coloration. Pink specks scattered throughout epidermis, as well in the stylet region of the proboscis. Body long and thin, thread-like, widest at the level of the cerebral ganglia and cephalic furrow (Fig.
Rhynchocoel and proboscis. Rhynchocoel and proboscis very short (< 1/3 body length), with stylets found within the anterior-most quarter of the body. All examined individuals (n = 8) possessed a posteriorly forked basis and spirally sculpted stylets (Fig.
Reproduction. Ripe males observed in January 2022.
Coral rubble, shell hash, rocks encrusted with coralline algae and vermetid tubes; between the depths of 2–30 m.
Currently only known from the Arabian Sea (Mirbat, Dhofar Governorate, Oman).
Species epithet refers to the type region of the species, the Arabian Sea (and the coast of the Arabian Peninsula).
A single individual of this species (SMPP0632) was extracted by CE from coral rubble collected by Maycol Madrid on 20 Jan 2020 at Isla Pachequilla (8.67231, -79.0605) from a depth of 5 m using SCUBA. Posterior end of specimen was missing. Partial specimen was 4–5 mm long and ~ 0.3 mm wide. Body uniformly pink with colorless margins and a single mid-dorsal longitudinal stripe, which is light in color and iridescent, similar to that seen in the Caribbean species Tetranemertes bifrost sp. nov. described above, and begins just posterior to the cephalic lobe. Four rows of pre-cerebral ocelli, two on each side, orange-red in reflected light, large in relation to head compared to other eumonostiliferan nemerteans. Head wider than body, diamond-shaped. Stylets not observed. Although we do not have a morphological voucher to designate the holotype and thus formally describe this species, DNA sequences clearly differentiate it from all other species of Tetranemertes (Table
The present study expands the number of known species within the genus Tetranemertes from three to 11, including seven newly described and one undescribed species. This is the first report of Tetranemertes species in the Caribbean Sea, the Gulf of Mexico, the North Pacific Ocean (Japan and Panamá), and the Arabian Sea (Oman). Ommatoplea ophiocephala described from South Africa by
The monophyly of the genus Tetranemertes is strongly supported by the molecular phylogenetic analyses, which include sequences from T. antonina, T. rubrolineata, the seven newly described species, as well as the undescribed species we report from the Pacific coast of Panamá. Tetranemertes hermaphroditica currently lacks DNA sequence data, and is included in the genus on morphological grounds alone. Although the genus lacks unique morphological synapomorphies, all included species are similar to T. antonina in body shape, morphology of cephalic furrows, distribution of ocelli, and possessing a relatively short rhynchocoel and proboscis. Furthermore, six of the seven new species described here, as well as T. rubrolineata, possess an unusual character of having a central stylet basis that is slightly bilobed to deeply forked posteriorly. Observed variation in the shape of the basis among individuals of T. bifrost sp. nov., T. majinbuui sp. nov., T. rubrolineata, T. unistriata sp. nov., and T. arabica sp. nov., with some individuals having a forked basis and others (usually with much smaller stylets) a posteriorly rounded basis, may reflect changes during ontogeny or regeneration of proboscis. The only species so far in which all examined individuals had rounded basis of central stylet is the undescribed species from Oman, T. paulayi sp. nov., which also has the unusual characteristic of having pigmented blood. A forked basis of central stylet may be a unique morphological synapomorphy of the genus, with T. paulayi sp. nov. representing a secondary loss of this feature.
The current revision of the genus Tetranemertes raises the number of known species from three to eleven, including seven newly described, and one undescribed species. Previously, DNA sequence data existed for only two species of the genus, T. antonina and T. bifrost sp. nov., the latter previously undescribed. We publish first DNA sequence data for one previously described, seven newly described, and one undescribed species; provide a revised morphological diagnosis of the genus, including a possible morphological synapomorphy of a forked basis of central stylet; and provide the first evidence of monophyly based on a multi-gene molecular phylogeny of the genus. New additions to the genus greatly expand the known geographic range of the genus from the Mediterranean, the Great Barrier Reef of Australia, and Madagascar to the Pacific coast of Japan, the Arabian Sea, Eastern Tropical Pacific, and the Caribbean Sea.
We are grateful to Rachel Collin, Maycol Madrid, Deyvis Gonzales, and other staff of the STRI Bocas Research Station and STRI Naos for logistical support. Sampling in Oman was made possible by NSF grant DEB-1856245 (PI Gustav Paulay) and the participants of Oman Bioblitz 2022. We are deeply indebted to Dr. Michel Claereboudt and Nancy Stauft for help with organization and logistics in Oman. Collection of material in Japan was made possible with the help of Dr. Hiroshi Kajihara. Sampling in the Mediterranean was supported by the European Project LIFE+INDEMARES. We are grateful to the reviewers and the subject editor for helping to improve our manuscript.
The authors have declared that no competing interests exist.
No ethical statement was reported.
This study was supported by the NSF grants DEB-1455283 and DEB-1856363 to SM, DEB-1456674 to Dr. Rachel Collin, DEB-9712463 to JN and Dr. Diana Lipscomb and DEB-1856245 to Dr. Gustav Paulay. EZ’s, ICs and CE’s work in Panamá was partly supported by Smithsonian Tropical Research Institute’s short-term fellowships.
Author contributions, according to role definition by CRediT (https://casrai.org/credit/), are as follows. IC: conceptualization, data curation, investigation, resources, visualization, writing — original draft. CE: data curation, investigation, resources. EZ: conceptualization, data curation, formal analysis, investigation, resources, visualization, writing — review and editing. JN: data curation, funding acquisition, investigation, resources. MS: data curation, resources. JJ: resources. SM: conceptualization, data curation, funding acquisition, investigation, supervision, project administration, resources, visualization, writing — original draft, review and editing.
Irina Cherneva https://orcid.org/0000-0002-5533-6527
Christina I. Ellison https://orcid.org/0000-0002-1856-386X
Eduardo E. Zattara https://orcid.org/0000-0002-9947-9036
Jon L. Norenburg https://orcid.org/0000-0001-7776-1527
Megan L. Schwartz https://orcid.org/0000-0001-5318-2838
Juan Junoy https://orcid.org/0000-0002-6125-558X
Svetlana A. Maslakova https://orcid.org/0000-0002-3629-6638
All of the data that support the findings of this study are available in the main text. Specimen data is available in the BOLD dataset https://dx.doi.org/10.5883/DS-TETRA.