Research Article
Print
Research Article
The systematic position of Cryptopotamon anacoluthon (Kemp, 1918), with the description of a new species of Sinolapotamon Tai & Sung, 1975 (Crustacea, Decapoda, Brachyura, Potamidae) from southern China
expand article infoYuan-Biao Lu‡, Yi-Xuan Zhang‡, Jie-Xin Zou‡§
‡ Nanchang University, Nanchang City, China
§ Jiangxi Provincial Key Laboratory of Experimental Animals, Nanchang City, China

Corresponding author: Jie-Xin Zou ( jxzou@ncu.edu.cn )

Academic editor: Sameer Pati
© 2023 Yuan-Biao Lu, Yi-Xuan Zhang, Jie-Xin Zou.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Lu Y-B, Zhang Y-X, Zou J-X (2023) The systematic position of Cryptopotamon anacoluthon (Kemp, 1918), with the description of a new species of Sinolapotamon Tai & Sung, 1975 (Crustacea, Decapoda, Brachyura, Potamidae) from southern China. ZooKeys 1166: 155-173. https://doi.org/10.3897/zookeys.1166.101737
ZooBank: urn:lsid:zoobank.org:pub:7BCF174D-E335-49B2-9799-4F7E99D01FB7
Open Access

Abstract

The systematics of the potamid freshwater crab Cryptopotamon anacoluthon (Kemp, 1918) is clarified, and its generic position in Sinolapotamon Tai & Sung, 1975, is confirmed based on morphological comparisons, geographical information and phylogenetic analyses. A new species of Sinolapotamon, Sinolapotamon cirratum sp. nov. is described from the Guangxi Zhuang Autonomous Region of China. Sinolapotamon cirratum sp. nov. is distinguished from its congeners by the combination of characters of its carapace, third maxilliped, anterolateral margin, and unique male first gonopod. Phylogenetic analyses based on partial COX1, 16S rRNA and 28S rRNA genes also support the species as new.

Key words

Freshwater crabs, molecular phylogeny, systematics, taxonomy

Introduction

Located in the southwest border region of China, with a warm climate, abundant precipitation, and a high percentage of forest coverage and karst landforms, Guangxi (Fig. 1) provides a suitable living environment for freshwater crabs. In China, which has the highest species richness of freshwater crabs globally (Cumberlidge et al. 2011), the species richness in Guangxi (43 species, including S. cirratum sp. nov.) is surpassing that of Taiwan (41 species) and only lower than that of Yunnan (74 species) (Chu et al. 2018; Wang et al. 2019; Cai et al. 2021). Rong County, situated in southeastern Guangxi and adjoining Guangdong Province, is the type locality of Sinolapotamon cirratum sp. nov. (Fig. 1). Hong Kong (Fig. 1), located in the south of China, consists of Hong Kong Island, Kowloon, the New Territories and 262 surrounding islands. The New Territories and Kowloon are connected to mainland China. It is worth noting that the New Territories is connected to Shenzhen, Guangdong Province.

Figure 1. 

Map showing collection sites of Sinolapotamon used in this study and the known collection sites of Cryptopotamon anacoluthon. Part of the studied region (Shenzhen and Hong Kong) is enlarged.

The genus Sinolapotamon Tai & Sung, 1975, was described, with the type species as Potamon (Geothelphusa) patellifer Wu, 1934 (type locality, Luocheng). Zhu et al. (2010) described two species of Sinolapotamon from Guangxi: S. auriculatum Zhu, Naruse & Zhou, 2010, from Shanglin, and S. palmatum Zhu, Naruse & Zhou, 2010, from Liuzhou (Fig. 1). There has been disagreement regarding the generic position of Cryptopotamon anacoluthon (Kemp, 1918). Ng and Dudgeon (1992), while describing Cryptopotamon Ng & Dudgeon, 1992, included only Potamon (Potamon) anacoluthon Kemp, 1918, from Hong Kong (Fig. 1). Dai (1999) pointed out that Cryptopotamon is a synonym of Sinolapotamon, considering that the differences between these two genera could only be regarded as interspecific differences. Ng et al. (2008), however, continued to place Potamon (Potamon) anacoluthon in Cryptopotamon. Based on phylogenetic methods, we reconstructed the phylogenetic relationships of Sinolapotamon, which confirm the generic position of Potamon (Potamon) anacoluthon in Sinolapotamon and recognize a new species. Sinolapotamon cirratum sp. nov. is described here based on morphology and genetic data.

Materials and methods

Specimens were collected from the Duqiaoshan Forest Park and Silaochong, both in Rong County, Yulin City, Guangxi Zhuang Autonomous Region, China. The two sites are so close that they appear as one dot in Fig. 1 (about 5 km). In addition, the sites of the specimens of C. anacoluthon referred to in Ng and Dudgeon (1992) were added to the map (Fig. 1). The two sites are: Tai Po Kau Forest Reserve stream, New Territories, Hong Kong; and the stream at Wu Kwai Sha, New Territories, Hong Kong. The linear distances from the ‘Shenzhen’ site to the two ‘Hong Kong’ sites are between 30–40 km (Fig. 1). Ethanol (95%) was used to preserve the collected specimens, which were deposited in the Department of Parasitology of the Medical College of the Nanchang University, Jiangxi, China (NCU MCP). Materials used herein, except for the new species and S. anacoluthon, are as follows: S. patellifer, 1 ♂, Yangshuo County, Guangxi Province, collection date not clear, NCU MCP 407301; S. auriculatum, 2 ♂♂, Shanglin County, Guangxi Province, July 2006, NCU MCP 72301, 72302; S. palmatum, 2 ♂♂, Liuzhou City, Guangxi Province, May 2018, NCU MCP 415301, 415302. Carapace width and length were measured in millimeters. The terminology used herein primarily follows that of Dai (1999) and Davie et al. (2015). The abbreviations used for the male first gonopod and male second gonopod are G1 and G2, respectively.

Approximately 50 mg of muscle tissue was excised from ambulatory legs. Total genomic DNA was extracted using the D3373-01 Mollusc DNA Kit (Omega Biotek, Inc., Norcross, USA). In our study, three fragments of target genes were amplified, including the mitochondrial COX1 and 16S rRNA genes and nuclear 28S rRNA gene. The primers and annealing temperatures used are presented in Table 1. Notably, the COX1 primers used were slightly modified based on the primers LCO1490 and HCO2198. A base T in the primer HCO2198 was replaced with a degenerate base Y (Folmer et al. 1994; Yang 2011). We performed phylogenetic analyses with the single-gene dataset (COX1) and 3-gene combined dataset (COX1, 16S rRNA and 28S rRNA). All molecular data are presented in Table 2. Sequences were aligned using ClustalW (Thompson et al. 2003), and the conserved regions were selected with Gblocks 0.91b (Castresana 2000) using the default settings. The optimal model for Bayesian inference (BI) analysis was determined using MrModeltest v. 2.3 (Nylander 2004) on the basis of the Akaike information criterion (AIC). The best-fitting model was GTR+G+I for both datasets. MrBayes v. 3.2.6 (Ronquist et al. 2012) was employed to perform BI analysis, and four Monte Carlo Markov chains of 2 000 000 generations were run with sampling every 1000 generations. The first 25% of generations were discarded as burn-in. Tracer v. 1.6 (Rambaut et al. 2013) was used to examine the sampling parameter. The optimal model, identified with MEGA X, for maximum likelihood (ML) analysis was also GTR+G+I for both datasets (Kumar et al. 2018). MEGA X was also employed to construct the ML tree based on 1000 bootstrap replicates and to calculate the pairwise distance based on the Kimura 2-parameter (K2P) model (Kumar et al. 2018). The map of the study area was prepared using ArcMap v. 10.2.

Table 1.
Download as
CSV
XLSX

Information on the primers used and annealing temperatures.

Gene Primer name Sequence 5’-3’ Product Length (bp) Annealing Temperature (°C) Reference
COI LCO1490 GGTCAACAAATCATAAAGATATTGG ~700 52 Folmer et al. (1994) and Yang (2011)
HCO2198’ TAAACTTCAGGGTGACCAAAAAAYCA
16S rRNA 1471 CCTGTTTANCAAAAACAT ~600 50 Crandall and Fitzpatrick (1996)
1472 AGATAGAAACCAACCTGG
28S rRNA F28S CAGCCCTAAGCAGGTGGTAAACT ~1000 53 Ji et al. (2016)
R28S CCATCTTTCGGGTCCCAACAT
Table 2.
Download as
CSV
XLSX

Collection information and GenBank accession number of the species used for phylogenetic analyses.

Species GenBank number Voucher number Locality Reference
Candidiopotamon okinawense Minei, 1973 COI, MN737145 – Okinawa, Japan Zhang et al. 2020
Candidiopotamon rathbunae (De Man, 1914) COI, AB433579 NCHU:ZOOL:13146 Taiwan Shih et al. 2011a
Chinapotamon depressum (Dai, Song, Li & Liang, 1980) COI, MZ350918 – Guangdong, China Pan et al. 2021
Geothelphusa dehaani (White, 1847) COI, AB187570 – Tokyo, Japan Segawa and Aotsuka 2005
Geothelphusa minei Shy & Ng, 1998 COI, AB625725 Gmn6 Ryukyu Shih et al. 2011b
Huananpotamon angulatum (Dai, Chen, Song, Fan, Lin & Zeng, 1979) COI, AB433576 NCHU:ZOOL:13139 Fujian, China Shih et al. 2011b
Nanhaipotamon guangdongense Dai, 1997 COI, MK226144 Ns7 Guangdong, China Huang et al. 2018
Nanhaipotamon hongkongense (Shen, 1940) COI, AB470509 Nh3 Hong Kong Shih et al. 2011b
Nanhaipotamon pingyuanense Dai, 1997 COI, AB470513 Npy3 Guangdong, China Shih et al. 2011b
Neotiwaripotamon jianfengense Dai & Naiyanetr, 1994 COI, MZ350933 – Hainan, China Pan et al. 2021
Sinopotamon yaanense (Chung & Ts’ao, 1962) COI, LC155173 SC8 Sichuan, China Shih et al. 2016
Longpotamon nanlingense (Dai & Jiang, 1991) COI, LC155196 SPx173 Hunan, China Shih et al. 2016
Cantopotamon zhuhaiense Huang, Ahyong & Shih, 2017 COI, LC342051 SYSBM:1439 Guangdong, China Huang et al. 2017
Parapotamon spinescens (Calman, 1905) COI, LC155209 PP4 Yunnan, China Shih et al. 2016
Tenuilapotamon latilum (Chen, 1980) COI, LC155206 TNL1 Hubei, China Shih et al. 2016
Tiwaripotamon edostilus Ng & Yeo, 2001 COI, AB896762 TWs6 Haiphong, Vietnam Shih and Do 2014
Tiwaripotamon pingguoense Dai & Naiyanetr, 1994 COI, LC145315 TWs13 Guangxi, China Van et al. 2016
Yarepotamon gracillipa (Dai, Song, Li & Liang, 1980) COI, AB433577 – Guangxi, China Direct Submission
Apotamonautes hainanensis (Parisi, 1916) COI, MN737137 – Hainan, China Zhang et al. 2020
Chinapotamon maolanense Zou, Bai & Zhou, 2018 COI, MT134100 – Guizhou, China Cui et al. 2020
Indochinamon chinghungense (Dai, Song, He, Cao, Xu & Zhong, 1975) COI, MZ350925 – Yunnan, China Pan et al. 2021
Indochinamon daweishanense (Dai, 1995) COI, MZ350926 – Yunnan, China Pan et al. 2021
Potamiscus yiwuensis Dai & Cai, 1998 COI, MN737136 – Yunnan, China Zhang et al. 2020
Qianguimon elongatum Huang, 2018 COI, MZ350943 – Guizhou, China Pan et al. 2021
Vadosapotamon sheni (Dai & Chen in Dai, Chen, Liu, Luo, Yi, Liu, Gu & Liu, 1990) COI, MZ350958 – Sichuan, China Pan et al. 2021
Longpotamon yangtsekiense (Bott, 1967) COI, EU676302 TB5 China Direct Submission
Tenuilapotamon joshuiense (Dai, Song, He, Cao, Xu & Zhong, 1975) COI, MZ350951 – Hunan, China Pan et al. 2021
Neotiwaripotamon whiteheadi (Parisi, 1916) COI, MZ350934 – Hainan, China Pan et al. 2021
Huananpotamon lichuanense Dai, Zhou & Peng, 1995 COI, MN737141 – Jiangxi, China Zhang et al. 2020
Johora singaporensis Ng, 1986 COI, MG010237 JSIN_BTM01 Singapore Tay et al. 2018
S. cirratum sp. nov. COI, OP425670 Slsp01 Guangxi, China This study
COI, OP425672 Slsp02 Guangxi, China This study
COI, OP425671 Slsp03 Guangxi, China This study
S. auriculatum Zhu, Naruse & Zhou, 2010 COI, OP425667 Slac01 Guangxi, China This study
COI, OP376822 Slpm02 Guangxi, China This study
S. anacoluthon (Kemp, 1918) COI, OP425668 Slal01 Guangdong China This study
COI, OP425669 Slal02 Guangdong China This study
S. patellifer (Wu, 1934) COI, MK883709 – Guangxi, China Ji et al. 2019
Candidiopotamon okinawense Minei, 1973 16S, AB208627 Co Okinawa, Japan Shih et al. 2006
Candidiopotamon rathbunae (De Man, 1914) 16S, AB208589 TPWL1 Taiwan Shih et al. 2006
Chinapotamon depressum (Dai, Song, Li & Liang, 1980) 16S, KT586287 – Guangxi, China Ji et al. 2016
Geothelphusa dehaani (White, 1847) 16S, AB535460 Gd21 Kagoshima, Japan Ng et al. 2010
Geothelphusa minei Shy & Ng, 1998 16S, AB625677 Gmn8 Ryukyu Shih et al. 2011b
Huananpotamon angulatum (Dai, Chen, Song, Fan, Lin & Zeng, 1979) 16S, AB433555 NCHU:ZOOL:13139 Fujian, China Shih et al. 2011b
Nanhaipotamon hongkongense (Shen, 1940) 16S, AB212869 NHHK Hong Kong Shih et al. 2005
Nanhaipotamon pingyuanense Dai, 1997 16S, AB265237 NPy Guangdong, China Shih et al. 2007
Neotiwaripotamon jianfengense Dai & Naiyanetr, 1994 16S, KT586289 – Hainan, China Ji et al. 2016
Sinopotamon yaanense (Chung & Ts’ao, 1962) 16S, KT586263 02 Sichuan, China Ji et al. 2016
Longpotamon nanlingense (Dai & Jiang, 1991) 16S, KT586180 01 Hunan, China Ji et al. 2016
Tenuilapotamon latilum (Chen, 1980) 16S, AB428468 – Hubei, China Shih et al. 2009
Longpotamon yangtsekiense Bott, 1967 16S, KT586268 02 Jiangsu, China Ji et al. 2016
Tenuilapotamon joshuiense (Dai, Song, He, Cao, Xu & Zhong, 1975) 16S, ON024657 NCU MCP 430301 Hunan, China Direct Submission
S. cirratum sp. nov. 16S, OP467587 Slsp01 Guangxi, China This study
16S, OP467588 Slsp02 Guangxi, China This study
16S, OP467584 Slsp03 Guangxi, China This study
S. auriculatum Zhu, Naruse & Zhou, 2010 16S, OP467583 Slac01 Guangxi, China This study
16S, OP467590 Slpm02 Guangxi, China This study
S. anacoluthon (Kemp, 1918) 16S, OP467585 Slal01 Guangdong, China This study
16S, OP467586 Slal02 Guangdong, China This study
S. patellifer (Wu, 1935) 16S, MK883709 – Guangxi, China Ji et al. 2019
Candidiopotamon okinawense Minei, 1973 28S, AB503625 Co Okinawa, Japan Direct Submission
Candidiopotamon rathbunae (De Man, 1914) 28S, AB503628 Cr Taiwan Direct Submission
Chinapotamon depressum (Dai, Song, Li & Liang, 1980) 28S, KT586427 – Guangxi, China Ji et al. 2016
Geothelphusa dehaani (White, 1847) 28S, AB503607 Gdmms Kagoshima, Japan Direct Submission
Geothelphusa minei Shy & Ng, 1998 28S, AB503619 GmnIG Okinawa, Japan Direct Submission
Huananpotamon angulatum (Dai, Chen, Song, Fan, Lin & Zeng, 1979) 28S, AB576807 Hua2 Fujian, China Shih et al. 2011b
Nanhaipotamon hongkongense (Shen, 1940) 28S, AB551401 Nh3 Hong Kong Shih et al. 2011b
Nanhaipotamon pingyuanense Dai, 1997 28S, AB551405 Npy2 Guangdong, China Shih et al. 2011b
Neotiwaripotamon jianfengense Dai & Naiyanetr, 1994 28S, KT586429 – Hainan, China Ji et al. 2016
Sinopotamon yaanense (Chung & Ts’ao, 1962) 28S, KT586416 04 Sichuan, China Ji et al. 2016
Longpotamon nanlingense (Dai & Jiang, 1991) 28S, KT586368 01 Hunan, China Ji et al. 2016
Tenuilapotamon latilum (Chen, 1980) 28S, MW540828 NCU MCP 66301 Hubei, China Direct Submission
Longpotamon yangtsekiense (Bott, 1967) 28S, KT586417 02 Jiangsu, China Ji et al. 2016
Tenuilapotamon joshuiense (Dai, Song, He, Cao, Xu & Zhong, 1975) 28S, ON033004 NCU MCP 430301 Hunan, China Direct Submission
S. cirratum sp. nov. 28S, OP578215 Slsp01 Guangxi, China This study
28S, OP578219 Slsp02 Guangxi, China This study
28S, OP578212 Slsp03 Guangxi, China This study
S. auriculatum Zhu, Naruse & Zhou, 2010 28S, OP578218 Slac01 Guangxi, China This study
28S, OP578217 Slpm02 Guangxi, China This study
S. anacoluthon (Kemp, 1918) 28S, OP578213 Slal01 Guangdong, China This study
28S, OP578214 Slal02 Guangdong, China This study
S. patellifer (Wu, 1936) 28S, OP578216 Slpl01 Guangxi, China This study

Results

Systematics

Family Potamidae Ortmann, 1896

Sinolapotamon Tai & Sung, 1975

Cryptopotamon Ng & Dudgeon, 1992: 741, figs 3B, 4, 5.

Type species

Potamon (Geothelphusa) patellifer Wu, 1934, by original designation.

Sinolapotamon anacoluthon (Kemp, 1918)

Figs 2, 7C

Potamon (Potamon) anacoluthon Kemp, 1918: 243, fig. 5.

Cryptopotamon anacoluthon Ng & Dudgeon, 1992: 741, figs 3B, 4, 5. — Ng et al. 2008: 161 (list).

Sinolapotamon anacoluthon Dai, 1999: 150, fig. 79.

Material examined

China • 4 ♂♂ (18.40 × 16.34 mm, 20.26 × 18.40 mm, 21.64 × 18.60 mm, 19.26 × 17.04 mm); Yangtaishan Forest Park, Shenzhen, Guangdong Province; 22.6587°N, 113.9837°E; July 2022; Sheng Yu leg.; NCU MCP 434001–434004 • 1 ♂ (25.84 × 22.76 mm); same collection data as above; NCU MCP 434101 • 3 ♀♀ (26.34 × 23.58 mm, 28.84 × 24.38 mm, 24.31 × 20.95 mm); same collection data as above; NCU MCP 434102–434104.

Diagnosis

Carapace gently convex, regions indistinct. Cervical groove shallow, indistinct; H-shaped groove depressed and distinct (Fig. 2A). Epigastric cristae weak, postorbital cristae flat, indistinct. External orbital angle triangular, with about 5 small granules. Epibranchial tooth sharp, distinctly separated with external orbital angle by V-shaped gap. Anterolateral margin of carapace cristate, with about 12 granules (Fig. 2A). Maxilliped 3 exopod reaching nearly 1/3 of merus length, with long flagellum (Fig. 2C). Chelipeds (pereiopod 1) strongly unequal (Fig. 2A, B, D). G1 slender, subterminal segment about 1.1 times as long as terminal segment; 2 lobes of terminal segment strongly unequal, dorsal lobe longitudinally extended, oval shaped, ventral lobe sharp and short, reaching 3/7 of terminal segment (Figs 2E, 7C).

Figure 2. 

Sinolapotamon anacoluthon, male (25.84 × 22.76 mm) (NCU MCP 434101) A overall dorsal habitus B overall ventral habitus C frontal view of cephalothorax D outer view of chelipeds E sternopleonal cavity with G1. Scale bars: 1 cm.

Ecology

The species is usually inhabiting the clear hill streams at an altitude below 50 m. Stones could serve as shelter and leaf mould could serve as food (Dai, 1999).

Distribution

China: Shenzhen of Guangdong Province (present record) and Hong Kong.

Remarks

The specimens from Shenzhen, with gently convex dorsal surface of carapace, indistinct postorbital cristae, sharp epibranchial tooth, unequal lobes of the terminal segment of the G1 (Fig. 2), and other characteristics, agree well with the descriptions and illustrations in Ng and Dudgeon (1992) and Dai (1999). The ratio of the subterminal segment to the terminal segment of G1 calculated in this study is 1.1 (Fig. 7C), which is equal to that in Dai (1999) and slightly smaller than that in Ng and Dudgeon (1992) (1.17). Although the specimens are not from Hong Kong, they could still be determined as S. anacoluthon based on morphological examination and the proximity of their collection site to Hong Kong (Fig. 1).

Ng and Dudgeon (1992) listed the differences between Cryptopotamon and Sinolapotamon, including carapace, epigastric cristae, postorbital cristae, epibranchial tooth, and the ratio of the subterminal segment to the terminal segment of the G1. We, however, noticed that those differences are interspecific, while two or more species sharing the same character state with the remaining species is not. For instance, S. anacoluthon has a gently convex carapace similar to that of S. cirratum sp. nov. but different from the remaining congeners (Figs 2A, 3A). The weak epigastric cristae of S. anacoluthon are consistent with those of S. auriculatum and S. cirratum sp. nov. (Fig. 2A; see Zhu et al. 2010: figs 1a, 6a). The indistinct postorbital cristae of S. anacoluthon are comparable with those of S. auriculatum and S. palmatum (Fig. 2A; see Zhu et al. 2010: figs 1a, 6a). The sharp epibranchial tooth is consistent with that of S. auriculatum (Fig. 2A; see Zhu et al. 2010: fig. 1a). The different ratios of the subterminal segment to the terminal segment of the G1 could only be regarded as interspecific differences. Most importantly, all five species have accordant fundamental types of G1 (Fig. 7).

Figure 3. 

Sinolapotamon cirratum sp. nov., holotype male (17.90 × 15.50 mm) (NCU MCP 434201) A overall dorsal habitus B frontal view of cephalothorax. Scale bars: 1 cm.

Sinolapotamon cirratum sp. nov.

https://zoobank.org/25AEC22F-BAAA-4DF5-8580-8334F8DBB9EC
Figs 3, 4, 5, 6, 7A, 8

Type material

Holotype : China • ♂ (17.90 × 15.50 mm); Guangxi Zhuang Autonomous Region, Yulin City, Rong County, Duqiaoshan Forest Park; 22.8019°N, 110.6098°E; October 2022; Yi-Xuan Zhang leg.; NCU MCP 434201. Paratypes: CHINA • 1 ♀ (17.42 × 15.45 mm); same collection data as for holotype; NCU MCP 433901 • 1 ♀ (23.74 × 20.30 mm); same collection data as for holotype; NCU MCP 433902 • 4 ♂♂ (22.54 × 19.55 mm, 22.92 × 19.80 mm, 23.05 × 20.24 mm, 18.00 × 16.02 mm); same collection data as for holotype; NCU MCP 433903–433906.

Other material

China • 7 ♂♂ (21.96 × 19.12 mm, 13.36 × 11.93 mm, 15.76 × 13.18 mm, 17.34 × 14.99 mm, 17.26 × 14.94 mm, 17.93 × 14.91 mm, 20.73 × 17.62 mm); same collection data as for holotype; NCU MCP 434202–434208 • 8 ♂♂ (14.99 × 12.90 mm, 9.48 × 8.65 mm, 9.61 × 8.54 mm, 9.81 × 8.91 mm, 8.71 × 7.53 mm, 8.82 × 7.77 mm, 9.74 × 7.38 mm, 10.42 × 8.79 mm); Guangxi Zhuang Autonomous Region, Yulin City, Rong County, Silaochong, small stream; 22.8263°N, 110.6065°E; November 2018; Jie-Xin Zou et al. leg.; NCU MCP 416001–416008.

Diagnosis

Carapace subquadrate, regions indistinct; dorsal surface gently convex, anterolateral region weakly rugose. Cervical groove shallow and wide; H-shaped groove shallow (Figs 3A, 5A). Epigastric cristae distinct, separated from postorbital cristae by narrow gap; epibranchial region slightly depressed; mesogastric region gently convex. External orbital angle triangular, distinctly separated from anterolateral margin by wide notch. Anterolateral margin of carapace distinctly cristate, lined with approximately 20 granules (Figs 3A, 5A). Maxilliped 3 exopod reaching nearly 1/2 of merus length, with long flagellum, slightly longer than width of merus (Fig. 4B). Chelipeds (pereiopod 1) strongly unequal in males, subequal in females (Figs 3A, 4A, 5A). G1 slender, subterminal segment about 1.7 times as long as terminal segment; 2 lobes of terminal segment strongly unequal, dorsal lobe longitudinally extended, oval shaped, ventral lobe blunt, reaching 1/2 of terminal segment (Figs 6A–D, 7A). Female vulvae ovate, medium-sized, occupying anterior 2/3 length of sternite 6 (Fig. 5B).

Figure 4. 

Sinolapotamon cirratum sp. nov., holotype male (17.90 × 15.50 mm) (NCU MCP 434201) A outer view of chelipeds B left third maxilliped C anterior thoracic sternum, pleonal somites 4–6 and telson D sternopleonal cavity with G1. Scale bars: 5 mm.

Figure 5. 

Sinolapotamon cirratum sp. nov., paratype female (17.42 × 15.45 mm) (NCU MCP 433901) A overall dorsal habitus B sternopleonal cavity with vulvae. Scale bars: 1 cm.

Figure 6. 

Gonopods of Sinolapotamon cirratum sp. nov., holotype male (17.90 × 15.50 mm) (NCU MCP 434201) A ventral view of left G1 B ventral view of terminal segment of left G1 C dorsal view of left G1 D dorsal view of terminal segment of left G1 E ventral view of left G2. Scale bars: 1 mm.

Figure 7. 

Left G1s (ventral view) of known species of Sinolapotamon A Sinolapotamon cirratum sp. nov., holotype (NCU MCP 434201) B S. patellifer (Yangshuo, NCU MCP 407301) C S. anacoluthon (Shenzhen, NCU MCP 434001) D S. auriculatum (Shanglin, NCU MCP 72301) E S. palmatum (Liuzhou, NCU MCP 415301).

Description

Carapace subquadrate, nearly 1.2 times as wide as long; surface generally smooth, regions indistinct; dorsal surface slightly convex, with tiny pits, anterolateral region weakly rugose. Cervical groove shallow and wide; H-shaped groove shallow. Front gently deflexed; frontal margin slightly rimmed, weakly bilobed in dorsal view (Figs 3A, 5A). Epigastric cristae low and weak, separated from postorbital cristae by narrow gap; postorbital cristae laterally expanded, not fused with epibranchial tooth. Epibranchial region gently depressed; mesogastric region gently convex. External orbital angle bluntly triangular, distinctly separated from anterolateral margin by V-shaped wide gap (Figs 3A, 5A). Epibranchial tooth distinct, bluntly angular. Anterolateral margin of carapace distinctly cristate, lined with approximately 20 granules; bent inward posteriorly. Posterolateral surface smooth, with oblique striae, converging towards posterior carapace margin (Figs 3A, 5A). Orbits large; supraorbital and infraorbital margins cristate. Sub-orbital, pterygostomial, subhepatic regions covered with striae. Epistome posterior margin narrow longitudinally; median lobe triangular, lateral margins sinuous (Fig. 3B).

Maxilliped 3 exopod reaching nearly 1/2 of merus length, with long flagellum, slightly longer than width of merus. Merus subrectangular, 2 times as wide as long. Ischium subtrapezoidal, about 1.4 times as long as wide, with distinct sulcus (Fig. 4B).

Chelipeds (pereiopod 1) strongly unequal in males, subequal in females. Merus trigonal in cross section. Carpus surface gently depressed, with spine at inner distal angle and spinule at base in both males and females. Palm of lager chela about 1.3–1.5 times as long as high in males, 1.3–1.6 times in females. Dactylus of larger chela 0.6–1.0 times as long as palm in males, practically same proportion in females. Inner margin of fingers lined with granular teeth; fingers of lager chela leaving small gap while smaller one without gap when closed in both males and females (Figs 3A, 4A, 5A).

Ambulatory legs (pereiopod 2–5) slender, with setae; pereiopod 3 longest, merus 0.5–0.6 times as long as carapace length. Pereiopod 5 propodus about 2.0 times as long as broad in both males and females, 0.8–0.9 times as long as dactylus; dactylus gently curved (Figs 3A, 5A).

Male thoracic sternum generally smooth, pitted; sternite 1 triangular; sternite 2–3 fused without visible sutures. Male sternopleonal cavity relatively deep, exceeding imaginary line connecting posterior edges of cheliped coxae base. Median longitudinal suture of sternites 7, 8 deep. Tubercle of abdominal lock positioned at approaching mid-length of sternite 5. Sutures between sternites in female indistinct (Fig. 4C, D). Female vulvae ovate, medium-sized, occupying anterior 2/3 length of sternite 6 (Fig. 5B).

Male pleon and telson triangular; pleonal somites 3–6 gradually narrowed longitudinally, lateral margins forming gently concave line with thoracic sternum; pleonal somite 6 about 2.2 times as wide as long; telson about 1.3 times as wide as long (Fig. 4C). Female pleon and telson broadly ovate (Fig. 5B).

G1 slender, tip of terminal segment exceeding beyond pleonal locking tubercle and suture between thoracic sternites 4 and 5 (Fig. 4D). Subterminal segment about 1.7 times as long as terminal segment; edges of dorsal lobe curled; 2 lobes of terminal segment strongly unequal, dorsal lobe longitudinally extended, oval, ventral lobe blunt, reaching 1/2 length of terminal segment (Fig. 6A–D). G2 slender, longer than G1 (Fig. 6A, E).

Remarks

Consistent with the diagnostic characters of Sinolapotamon, Sinolapotamon cirratum sp. nov. has a gently convex dorsal surface, long flagellum of the third maxilliped exopod and unequal lobes of the G1 terminal segment (Figs 3A, 4B, 7A). The dorsal lobe of the G1 terminal segment in S. cirratum sp. nov. is long and oval, which is similar to that of S. anacoluthon. The two species can nevertheless be distinguished by the ratio of the subterminal segment to the terminal segment of G1, which is 1.7 in S. cirratum sp. nov. and 1.1 in S. anacoluthon (Fig. 7A, C). When compared with S. patellifer, S. auriculatum and S. palmatum, the new species could be easily distinguished by the shape of the dorsal lobes and ventral lobes. The ventral lobe of S. cirratum sp. nov. is bluntly angular, while those of the other species in Sinolapotamon are pointed or shortly pointed (Fig. 7A, B, D, E). They also differ in comparative length of the ventral lobe relative to the terminal segment of the G1 (see Table 3). Additional differences among the known species of Sinolapotamon are provided in Table 3.

Table 3.
Download as
CSV
XLSX

Morphological differences between five species of Sinolapotamon.

Species Sinolapotamon cirratum sp. nov. S. patellifer (cf. Dai 1999: fig. 78) S. anacoluthon (cf. Ng and Dudgeon 1992: figs 4, 5) S. palmatum (cf. Zhu et al. 2010: figs 6–9) S. auriculatum (cf. Zhu et al. 2010: figs 1–4)
Flagellum of exopod of third maxilliped slightly longer than width of merus (Fig. 4B) slightly shorter than width of merus exceeding width of merus slightly longer than width of merus shorter than width of merus
Anterolateral margin of carapace distinctly cristate, lined with approximately 20 granules (Fig. 3A) ridged, without conspicuous granules cristate, lined with numerous small rounded granules convex laterally, cristate, lined with fine granules weakly convex laterally, cristate, lined with fine granules
Ratio of subterminal segment to terminal segment of G1 1.7 (Fig. 7A) 1.7 (Fig. 7B) 1.1 (Fig. 7C) 1.5 (Fig. 7E) 1.5 (Fig. 7D)
Terminal segment of G1 longitudinally extended oval (Fig. 7A) oval (Fig. 7B) longitudinally extended oval (Fig. 7C) subcircular (Fig. 7E) oval (Fig. 7D)
ventral lobe of G1 blunt, reaching 1/2 length of terminal segment (Fig. 7A) sharp, reaching beyond proximal 2/3 length of terminal segment (Fig. 7B) sharp and short, reaching 3/7 length of terminal segment (Fig. 7C) sharp, reaching 5/6 length of terminal segment (Fig. 7E) sharp, reaching proximal 1/2 length of terminal segment (Fig. 7D)

Etymology

The new species is named Sinolapotamon cirratum sp. nov. because of the curled edges of the dorsal lobe of the G1. In the Latin, ‘cirratus’ means ‘curled’.

Ecology

The specimens were collected from puddles in the Duqiaoshan Forest Park. These crabs live in the shallow water or under the wet stones (Fig. 8A, B).

Figure 8. 

A Sinolapotamon cirratum sp. nov. in the wild B general habitat of Sinolapotamon cirratum sp. nov.

Distribution

China: Guangxi Zhuang Autonomous Region: Rong County, Yulin City.

Phylogenetic relationships

A single-gene dataset (COX1) and a 3-gene combined dataset (COX1, 16S rRNA, and 28S rRNA) were used to reconstruct the ML tree and BI tree, respectively. The topologies of the ML tree and BI tree based on the single-gene dataset and the 3-gene combined dataset were analogous. Both evolutionary trees based on the single-gene and 3-gene datasets offer strong evidence for the recognition of the new species as Sinolapotamon cirratum sp. nov., since it is clustered with the species of Sinolapotamon as a monophyletic clade. Sinolapotamon patellifer and S. auriculatum form a sister group. Notably, S. anacoluthon (previously C. anacoluthon) is in ‘Clade Sinolapotamon’, which provides supporting evidence for recognizing the species in Sinolapotamon (Figs 9, 10). The results show that pairwise genetic distances range from 0.0600–0.1106 within the genus Sinolapotamon, and the genetic distances between Sinolapotamon cirratum sp. nov. and its congeners range from 0.0728–0.0947 (Table 4). Phylogenetic analyses, therefore, provided evidence for the identification of Sinolapotamon cirratum sp. nov. as a new species.

Figure 9. 

Phylogenetic tree based on the COX1 gene. Topologies and branch lengths were obtained from BI analysis. Only values >50% are displayed.

Figure 10. 

Phylogenetic tree based on three genes (COX1, 16S rRNA and 28S rRNA). Topologies and branch lengths were obtained from BI analysis. Only values >50% are displayed.

Table 4.
Download as
CSV
XLSX

Pairwise genetic distances of known species of Sinolapotamon.

Species 1 2 3 4
Sinolapotamon auriculatum – – – –
Sinolapotamon anacoluthon 0.0802 – – –
Sinolapotamon cirratum sp. nov. 0.0890 0.0728 – –
Sinolapotamon palmatum 0.1106 0.0692 0.0947 –
Sinolapotamon patellifer 0.0600 0.0863 0.0842 0.1067

Discussion

Previous studies on Sinolapotamon focused on morphological descriptions and lacked molecular evidence (Tai and Sung 1975; Ng and Dudgeon 1992; Zhu et al. 2010). For our study, we obtained sequences of the partial COX1, 16S rRNA and 28S rRNA genes of all the members of Sinolapotamon, thus compensating for this gap. Moreover, the taxonomic statuses of the new species and S. anacoluthon are demonstrated based on morphology, molecular phylogeny and geographical distribution.

Ng and Dudgeon (1992) listed the morphological differences between Cryptopotamon and Sinolapotamon, including a gently convex carapace against a strongly inflated carapace, and the extent of prominence of the epigastric and postorbital cristae. Dai (1999) stated that these differences could only be regarded as interspecific and that the fundamental types of G1 are accordant, thus considering Cryptopotamon as a synonym of Sinolapotamon. Ng et al. (2008), however, listed S. anacoluthon as belong to Cryptopotamon. We assessed the morphological differences among the five known species of Sinolapotamon (see Remarks above) (Table 3) and reconstructed the phylogenetic relationships in Sinolapotamon, in turn providing molecular evidence for transferring C. anacoluthon to Sinolapotamon. Sinolapotamon anacoluthon was previously recorded only from Hong Kong (Ng and Dudgeon 1992; Stanton et al. 2017), but we also collected this species in Shenzhen of the Guangdong Province. There is some geographical distance between S. anacoluthon (from Guangdong) and its congeners (from Guangxi). We, however, noticed that all the species of Sinolapotamon are distributed near the Pearl River Basin. We speculate that the Pearl River contributed to the spread of Sinolapotamon, but further surveys will be needed to validate this hypothesis.

Conclusion

In this study, a new species of Sinolapotamon is described from the Guangxi Zhuang Autonomous Region of China, based on its morphological characteristics, especially its unique G1 among congeners, and the results of phylogenetic analyses (phylogenetic tree based on COX1 and 3-gene combined datasets). In addition, the generic position of Cryptopotamon anacoluthon in Sinolapotamon is confirmed largely on the basis of its morphology, with further evidence from the genetic data. Sinolapotamon is now known by five species. Based on the geographical distributions of Sinolapotamon, there is still possibility to discover new species in Guangxi or Guangdong.

Acknowledgements

We thank Ruoying Cheng (Nanchang University) for giving advice in taking the photos. We thank Qihong Tan (Nanchang University) for helping with the morphological description of the new species. We thank Chao Huang (Australian Museum) for the suggestions for the revision of the manuscript. Finally, we thank the subject editor and reviewers for greatly improving our manuscript.

Additional information

Conflict of interest

No conflict of interest was declared.

Ethical statement

No ethical statement was reported.

Funding

This work was supported by the National Natural Science Foundation of China (no. 32060306 and 21866020) and the National Parasitic Resources Center (NPRC-2019-194-30).

Author contributions

Jiexin Zou: review and editing; Yuanbiao Lu: original draft; Yixuan Zhang: investigation.

Author ORCIDs

Jie-Xin Zou https://orcid.org/0000-0002-5549-2167

Data availability

All of the data that support the findings of this study are available in the main text or Supplementary Information.

References

  • Cai MR, Tan QH, Zou JX (2021) A new species of freshwater crab of the genus Nanhaipotamon Bott, 1968 (Crustacea, Decapoda, Brachyura, Potamidae) from Longhai, Fujian Province, China. ZooKeys 1062: 11–30. https://doi.org/10.3897/zookeys.1062.71171
  • Chu KL, Ma XP, Zhang ZW, Wang PF, Lü LN, Zhao Q, Sun HY (2018) A checklist for the classification and distribution of China’s freshwater crabs. Shengwu Duoyangxing 26(3): 274–282. https://doi.org/10.17520/biods.2018062
  • Crandall KA, Fitzpatrick Jr JF (1996) Crayfish Molecular Systematics: Using a Combination of Procedures to Estimate Phylogeny. Systematic Biology 45(1): 1–26. https://doi.org/10.1093/sysbio/45.1.1
  • Cui YY, Shi LB, Ji WB, Xu SX, Zhu CC, Zhou XM, Zou JX (2020) The complete mitochondrial genome of the freshwater crab Chinapotamon maolanense (Decapoda: Brachyura: Potamoidea). Mitochondrial DNA, Part B, Resources 5(3): 2357–2359. https://doi.org/10.1080/23802359.2020.1773330
  • Cumberlidge N, Ng PKL, Yeo DCJ, Naruse T, Meyer KS, Esser LJ (2011) Diversity, endemism and conservation of the freshwater crabs of China (Brachyura: Potamidae and Gecarcinucidae). Integrative Zoology 6(1): 45–55. https://doi.org/10.1111/j.1749-4877.2010.00228.x
  • Dai AY (1999) Fauna Sinica (Arthropoda. Crustacea. Malacostraca. Decapoda. Parathelphusicae. Potamidae). Science Press, Beijing, 501 pp. [In Chinese with English summary]
  • Davie PJF, Guinot D, Ng PKL (2015) Anatomy and functional morphology of Brachyura. In: Castro P, Davie PJF, Guinot D, Schram FR, von Vaupel Klein JC (Eds) Treatise on Zoology – Anatomy, Taxonomy, Biology. The Crustacea (Vol. 9) (Part C-I). Decapoda: Brachyura (Part 1). Brill, Leiden, The Netherlands, 11–163. https://doi.org/10.1163/9789004190832_004
  • Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299.
  • Huang C, Ahyong ST, Shih HT (2017) Cantopotamon, a new genus of freshwater crabs from Guangdong, China, with descriptions of four new species (Crustacea: Decapoda: Brachyura: Potamidae). Zoological Studies 56: e41. https://doi.org/10.6620/zs.2017.56-41
  • Huang C, Wong KC, Ahyong ST (2018) The freshwater crabs of Macau, with the description of a new species of Nanhaipotamon Bott, 1968 and the redescription of Nanhaipotamon wupingense Cheng, Yang, Zhong & Li, 2003 (Crustacea, Decapoda, Potamidae). ZooKeys 810: 91–111. https://doi.org/10.3897/zookeys.810.30726
  • Ji YK, Sun YF, Gao W, Chu KL, Wang RC, Zhao Q, Sun HY (2016) Out of the Sichuan Basin: Rapid species diversification of the freshwater crabs in Sinopotamon (Decapoda: Brachyura: Potamidae) endemic to China. Molecular Phylogenetics and Evolution 100: 80–94. https://doi.org/10.1016/j.ympev.2016.04.003
  • Ji WB, Cui YY, Xu SX, Jia XN, Zhu CC, Zhou XM, Zou JX (2019) The complete mitochondrial genome of the freshwater crab Sinolapotamon patellifer (Decapoda: Brachyura: Potamoidea). Mitochondrial DNA, Part B, Resources 4(2): 2451–2453. https://doi.org/10.1080/23802359.2019.1637791
  • Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Molecular Biology and Evolution 35(6): 1547–1549. https://doi.org/10.1093/molbev/msy096
  • Ng PKL, Dudgeon D (1992) The Potamidae and Parathelphusidae (Crustacea: Decapoda: Brachyura) of Hong Kong. Invertebrate Systematics 6(3): 741–768. https://doi.org/10.1071/IT9920741
  • Ng PKL, Guinot D, Davie PJF (2008) Systema Brachyurorum: Part I. An annotated checklist of extant brachyuran crabs of the world. The Raffles Bulletin of Zoology 17 (Supplement): 1–286.
  • Ng PKL, Shih HT, Naruse T, Shy JY (2010) Using molecular tools to establish the type locality and distribution of the endemic Taiwanese freshwater crab Geothelphusa chiui Minei, 1974 (Crustacea: Brachyura: Potamidae), with notes on the genetic diversity of Geothelphusa from Eastern Taiwan. Zoological Studies 49: 544–555.
  • Nylander JAA (2004) MrModeltest v 2.3. Evolutionary Biology Centre, Uppsala University.
  • Pan D, Shi BY, Du SY, Gu TY, Wang RX, Xing YH, Zhang Z, Chen JJ, Cumberlidge N, Sun HY (2021) Mitogenome phylogeny reveals Indochina Peninsula origin and spatiotemporal diversification of freshwater crabs (Potamidae: Potamiscinae) in China. Cladistics 38(1): 1–12. https://doi.org/10.1111/cla.12475
  • Rambaut A, Drummond AJ, Suchard M (2013) Tracer v1. 6—MCMC trace analysis package. Institute of Evolutionary Biology, University of Edinburgh, UK.
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice Across a Large Model Space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029
  • Segawa RD, Aotsuka T (2005) The mitochondrial genome of the Japanese freshwater crab, Geothelphusa dehaani (Crustacea: Brachyura): Evidence for its evolution via gene duplication. Gene 355: 28–39. https://doi.org/10.1016/j.gene.2005.05.020
  • Shih HT, Do VT (2014) A new species of Tiwaripotamon Bott, 1970, from northern Vietnam, with notes on T. vietnamicum (Dang & Ho, 2002) and T. edostilus Ng & Yeo, 2001 (Crustacea, Brachyura, Potamidae). Zootaxa 3764(1): 26–38. https://doi.org/10.11646/zootaxa.3764.1.2
  • Shih HT, Chen GX, Wang LM (2005) A new species of freshwater crab (Decapoda: Brachyura: Potamidae) from Dongyin Island, Matsu, Taiwan, defined by morphological and molecular characters, with notes on its biogeography. Journal of Natural History 39(31): 2901–2911. https://doi.org/10.1080/00222930500214010
  • Shih HT, Hung HC, Schubart CD, Chen CA, Chang HW (2006) Intraspecific genetic diversity of the endemic freshwater crab Candidiopotamon rathbunae (Decapoda, Brachyura, Potamidae) reflects five million years of the geological history of Taiwan. Journal of Biogeography 33(6): 980–989. https://doi.org/10.1111/j.1365-2699.2006.01472.x
  • Shih HT, Fang SH, Ng PKL (2007) Phylogeny of the freshwater crab genus Somanniathelphusa Bott (Decapoda: Parathelphusidae) from Taiwan and the coastal regions of China, with notes on their biogeography. Invertebrate Systematics 21(1): 29–37. https://doi.org/10.1071/IS06007
  • Shih HT, Yeo DCJ, Ng PKL (2009) The collision of the Indian plate with Asia: molecular evidence for its impact on the phylogeny of freshwater crabs (Brachyura: Potamidae). Journal of Biogeography 36(4): 703–719. https://doi.org/10.1111/j.1365-2699.2008.02024.x
  • Shih HT, Ng PKL, Naruse T, Shokita S, Liu MY (2011a) Pleistocene speciation of freshwater crabs (Crustacea: Potamidae: Geothelphusa) from northern Taiwan and southern Ryukyus, as revealed by phylogenetic relationships. Zoologischer Anzeiger 250(4): 457–471. https://doi.org/10.1016/j.jcz.2011.07.004
  • Shih HT, Zhou XM, Chen GX, Chien IC, Ng PKL (2011b) Recent vicariant and dispersal events affecting the phylogeny and biogeography of East Asian freshwater crab genus Nanhaipotamon (Decapoda: Potamidae). Molecular Phylogenetics and Evolution 58(3): 427–438. https://doi.org/10.1016/j.ympev.2010.11.013
  • Shih HT, Huang C, Ng PKL (2016) A re-appraisal of the widely-distributed freshwater crab genus Sinopotamon Bott, 1967, from China, with establishment of a new genus (Crustacea: Decapoda: Potamidae). Zootaxa 4138(2): 309–331. https://doi.org/10.11646/zootaxa.4138.2.5
  • Stanton DJ, Leven MR, Hui TCH (2017) Distribution of Cryptopotamon anacoluthon (Kemp, 1918) (Crustacea: Brachyura: Potamidae), a freshwater crab endemic to Hong Kong. Journal of Threatened Taxa 9(2): 9786–9794. https://doi.org/10.11609/jott.3007.9.2.9786-9794
  • Tai AY, Sung YZ (1975) A preliminary study of the freshwater crabs as intermediate hosts of lung flukes from China. Acta zoologica Sinica 21: 169–178.
  • Tay YC, Ng DJJ, Loo JB, Huang D, Cai Y, Yeo DCJ, Meier R (2018) Roads to isolation: Similar genomic history patterns in two species of freshwater crabs with contrasting environmental tolerances and range sizes. Ecology and Evolution 8(9): 4657–4668. https://doi.org/10.1002/ece3.4017
  • Van Tu Do HTS, Huang C (2016) A new species of freshwater crab of the genus Tiwaripotamon Bott, 1970 (Crustacea, Brachyura, Potamidae) from northern Vietnam and southern China. The Raffles Bulletin of Zoology 64: 213–219.
  • Wang SB, Huang C, Zou JX (2019) Description of a new species of freshwater crab of the genus Qianguimon Huang, 2018 (Crustacea: Decapoda: Brachyura: Potamidae) from Yulin, Guangxi, Southern China. Zoological Studies 58: e31. https://doi.org/10.6620/zs.2019.58-31
  • Yang FF (2011) Investigating the phylogenic relationship of ribbed-shelled and smooth-shelled snails of Oncomelania hupesis collected from Guangxi with these from neighborhood provinces, China. Master Thesis, Guangxi Medical University, Nanning, China.
  • Zhang Z, Xing YH, Cheng JJ, Pan D, Lü LN, Cumberlidge N, Sun HY (2020) Phylogenetic implications of mitogenome rearrangements in East Asian potamiscine freshwater crabs (Brachyura: Potamidae). Molecular Phylogenetics and Evolution 143: е106669. https://doi.org/10.1016/j.ympev.2019.106669
  • Zhu C, Naruse T, Zhou XM (2010) Two new species of freshwater crabs of the genus Sinolapotamon Tai & Sung, 1975 (Decapoda, Brachyura, Potamidae) from Guangxi Zhuang Autonomous Region, China. Crustaceana 83(2): 245–256. https://doi.org/10.1163/001121609X12603430877199

Supplementary materials

Supplementary material 1 

Phylogenetic tree (ML) based on the COX1 gene

Yuan-Biao Lu, Yi-Xuan Zhang, Jie-Xin Zou

Data type: phylogenetic (.mtsx file)

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (38.75 kb)
Supplementary material 2 

Phylogenetic tree (BI) based on the COX1 gene

Yuan-Biao Lu, Yi-Xuan Zhang, Jie-Xin Zou

Data type: phylogenetic (.tre file)

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (17.46 kb)
Supplementary material 3 

Phylogenetic tree (ML) based on 3 genes

Yuan-Biao Lu, Yi-Xuan Zhang, Jie-Xin Zou

Data type: phylogenetic (.mtsx file)

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (41.79 kb)
Supplementary material 4 

Phylogenetic tree (BI) based on 3 genes

Yuan-Biao Lu, Yi-Xuan Zhang, Jie-Xin Zou

Data type: phylogenetic (.tre file)

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (9.54 kb)
login to comment