Corresponding author: Wan-Xue Liu (
Academic editor: Zachary Lahey
Wan W-J, Du S-J, Hansson C, Liu W-X (2023) A new species of
The genus
Identification of
For this project we collected
Collecting information of
Specimens | Sampling locality | GPS coordinates | Host plants | Host | Sampling date |
---|---|---|---|---|---|
5♀, 2♂ (4♀) | Longnan, Gansu |
|
|
|
2019.05 |
1♀ | Baiyin, Gansu |
|
|
|
2018.09 |
7♀, 1♂ | Chifeng, Inner Mongolia |
|
|
Unknown | 2018.08 |
1♂ | Guyuan, Ningxia |
|
|
2018.09 | |
1♂ | Guyuan, Ningxia |
|
|
|
2018.09 |
1♀ (1♀) | Gonghe, Qinghai |
|
|
|
2018.07 |
1♀ (1♀) | Baoji, Shaanxi |
|
|
Unknown | 2019.05 |
1♂ | Baoji, Shaanxi |
|
|
Unknown | 2019.05 |
1♀, 1♂ | Yantai, Shandong |
|
|
Unknown | 2017.05 |
1♀ | Rizhao, Shandong |
|
|
|
2018.10 |
1♂ (1♂) | Linyi, Shandong |
|
|
|
2019.05 |
2♀, 4♂ (1♂) | Xinzhou, Shanxi |
|
|
|
2017.06 |
1♀ | Xinzhou, Shanxi |
|
|
|
2017.06 |
1♀, 3♂ | Xinzhou, Shanxi |
|
2017.06 | ||
3♂ (2♂) | Linfen, Shanxi |
|
|
2017.06 | |
1♀, 2♂ | Xinzhou, Shanxi |
|
|
|
2017.06 |
3♂ | Xinzhou, Shanxi |
|
|
|
2017.07 |
1♀ | Xinzhou, Shanxi |
|
|
2017.07 | |
1♂ | Xinzhou, Shanxi |
|
|
Unknown | 2017.07 |
6♀, 3♂ (3♀) | Xinzhou, Shanxi |
|
Unknown | 2017.07 | |
2♀, 2♂ | Xinzhou, Shanxi |
|
|
|
2018.05 |
2♀, 2♂ (1♀, 1♂) | Changzhi, Shanxi |
|
|
|
2018.05 |
1♀ | Changzhi, Shanxi |
|
|
|
2018.05 |
2♀, 2♂ (1♀, 1♂) | Yangquan, Shanxi |
|
|
|
2018.05 |
3♂ | Xinzhou, Shanxi |
|
|
2018.05 | |
3♀ (2♀) | Xinzhou, Shanxi |
|
2018.09 | ||
3♀, 5♂ (2♀, 1♂) | Jincheng, Shanxi |
|
|
|
2019.05 |
6♀, 12♂ (2♀, 3♂) | Jincheng, Shanxi |
|
|
|
2019.05 |
5♀, 3♂ (2♀, 1♂) | Jincheng, Shanxi |
|
|
|
2019.05 |
2♀, 2♂ (1♂) | Beijing |
|
|
|
2016.05 |
4♀, 23♂ (1♀,1♂) | Beijing |
|
|
2016.06 | |
5♀, 3♂ (2♀, 1♂) | Beijing |
|
|
|
2016.06 |
2♀ | Beijing |
|
|
|
2017.05 |
1♂ (1♂) | Beijing |
|
|
|
2017.05 |
2♂ | Beijing |
|
|
2017.05 | |
1♂ | Beijing |
|
|
|
2017.08 |
5♀, 6♂ | Beijing |
|
|
|
2018.05 |
1♂ (1♂) | Beijing |
|
|
|
2018.05 |
4♀ (2♀) | Beijing |
|
|
|
2019.05 |
5♀ (3♀) | Beijing |
|
|
2019.05 | |
8♀, 14♂ (3♀, 3♂) | Beijing |
|
|
|
2019.05 |
4♀, 2♂ (2♀, 1♂) | Beijing |
|
|
2019.05 | |
1♂ | Beijing |
|
|
Unknown | 2019.08 |
2♀ (1♀) | Shijiazhuang, Hebei |
|
|
|
2017.05 |
3♀, 1♂ (2♀) | Shijiazhuang, Hebei |
|
|
2017.05 | |
1♀ (1♀) | Shijiazhuang, Hebei |
|
|
Unknown | 2018.06 |
3♀, 5♂ | Shijiazhuang, Hebei |
|
|
|
2018.07 |
8♀, 10♂ | Shijiazhuang, Hebei |
|
|
|
2018.07 |
1♀ (1♀) | Shijiazhuang, Hebei |
|
|
|
2018.07 |
6♀, 7♂ | Shijiazhuang, Hebei |
|
|
2018.08 | |
5♀, 14♂ (3♀, 4♂) | Zhangjiakou, Hebei |
|
|
|
2018.08 |
1♀ (1♀) | Zhangjiakou, Hebei |
|
|
|
2019.07 |
2♂ (2♂) | Zhangjiakou, Hebei |
|
|
|
2019.07 |
1♀ | Zhangjiakou, Hebei |
|
|
2019.08 | |
2♀, 2♂ | Zhangjiakou, Hebei |
|
|
2022.08 |
Note: The number and sex of molecular identification specimens were in brackets.
We collected the leaves of vegetables and ornamental plants infested with agromyzid leafminers in different provinces of China from 2016 to 2022. The leaves were placed in cages and each cage was labeled with collection date, locality, and host plant. The collected leaf material was maintained in climate chambers set at 25 ± 1 °C, 30–50% relative humidity, and a photoperiod of 14:10 h (light: dark) until agromyzid leafminers and their parasitoids emerged. All wasp specimens and their hosts were preserved in absolute ethanol and maintained at -20 °C at the Institute of Plant Protection (
Two males and two females of
The specimens were examined using a stereomicroscope (Olympus, SZX-16). Photographs were taken using an Olympus BX43 microscope equipped with a Helicon Focus 6.
The morphological terminology and measurement methods follow
Genomic DNA was extracted from the metasoma of each specimen. The extraction methods followed those described by
Primers used for amplification.
Gene | Primers | Sequences (5’-3’) | References |
---|---|---|---|
|
LCO1490 | GGTCAACAAATCATAAAGATATTGG |
|
HCO2198 | TAAACTTCAGGGTGACCAAAAAATCA |
|
|
|
ITS2F | TGTGAACTGCAGGACACATG |
|
ITS2R | AATGCTTAAATTTAGGGGGTA |
|
|
|
D2-3549F | AGTCGTGTTGCTTGATAGTGCAG |
|
D2-4068R | TTGGTCCGTGTTTCAAGACGGG |
|
Amplifications were performed as described by
The unpurified
The
All sequences were aligned following the default options of the CLUSTAL W tool (
Scape white with apical 1/3–1/2 dark brown (Figs
Female (Fig.
Females are slightly larger than males (1.6 mm and 1.4 mm, respectively).
China (Beijing, Gansu, Hebei, Inner Mongolia, Ningxia, Qinghai, Shaanxi, Shandong, and Shanxi).
The name is derived from a combination of the Latin
The length of
Collection sites of
Phylogenetic tree of the three
The mean genetic distance of
The mean genetic distance between three
Species |
|
|
|
|||||||
---|---|---|---|---|---|---|---|---|---|---|
1 | 2 | 3 | 1 | 2 | 3 | 1 | 2 | 3 | ||
1 |
|
0.0153 | – | – | ||||||
2 |
|
0.1133 | – | 0.0862 | – | 0.0018 | – | |||
3 |
|
0.1337 | 0.1485 | – | 0.0649 | 0.0414 | – | 0.0018 | 0.0037 | – |
The length of the 25
The length of the 11 sequences obtained from
All gene sequences are uploaded to GenBank with accession numbers
The new species,
We thank Miao-Miao Mao for collecting material of the new species, and Editage (
The genetic distance between three
phylogenetic