2 urn:lsid:arphahub.com:pub:45048D35-BB1D-5CE8-9668-537E44BD4C7E urn:lsid:zoobank.org:pub:91BD42D4-90F1-4B45-9350-EEF175B1727A ZooKeys ZK 1313-2989 1313-2970 Pensoft Publishers 10.3897/zookeys.1192.98352 98352 Research Article Anura Megophryidae Biodiversity & Conservation Systematics China The fourth species of Leptobrachella (Anura, Megophryidae) found at Shiwandashan National Nature Reserve, Guangxi, China Chen Wei-Cai chenweicai2003@126.com https://orcid.org/0000-0002-2398-4079 1 Li Peng https://orcid.org/0000-0001-8311-0544 1 Peng Wan-Xiao https://orcid.org/0000-0001-5635-9061 1 Liu You-Jun https://orcid.org/0000-0001-7285-4943 2 Huang Yong https://orcid.org/0000-0002-3493-9468 3 Key Laboratory of Environment Change and Resources Use in Beibu Gulf Ministry of Education, Nanning Normal University, Nanning 530001, China Guangxi Key Laboratory of Earth Surface Processes and Intelligent Simulation, Nanning Normal University, Nanning 530001, China Shiwandashan National Nature Reserve, Fangcheng 538000, China Guangxi University of Chinese Medicine, Nanning 530200, China

Corresponding author: Wei-Cai Chen (chenweicai2003@126.com)

Academic editor: Johannes Penner

 2024 22 02 2024 1192 257 279 8D4DA768-82CC-5FCD-AE6B-8906C96F03FD 96474EC4-42B1-4BEE-A68D-4F736A8A4EB9 06 12 2022 02 02 2024 Wei-Cai Chen, Peng Li, Wan-Xiao Peng, You-Jun Liu, Yong Huang This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. http://zoobank.org/96474EC4-42B1-4BEE-A68D-4F736A8A4EB9

A new species of the genus Leptobrachella, L. guinanensissp. nov., is described in this study based on morphological, molecular, and bioacoustic data. The species was discovered in the Shiwandashan National Nature Reserve in Shangsi County, Guangxi, China. Phylogenetically, L. guinanensissp. nov. is closely related to L. ventripunctata. However, there are distinct morphological differences between L. guinanensissp. nov. and L. ventripunctata, as well as three other sympatric species (L. shangsiensis, L. shiwandashanensis, and L. sungi). These differences include body size (SVL 30.5–32.5 mm in males; 38.7–41.8 mm in females in the new species vs 25.5–28.0 mm in males, 31.5–35.0 mm in females in L. ventripunctata), the absence of brown spots on the ventral surface (vs chest and belly creamy white with many scattered brown spots in L. ventripunctata), 1/3 toe webbing and wide toe lateral fringes (vs no toe webbing and no lateral fringes in L. ventripunctata), and distinct dermal ridges under toes (vs absent in L. ventripunctata). Furthermore, the dominant vocal frequencies of the new species range from 7.3 to 8.3 kHz, which is unique compared to other Leptobrachella species and represents the highest dominant frequencies ever recorded. The Shiwandashan National Nature Reserve is now home to four known sympatric species of Leptobrachella.

 Bioacoustics morphology phylogeny sympatric species Citation

Chen W-C, Li P, Peng W-X, Liu Y-J, Huang Y (2024) The fourth species of Leptobrachella (Anura, Megophryidae) found at Shiwandashan National Nature Reserve, Guangxi, China. ZooKeys 1192: 257–279. https://doi.org/10.3897/zookeys.1192.98352

 Introduction

The Shiwandashan National Nature Reserve is situated in southern Guangxi, China, near the Sino-Vietnamese border, at coordinates 21°30'–22°08'N, 107°30'–108°30'E. Covering an area of 1,745 km2, the reserve exhibits an elevation range from slightly below 200 m to 1,462 m at the summit of Mt. Shuliangling. With a tropical monsoon climate, the reserve lies within the tropical mountain climate zone. The average annual temperature varies between 21.3 °C and 22.4 °C, while the total amount of annual precipitation ranges from 1,203.6 to 2,820.2 mm (Tan 2014). Recent literature reports the presence of 47 amphibian species within the reserve (Ren et al. 2018). Over the past decade, six new amphibian species have been discovered in this reserve. These include Leptobrachella shangsiensis Chen, Liao, Zhou & Mo, 2019 (Chen et al. 2019); Leptobrachella shiwandashanensis Chen, Peng, Pan, Liao, Liu & Huang, 2021 (Chen et al. 2021); Nidirana shiwandashanensis Chen, Peng, Li & Liu, 2022 (Chen et al. 2022a); Occidozyga shiwandashanensis Chen, Peng, Liu, Huang, Liao & Mo, 2022 (Chen et al. 2022b); Odorrana fengkaiensis Wang, Lau, Yang, Chen, Liu, Pang & Liu, 2015 (Wang et al. 2015); and Zhangixalus pinglongensis (Mo, Chen, Liao & Zhou, 2016) (Mo et al. 2016). Additionally, the previously recorded L. sungi (Lathrop, Murphy, Orlov & Ho, 1998) (Mo et al. 2008) brings the total number of Leptobrachella species in this reserve to three. In our recent study, we collected 14 specimens of Leptobrachella within the reserve and observed distinct differences to the known three species. Therefore, this study employs an integrative approach involving morphological, molecular, and bioacoustics analyses to identify and describe this newly discovered species.

 Materials and methods Sampling and morphological examination

Between 2021 and 2022, fourteen specimens were collected at the Shiwandashan National Nature Reserve (SWDS), Shangsi County, Guangxi, China (permission no. SWDS20210501). For comparison, nine specimens of Leptobrachella ventripunctata (Fei, Ye & Li, 1990) were collected at the Jinzhongshan National Nature Reserve on 22 June 2021 (JZS) (permission no. JZS20210605). Additionally, L. sungi specimens were collected at the SWDS (n = 16) on 4 July 2021, and the Sishuihe Nature Reserve (SSH) (n = 3) on 20 June 2020, located in Lingyun County, Guangxi, China (permission no. SSH20200615) (Fig. 1). After euthanasia using isoflurane, all specimens were fixed in 10% formalin for 48 h and finally stored in 75% ethanol. Muscle samples were taken prior to fixation and stored in 100% ethanol for subsequent molecular analyses. All specimens and muscle samples are deposited in the collection of Nanning Normal University (NNU) (see Table 1 for details). Specimens were measured with a digital caliper to the nearest 0.1 mm. The following measurements were taken:

10.3897/zookeys.1192.98352.figure1 F25B6A49-B812-5D0C-A82F-336505777727

Localities of the new species and its sister taxa. Sample ID corresponding to those provided in Table 1.

https://binary.pensoft.net/fig/990961

DNA sequences used in this study. ‘*’ represents type locality.

ID Species Locality Voucher no. 16S
1 L. ventripunctata Longlin County, Guangxi, China NNU00527 OP548575
2 L. ventripunctata Longlin County, Guangxi, China NNU00528 OP548576
3 L. ventripunctata Longlin County, Guangxi, China NNU00529 OP548577
4 L. ventripunctata Longlin County, Guangxi, China NNU00530 OP548578
5 L. ventripunctata Longlin County, Guangxi, China NNU00531 OP548579
6 L. ventripunctata Xishuangbanna, Yunnan, China* SYS a001768 KM014811
7 L. ventripunctata Xishuangbanna, Yunnan, China* SYS a004539 MG520361
8 L. ventripunctata Zhushihe, Xishuangbanna, Yunnan, China* SYSa004536 MH055831
9 L. guinanensis sp. nov. Shangsi County, Guangxi, China* NNU00557 OP548561
10 L. guinanensis sp. nov. Shangsi County, Guangxi, China* NNU00558 OP548562
11 L. guinanensis sp. nov. Shangsi County, Guangxi, China* NNU00559 OP548563
12 L. guinanensis sp. nov. Shangsi County, Guangxi, China* NNU00560 OP548564
13 L. guinanensis sp. nov. Shangsi County, Guangxi, China* NNU00561 OP548565
14 L. guinanensis sp. nov. Shangsi County, Guangxi, China* NNU00569 OP548566
15 L. guinanensis sp. nov. Shangsi County, Guangxi, China* NNU00570 OP548567
16 L. shiwandashanensis Fangcheng City, Guangxi, China* NNU202103146 MZ326691
17 L. shiwandashanensis Fangcheng City, Guangxi, China* NNU202103213 MZ326692
18 L. shiwandashanensis Fangcheng City, Guangxi, China* NNU202103214 MZ326693
19 L. shiwandashanensis Fangcheng City, Guangxi, China* NNU202103215 MZ326694
20 L. shangsiensis Shangsi County, Guangxi, China* NHMG1401032 MK095460
21 L. shangsiensis Shangsi County, Guangxi, China* NHMG1401033 MK095461
22 L. shangsiensis Shangsi County, Guangxi, China* NHMG1704002 MK095462
23 L. shangsiensis Shangsi County, Guangxi, China* NHMG1704003 MK095463
24 L. sungi Shangsi County, Guangxi, China NNU00572 OP548569
25 L. sungi Shangsi County, Guangxi, China NNU00573 OP548570
26 L. sungi Shangsi County, Guangxi, China NNU00574 OP548571
27 L. sungi Lingyun County, Guangxi, China NNU00685 OP548572
28 L. sungi Lingyun County, Guangxi, China NNU00686 OP548573
29 L. sungi Lingyun County, Guangxi, China NNU00687 OP548574
30 L. aerea Quang Binh, Vietnam ZFMK 86362 JN848409
31 L. alpina Caiyanghe, Yunnan, China KIZ049024 MH055867
32 L. applebyi Phong Dien Nature Reserve, Thua Thien-Hue, Vietnam KIZ010701 MH055947
33 L. arayai Borneo, Malaysia* AE100/S9 DQ642119
34 L. ardens Kon Ka Kinh National Park, Gia Lai, Vietnam* ZMMU-NAP-06099 MH055949
35 L. aspera Huanglianshan Nature Reserve, Lyuchun, Yunnan, China* SYS a007743 MW046199
36 L. baluensis Sabah, Borneo, Malaysia* SP 21604 LC056792
37 L. bashaensis Basha Nature Reserve, Guizhou, China* GIB196404 MW136295
38 L. bidoupensis Bidoup-Nui Ba National Park, Lam Dong, Vietnam* ZMMU-A-4797-01454 MH055945
39 L. bijie Bijie City, Guizhou, China* SYS a007313 MK414532
40 L. botsfordi Lao Cai, Vietnam* AMS R 176540 MH055952
41 L. bourreti Mao’er Shan, Guangxi, China KIZ019389 MH055869
42 L. brevicrus Sarawak, Borneo, Malaysia* ZMH A09365 KJ831302
43 L. chishuiensis Guizhou, China* CIBCS20190518047 MT117053
44 L. crocea Thua Thien-Hue, Vietnam ZMMU-NAP-02274 MH055955
45 L. damingshanensis Wuming County, Guangxi, China* NNU202103281 MZ145229
46 L. dorsospina Yushe Forest Park, Shuicheng, Guizhou, China* SYS a004961 MW046194
47 L. dringi Borneo, Malaysia* KUHE:55610 AB847553
48 L. eos Phongsaly, Laos* MNHN 2004.0274 JN848452
49 L. feii Yunnan, China* KIZ048894 MT302634
50 L. firthi Kon Tum, Vietnam* AMS: R 176524 JQ739206
51 L. flaviglandulosa Xiaoqiaogou Nature Reserve, Yunnan, China* KIZ016072 MH055934
52 L. fritinniens Danum Valley Field Center, Sabah, Malaysia FMNH 244800 MH055971
53 L. fuliginosa Phetchaburi, Thailand KUHE:20197 LC201988
54 L. gracilis Bukit Kana, Sarawak, Malaysia FMNH 273682 MH055972
55 L. graminicola Mount Pu Ta Leng, Lao Cai, Vietnam* VNMN 010909 MZ224649
56 L. hamidi Borneo, Malaysia* KUHE 17545 AB969286
57 L. heteropus Peninsular, Malaysia KUHE 15487 AB530453
58 L. isos Gia Lai, Vietnam* AMS R 176480 KT824769
59 L. itiokai Gunung Mulu National Park, Sarawak, Malaysia* KUHE:55897 LC137805
60 L. jinshaensis Lengshuihe Nature Reserve, Jinsha County, Guizhou, China* CIBJS20200516001 MT814014
61 L. juliandringi Sarawak, Borneo, Malaysia* KUHE 17557 LC056784
62 L. kajangensis Tioman, Malaysia* LSUHC:4439 LC202002
63 L. kalonensis Binh Thuan, Vietnam* IEBR A.2014.15 KR018114
64 L. kecil Cameron, Malaysia * KUHE:52439 LC202003
65 L. khasiorum Meghalaya, India* SDBDU 2009.329 KY022303
66 L. laui Wutongshan, Shenzhen city, China* SYS a001507 KM014544
67 L. liui Wuyi Shan, Fujian, China * ZYCA907 MH055908
68 L. macrops Dak Lak, Vietnam* AMS R177663 KR018118
69 L. maculosa Ninh Thuan, Vietnam* AMS: R 177660 KR018119
70 L. mangshanensis Manghan, Hunan, China * MSZTC201703 MG132198
71 L. maoershanensis Mao’er Shan, Guangxi, China KIZ07614 MH055927
72 L. marmorata Borneo, Malaysia* KUHE 53227 AB969289
73 L. maura Borneo, Malaysia SP 21450 AB847559
74 L. melanoleuca Kapoe, Ranong, Thailand KIZ018031 MH055967
75 L. melica Ratanakiri, Cambodia* MVZ 258198 HM133600
76 L. minima Doi Phu Fa, Nan, Thailand KIZ024317 MH055852
77 L. mjobergi Sarawak, Borneo, Malaysia* KUHE 47872 LC056787
78 L. murphyi Doi Inthanon, Chiang Mai, Thailand* KIZ031199 MZ710523
79 L. nahangensis Tuyen Quang, Vietnam* ROM 7035 MH055853
80 L. namdongensis Thanh Hoa, Vietnam* VNUF A.2017.95 MK965390
81 L. neangi Veal Veng District, Pursat, Cambodia* CBC 1609 MT644612
82 L. niveimontis Yongde County, Yunnan, China * KIZ028276 MT302620
83 L. nyx Ha GiangProv., Vietnam* AMNH A 163810 DQ283381
84 L. oshanensis Emei Shan, Sichuan, China* Tissue ID: YPX37492 MH055896
85 L. pallida Lam Dong, Vietnam* UNS00510 KR018112
86 L. parva Mulu National Park, Sarawak, Malaysia* KUHE:55308 LC056791
87 L. pelodytoides NA TZ819 AF285192
88 L. petrops Ba Vi National Park, Ha Tay, Vietnam ROM 13483 MH055901
89 L. picta Borneo, Malaysia UNIMAS 8705 KJ831295
90 L. pluvialis Lao Cai, Vietnam* MNHN:1999.5675 JN848391
91 L. puhoatensis Nghe An, Vietnam* VNMN 2016 A.22 KY849586
92 L. purpurus Yunnan, China * SYSa006530 MG520354
93 L. purpuraventra Guizhou, China * SYSa007281 MK414517
94 L. pyrrhops Loc Bac, Lam Dong, Vietnam* ZMMU-A-4873-00158 MH055950
95 L. rowleyae Da Nang City, Vietnam* ITBCZ2783 MG682552
96 L. sabahmontanus Borneo, Malaysia* BORNEENSIS 12632 AB847551
97 L. sola Gunung Stong, Kelantan, Malaysia KU RMB20973 MH055973
98 L. suiyangensis Guizhou, China * GZNU20180606005 MK829649
99 L. sungi Vinh Phuc, Vietnam * ROM 20236 MH055858
100 L. tadungensis Dak Nong, Vietnam* UNS00515 KR018121
101 L. tengchongensis Yunnan, China * SYSa004598 KU589209
102 L. tuberosa Kon Ka Kinh National Park, Gia Lai, Vietnam* ZMMU-NAP-02275 MH055959
103 L. wuhuangmontis Pubei County, Guangxi, China * SYS a003486 MH605578
104 L. wulingensis Hunan, China * CSUFT194 MT530316
105 L. yeae Mount Emei, Sichuan, China * CIBEMS20190422HLJ1-6 MT957019
106 L. yingjiangensis Yunnan, China * SYSa006532 MG520351
107 L. yunkaiensis Guangdong, China * SYSa004663 MH605584
108 L. zhangyapingi Chiang Mai, Thailand * KIZ07258 MH055864
109 Leptobrachium huashen Yunnan, China KIZ049025 KX811931
110 Xenophrys glandulosa Yunnan, China KIZ048439 KX811762

SVL snout-vent length;

HL head length from the tip of snout to rear of jaws;

HW head width at commissure of jaws;

SNT snout length from the tip of snout to the anterior eye corner;

ED diameter of the exposed portion of eyeball;

IOD interorbital distance, the shortest distance between the anterior corners of the orbits;

IN internarial space distance;

EN distance from the eye to nostril, measured from the anterior corner of the eye to the posterior margin of the nostril;

TD horizontal diameter of tympanum;

TED distance from anterior edge of the tympanum to posterior eye corner;

TIB tibia length with flexed hindlimb;

FLL forelimb length from elbow to the tip of third finger;

THL thigh length from vent to knee;

ML manus length from the tip of third digit to proximal edge of the inner palmar tubercle;

PL pes length from the tip of fourth toe to the proximal edge of inner metatarsal tubercle;

FEM maximum diameter of femoral gland.

Sex was determined either directly through observation of calling males, presence of vocal sacs in males, or the presence of eggs in the abdomen of females. The webbing formula was determined following Savage (1975). Morphological data were obtained from the collected vouches specimens (Suppl. material 1: table S1) as well as other museum specimens (Suppl. material 1: table S2).

 Phylogenetic analyses

DNA was isolated from muscle samples using Tiangen Biotech Co. Ltd. tissue extraction kits (Beijing, China). The mitochondrial fragments of 16S (~530 bp) were amplified and sequenced using the primer pairs 16Sar_L (5’–CGCCTGTTTACCAA AAACAT–3’) and 16Sbr_H (5’–CCGGTCTGAACTCAGATCACGT–3’). Polymerase chain reaction (PCR) amplification followed the method described by Chen et al. (2021). The 16S fragments were sequenced on an ABI Prism 3730 automated DNA sequencer, and the new sequences were deposited in GenBank (OP548561–OP548567, OP548569–OP548579). Phylogenetic trees were reconstructed using the new sequences and homologous sequences of the genus Leptobrachella downloaded from GenBank (Table 1). The molecular data included topotypic sequences of L. ventripunctata (GenBank no. MH055831, KM014811, and MG520361) from Xishuangbanna, Yunnan, China (Sung et al. 2014; Chen et al. 2018; Yang et al. 2018). Bayesian inference (BI) and maximum likelihood (ML) methods were used to construct the phylogenetic trees. BI was performed using MrBayes v. 3.1.2 (Ronquist and Huelsenbeck 2003). The best-fit evolution model (GTR+I+G) was tested in JMODELTEST v. 2.1.7 (Posada 2008). Two independent runs with four Markov Chain Monte Carlo simulations were performed for 30 million iterations, and trees were sampled every 1,000th generation. The first 25% of trees were discarded as burn-in. ML analysis was carried out on the CIPRES science gateway with 100 rapid bootstrap replicates (Miller et al. 2010) (https://www.phylo.org/portal2). Uncorrected p-distances of the 16S gene were estimated using Mega v. 7 (Kumar et al. 2016) with the default settings.

 Bioacoustics analysis

Advertisement calls were recorded using a SONY PCM-A10 recorder, and ambient temperature was measured using a digital hygrothermograph. The call recordings were analysed using the software Raven Pro v.1.6 (Cornell Laboratory of Ornithology, Ithaca, NY, USA). Audio-spectrograms were generated using Hanning windows, fast-Fourier transform (FFT) of 512 points, 50% overlap, and 172 Hz grid-spacing. Acoustic parameters were defined following Köhler et al. (2017) and Emmrich et al. (2020). Thus, we refer to a call refer as a group of notes, and the call duration is the time from the beginning of the first note to the end of the last note in a call. Call interval is defined as the time from the end of the last note of a call to the beginning of the first note of the subsequent call. Calls are often divided into two or more notes, which are smaller subunits that are usually separated by short intervals of silence relative to the note duration. The dominant frequency of a call is determined as the frequency with the highest energy concentration within the entire power spectrum.

 Morphological analysis

According to our results of the phylogenetic analyses, the new species is closely related to L. ventripunctata. Consequently Mann-Whitney U tests were conducted to determine the significance of differences in morphometric characters between the new species and L. ventripunctata (from JZS). Differences were considered significant below a threshold of 0.05. Principal component analysis (PCA) was performed to examine the distribution of the two species based on their morphometric parameters. Prior to the analysis, morphometric parameters were adjusted by calculating the ratio of each parameter to SVL, and then log-transformed to minimise the impact of allometry. All statistical analyses were carried out using IBM SPSS v. 20.

 Results Phylogenetic analyses and genetic divergence

BI and ML analyses yielded nearly identical phylogenetic trees (Fig. 2). The preliminary phylogenetic trees revealed that all SWDS specimens were classified into four distinct lineages, corresponding to L. shangsiensis, L. shiwandashanensis, L. sungi, and an unidentified Leptobrachella lineage (Fig. 2). The newly collected specimens from SWDS formed a monophyletic group that is closely related to L. ventripunctata. The JZS specimens and L. ventripunctata from the type locality clustered together. The genetic divergences between the newly collected specimens and three sympatric species (L. shangsiensis, L. shiwandashanensis, and L. sungi) exceeded 8.2% (Suppl. material 1: table S3). The genetic divergences between the topotypic samples of L. ventripunctata and the newly collected specimens ranged from 1.6% to 2.4%, while those between the newly collected specimens and L. ventripunctata from JZS ranged from 1.7% to 1.9% (Suppl. material 1: table S3).

10.3897/zookeys.1192.98352.figure2 DCB46F43-32E4-53FD-BF7F-781E4F9B74E6

BI trees based on the part of the 16S gene. Node support is indicated on branches as maximum likelihood support (upper half; > 70% < 90% = grey, > 90% = black) and Bayesian posterior probabilities (lower half; > 0.95 = grey, 1 = black).

https://binary.pensoft.net/fig/990962 Morphology

The diagnostic characters for the new species of the genus Leptobrachella occurring north of the Isthmus of Kra are presented in Table 2, indicating that the newly collected specimens differ significantly from their congeners. The results of Mann-Whitney U tests revealed significant differences between the new specimens and L. ventripunctata from JZS in various measurements, including SVL, ED, IN, and FLL for males, and SVL, HL, HW, EN, TED, TIB, and PL for females (Table 3). There is no overlap in measurements between the new species and L. ventripunctata from JZS or the paratypes in terms of the measured parameters, including SVL, HL, HW, SNT, ED, TIB, FLL, ML, and PL (Table 3). Thus, PCA results showed clear differentiation between the new species and L. ventripunctata (Fig. 3). Furthermore, the newly described species exhibited distinct differences from L. ventripunctata in terms of body size (males being larger: SVL 30.5–32.5 mm vs 25.5–28.0 mm), ventral texture (ventral surface creamy white without dark brown spots vs chest and belly with dark brown spots), presence of a wide lateral fringe on toes (vs absence), presence of 1/3 toe webbing (vs absence), and presence of distinct dermal ridges under the toes (vs absence).

Selected diagnostic characters for the species in the genus Leptobrachella occurring north of the Isthmus of Kra (modified from Rowley et al. 2017; Qian et al. 2020; and Wang et al. 2020). Toes webbing was determined following Fei et al. (2012). “Rudimentary” refers to an observable vestige of web.

ID Species Male SVL (mm) Female SVL (mm) Black spots on flanks Toes webbing Fringes on toes Ventral colouration Dorsal skin texture
1 L. guinanensis sp. nov. 30.5–32.5 38.7–41.8 Yes One third Wide Ventral surface creamy white without dark brown spots Dorsal surface shagreened with small, raised tubercles and longitudinal ridges
2 L. aerea 25.1–28.9 27.1–38.6 No Rudimentary Wide Near immaculate creamy white, brown specking on margins Finely tuberculate
3 L. alpina 24.0–26.4 31.7–32.1 Yes Rudimentary Wide Creamy-white with dark spots Relatively smooth, some with small warts
4 L. applebyi 19.6–22.3 21.7–26.4 Yes Rudimentary Absent Reddish brown with white speckling Smooth
5 L. ardens 21.3–24.7 24.5 Yes Absent Absent Reddish brown with white speckling Smooth-finely shagreened
6 L. aspera 22.4 25.0–26.4 Yes Rudimentary Narrow Creamy white with distinct dark patches on chest and abdomen Rough with dense conical granules, tubercles, and glandular folds
7 L. bashaensis 22.9–25.6 27.1 Yes Rudimentary Narrow Creamy-white chest and off-white belly with irregular black spots Dorsal skin slightly shagreened with small tubercles and irregular brown stripes
8 L. bidoupensis 18.5–25.4 28.3–29.4 Yes Rudimentary Narrow Reddish brown with white speckling Smooth
9 L. bijie 29.0–30.4 Unknown Yes Rudimentary Narrow White with distinct nebulous greyish speckling on chest and ventrolateral flanks Shagreened and granular
10 L. botsfordi 29.1–32.6 30.0–31.8 No Rudimentary Narrow Reddish brown with white speckling Shagreened
11 L. bourreti 28.0–36.2 42.0–45.0 Yes Rudimentary Narrow Creamy white Relatively smooth, some with small warts
12 L. chishuiensis 30.8–33.4 34.2 Yes Rudimentary Narrow White with distinct nebulous greyish speckling on chest and ventrolateral flanks Shagreened and granular
13 L. crocea 22.2–27.3 Unknown No Rudimentary Absent Bright orange Highly tuberculate
14 L. damingshanensis 33.6–34.4 Unknown Yes Rudimentary Narrow Creamy white ventral surface with small, creamy white glands on throat, chest and belly, becoming more concentrated near lateral margin Rough dorsal skin with sparse jacinth tubercles and some short longitudinal ridges
15 L. dong 29.2–34.2 34.4–43.1 Yes Rudimentary Wide White with distinct nebulous brown speckling on ventrolateral flanks Shagreened with fine tubercles
16 L. dorsospina 28.7–30.5 32.1–39.8 Yes Rudimentary Narrow Greyish white with black spots and orange pigmentations Rough with dense conical granules, tubercles, glandular folds, and conical spines
17 L. eos 33.1–34.7 40.7 No Rudimentary Wide Creamy white Shagreened
18 L. feii 21.5–22.8 25.7 Yes Rudimentary Narrow Creamy white with black blotches Shagreened with small tubercles and ridge
19 L. firthi 26.4–29.2 25.7–36.9 No Rudimentary Wide Creamy white Shagreened with fine tubercles
20 L. flaviglandulosa 23.0–27.0 29.3 Yes Rudimentary Narrow Whitish with black speckling on margins Shagreened with yellowish-brown tubercles
21 L. fuliginosa 28.2–30.0 Unknown Yes Rudimentary Narrow White with brown dusting Nearly smooth, few tubercles
22 L. isos 23.7–27.9 28.6–31.5 No Rudimentary Wide Creamy white with white dusting on margins Mostly smooth, females more tuberculate
23 L. jinshaensis 29.7–31.2 Unknown Yes Absent Narrow Ventral surface of throat cream white, chest, and belly cream yellow with purple speckling Dorsal skin shagreened, some of the granules forming longitudinal short skin ridges
24 L. jinyunensis 29.1–34.1 34.1–34.9 Yes Rudimentary Narrow Basically, floral white with deep grey pigments all over Rough, covered with dense small granules and large tubercles
25 L. kalonensis 25.8–30.6 28.9–30.6 Yes Absent Absent Pale, speckled brown Smooth
26 L. khasiorum 24.5–27.3 21.2–33.4 Yes Rudimentary Wide Creamy white Isolated, scattered tubercles
27 L. lateralis 26.9–28.3 36.6 Yes Rudimentary Absent Creamy white Roughly granular
28 L. laui 24.8–26.7 28.1 Yes Rudimentary Wide Creamy white with dark brown dusting on margins Round granular tubercles
29 L. liui 23.0–28.7 24.5–27.8 Yes Rudimentary Wide Creamy white with dark brown spots on chest and margins Round granular tubercles with glandular folds
30 L. macrops 28.0–29.3 30.3 Yes Rudimentary Absent Greyish violet with white speckling Roughly granular with larger tubercles
31 L. maculosa 24.2–26.6 27.0 Yes Absent Absent Brown with a few white speckling Mostly smooth
32 L. mangshanensis 22.2–27.8 30.2 Yes Rudimentary Narrow Throat grey-white and belly creamy white, scattered with white speckles Smooth with orange tubercles and dark brown stripes
33 L. maoershanensis 25.2–30.4 29.1 Yes Rudimentary Narrow Creamy white chest and belly with irregular black spots Longitudinal folds
34 L. melica 19.5–22.7 Unknown Yes Rudimentary Absent Reddish brown with white speckling Smooth
35 L. minima 25.7–31.4 31.6–37.3 Yes Rudimentary Absent Creamy white Smooth
36 L. nahangensis 40.8 Unknown Yes Rudimentary Absent Creamy white with light specking on throat and chest Smooth
37 L. namdongensis 30.9 32.1–35.3 Yes Rudimentary Absent Creamy white with brown dusting on margins Finely tuberculate
38 L. neangi Unknown (35.4–36.3 in females) 35.4–36.3 Yes Rudimentary (in females) Absent (in females) Light purplish grey with dark brown mottling on throat Small, irregular bumps and ridges
39 L. niveimontis 22.5–23.6 28.5–28.7 Yes Rudimentary Narrow Marbling with black speckling Relatively smooth with small tubercles
40 L. nokrekensis 26.0–33.0 34.0–35.0 Yes Rudimentary Unknown Creamy white Tubercles and longitudinal folds
41 L. nyx 26.7–32.6 37.0–41.0 Yes, but indistinct Rudimentary Absent Creamy white with white with brown margins Rounded tubercles
42 L. oshanensis 26.6–30.7 28.8–32.6 Yes Absent Absent Whitish with no markings or only small, light grey spots Smooth with few glandular ridges
43 L. pallida 24.5–27.7 Unknown No Absent Absent Reddish brown with white speckling Tuberculate
44 L. pelodytoides 27.5–32.3 35.5–37.8 Yes One third Narrow Whitish Mostly smooth with smooth warts
45 L. petrops 23.6–27.6 30.3–47.0 No Absent Narrow Immaculate creamy white Highly tuberculate
46 L. pingbianensis 28.0 30.0 Yes Rudimentary unknown Chest and belly with dark brown spots Smooth
47 L. pluvialis 21.3–22.3 Unknown Yes Rudimentary Absent Dirty white with dark brown marbling Smooth, flattened tubercles on flanks
48 L. puhoatensis 24.2–28.1 27.3–31.5 Yes Rudimentary Narrow Reddish brown with white dusting Longitudinal skin ridges
49 L. purpuraventra 27.3–29.8 33.0–35.3 Yes Rudimentary Narrow Grey-purple with distinct nebulous greyish speckling on chest and ventrolateral flanks Shagreened and granular
50 L. purpurus 25.0–27.5 Unknown Yes Rudimentary Wide Dull white with indistinct grey dusting Shagreen with small tubercles
51 L. pyrrhops 30.8–34.3 30.3–33.9 Yes Rudimentary Absent Reddish brown with white speckling Slightly shagreened
52 L. rowleyae 23.4–25.4 27–27.8 Yes Absent Absent Pinkish milk-white to light brown with white speckles Smooth with numerous tiny tubercles
53 L. shangsiensis 24.9–29.4 30.8–35.9 Yes Rudimentary Narrow Yellowish creamy white with marble texture Smooth with numerous tiny tubercles
54 L. shimentaina 26.4–28.9 30.1–30.7 Yes Rudimentary Wide Greyish pink with distinct hazy brown speckling on chest and ventrolateral flanks Round granular tubercles with glandular folds
55 L. shiwandashanensis 26.8–29.7 33.7–35.9 Yes Absent Absent Creamy white ventral surface with brown spots on lateral margin and near immaculate creamy white on throat and chest Shagreened dorsal surface with small, raised tubercles and ridges, more evident on shoulder and dorsal surfaces of limbs
56 L. suiyangensis 28.7–29.7 30.5–33.5 Yes Rudimentary Narrow Yellowish or creamy-white with marble texture or light brown speckling Shagreened with small granules
57 L. sungi 48.3–52.7 56.7–58.9 No or small Wide Narrow Yellowish or creamy-white Granular
58 L. tadungensis 23.3–28.2 32.1 Yes Absent Absent Reddish brown with white speckling Smooth
59 L. tamdil 32.3 31.8 Yes Wide Wide White Weakly tuberculate
60 L. tengchongensis 23.9–26.0 28.8–28.9 Yes Rudimentary Narrow White with dark brown blotches Shagreened with small tubercles
61 L. tuberosa 24.4–29.5 30.2 No Rudimentary Absent White with small grey spots/streaks Highly tuberculate
62 L. ventripunctata 25.5–28.0 31.5–35.0 Yes Absent Absent Chest and belly with dark brown spots Longitudinal skin ridges
63 L. verrucosa 23.2–25.9 Unknown Yes Absent Narrow Creamy white with greyish white and dark brown spots Shagreened with numerous conical tubercles
64 L. wuhuangmontis 25.6–30.0 33.0–36.0 Yes Rudimentary Narrow Greyish white mixed with tiny white and black dots Rough with dense conical tubercles
65 L. wulingensis 24.5–32.8 29.9–38.5 yes Rudimentary Narrow Creamy white, with distinct or indistinct brown speckling at margins Shagreened with sparse large warts, sometimes with longitudinal ridges
66 L. yeae 25.8–32.6 33.7–34.1 Yes Rudimentary Narrow Ventral belly cream white with variable brown specking Dorsum relatively smooth with fine tiny granules or short ridges
67 L. yingjiangensis 25.7–27.6 Unknown Yes Rudimentary Wide Creamy white with dark brown flecks on chest and margins Shagreened with small tubercles
68 L. yunkaiensis 25.9–29.3 34.0–35.3 Yes Rudimentary Wide Belly pink with distinct or indistinct speckling Shagreened with short skin ridges and warts
69 L. yunyangensis 28.3–30.6 Unknown Yes Rudimentary Narrow Ventral surfaces of the throat, chest, and belly greyish white with purple-brown speckling Rough dorsal skin, with sparse large granules and tubercles and short longitudinal ridges on the shoulder
70 L. zhangyapingi 45.8–52.5 Unknown Yes Rudimentary Wide Near immaculate white Mostly smooth with distinct tubercles

Morphometric measurements and comparisons between L. guinanensis sp. nov. and L. ventripunctata. “*” indicates p-value < 0.05; JZS = Jinzhongshan National Nature Reserve; SD = Standard deviation.

Characters p-value from Mann-Whitney U test L. guinanensis sp. nov. L. ventripunctata (JZS) L. ventripunctata (paratypes; Fei et al. 1992)
Male Female Males (n = 4) Female (n = 10) Males (n = 5) Females (n = 4) Males (n = 10)
New species vs L. ventripunctata New species vs L. ventripunctata Range (mean ± SD) (mm) Range (mean ± SD) (mm) Range (mean ± SD) (mm) Range (mean ± SD) (mm) Range (mean) (mm)
SVL 0.014* 0.005* 30.5–32.5 (31.8 ± 0.9) 38.7–41.8 (39.8 ± 1.5) 24.0–26.9 (26.0 ± 1.2) 32.0–34.5 (33.4 ± 1.1) 25.5–28.0 (26.5)
HL 0.806 0.011* 11.0–11.8 (11.3 ± 0.4) 14.0–15.3 (14.6 ± 0.4) 8.7–9.7 (9.3 ± 0.4) 11.1–12.0 (11.4 ± 0.4) 9.2–10.0 (9.6)
HW 0.142 0.048* 11.0–11.6 (11.4 ± 0.3) 14.0–15.5 (14.7 ± 0.6) 8.5–9.3 (9.0 ± 0.4) 11.1–12.5 (11.6 ± 0.6) 9.0–9.5 (9.5)
SNT 0.462 0.396 4.6–5.4 (4.9 ± 0.3) 5.1–6.5 (5.9 ± 0.4) 3.4–4.2 (3.8 ± 0.4) 4.6–4.9 (4.8 ± 0.1) 4.0–4.2 (4.1)
ED 0.014* 0.396 4.6–5.1 (4.9 ± .02) 5.2–5.9 (5.6 ± 0.2) 3.2–3.6 (3.5 ± 0.2) 4.3–5.1 (4.7 ± 0.4) 3.6–4.0 (3.8)
IOD 0.806 0.480 3.1–3.9 (3.5 ± 0.4) 3.7–4.3 (4.0 ± 0.3) 2.5–3.1 (2.9 ± 0.2) 2.9–3.2 (3.0 ± 0.1) 2.9–3.3(3.0)
IN 0.014* 0.258 3.4–4.1 (3.7 ± 0.3) 3.7–5.0 (4.2 ± 0.4) 2.3–2.8 (2.6 ± 0.2) 3.2–3.8 (3.6 ± 0.3) Unknown
EN 0.086 0.016* 2.1–2.8 (2.5 ± 0.3) 2.9–3.3 (3.0 ± 0.1) 1.4–2.0 (1.8 ± 0.3) 2.2–2.4 (2.3 ± 0.1) Unknown
TD 0.142 0.120 1.9–2.2 (2.0 ± 0.1) 1.7–2.9 (2.4 ± 0.4) 1.5–2.2 (2.0 ± 0.3) 2.0–2.7 (2.3 ± 0.4) 1.7–2.0 (1.8)
TED 0.624 0.048* 1.2–1.5 (1.3 ± 0.1) 2.0–2.8 (2.3 ± 0.3) 0.8–1.3 (1.1 ± 0.2) 1.3–1.8 (1.6 ± 0.2) Unknown
TIB 0.327 0.005* 15.2–15.9 (15.5 ± 0.4) 18.5–19.4 (19.0 ± 0.3) 12.0–12.8 (12.3 ± 0.3) 13.9–15.2 (14.6 ± 0.5) 11.4–13.3 (12.1)
FLL 0.014* 0.480 14.4–15.4 (14.9 ± 0.5) 17.9–19.4 (18.8 ± 0.6) 12.3–13.3 (12.9 ± 0.4) 14.9–16.9 (15.5 ± 0.9) 12.1–14.2 (12.9)
THL 0.462 0.157 13.0–15.8 (14.5 ± 1.5) 18.2–19.6 (18.7 ± 0.5) 11.4–13.1 (12.2 ± 0.8) 14.6–16.6 (15.2 ± 0.9) Unknown
ML 0.221 0.322 7.8–8.4 (8.1 ± 0.2) 9.3–10.2 (9.8 ± 0.4) 6.3–6.6 (6.4 ± 0.1) 7.1–8.7 (7.8 ± 0.7) 6.4–7.3 (7.0)
PL 1.000 0.032* 13.4–15.8 (14.4 ± 1.2) 15.4–19.0 (17.4 ± 1.5) 11.4–12.1 (11.7 ± 0.3) 12.8–14.7 (13.7 ± 0.9) 10.7–12.5 (11.4)
FEM 0.327 0.671 1.2–1.5 (1.3 ± 0.1) 1.4–2.2 (1.8 ± 0.3) 0.8–1.5 (1.2 ± 0.3) 1.2–1.6 (1.4 ± 0.2) Unknown
10.3897/zookeys.1192.98352.figure3 F1B3B8AA-E7FA-524D-9014-88D9CC0D7B2F

Scatter plot of PC1 and PC2 of PCA based on the morphometric measurements, distinguishing L. guinanensis sp. nov. and L. ventripunctataA male comparison B female comparison.

https://binary.pensoft.net/fig/990963 Bioacoustics

The calls of four individuals (NNU 00560–561, NNU 00875–876) were recorded. The main features of these calls are summarised in Table 4. The call of the newly described species consists of four notes (Fig. 4). The duration of the calls ranged from 23 milliseconds (ms) to 31 ms (mean 25.5 ± 1.4, n = 4), while the intervals between the calls were 55–133 ms (mean 91.2 ± 17.5, n = 4). The dominant frequencies of the calls were found to be in the range of 7.3–8.3 kHz. These characters were distinct from those of the sympatric species (L. shangsiensis, L. shiwandashanensis, and L. sungi) and L. ventripunctata (Fig. 4, Suppl. material 2: fig. S1, Table 4; Yang et al. 2018; Chen et al. 2019, 2021). Furthermore, the calls of the newly described species can also be differentiated from the known 40 species in the genus Leptobrachella (Suppl. material 1: table S4), as they possess the highest dominant frequencies ever recorded.

Comparisons of characters of advertisement calls of the new species, sympatric species, and L. ventripunctata.

Species Dominant frequency (kHz) Call durations (ms) Call intervals (ms) Notes/call Temperature (°C) Reference
L. guinanensis sp. nov. 7.3–8.3 25.5 (23–31) 91.2 (55–133) 4–5 24.1 This study
L. shiwandashanensis 5.3–5.7 226.6 (194–277) 153.1 (134–186) 14–16 23.0 Chen et al. 2021b
L. shangsiensis 5.5–6.5 66.0 (64–69) 250.5 (184–289) 5–6 21.5 Chen et al. 2019
L. sungi 2.0–2.7 59.4 (56–65) 478.4 (225–996) 3 24.5 This study
L. ventripunctata (YJ) 6.1–6.4 145.0 (65–430) 134.0 (31–416) 3–17 15.0 Yang et al. 2018
L. ventripunctata (JZS) 6.2–7.1 182.8 (142–318) 215.7 (131–507) 8–9 25.1 This study

YJ, Yingjiang County, Yunnan, China; JZS, Jinzhongshan National Nature Reserve, Longlin County, Guangxi, Chin.

 10.3897/zookeys.1192.98352.figure4 5DCCF089-3055-5686-9B6A-C592C00E558C

Advertisement calls of L. guinanensis sp. nov. A and L. ventripunctataB including waveforms and spectrograms.

https://binary.pensoft.net/fig/990964

Based on the evidence from morphology, phylogeny, and bioacoustics, it is evident that the collected specimens represent a distinct, previously undescribed species within the genus Leptobrachella. Therefore, we describe these specimens as a new species of the genus Leptobrachella.

 Taxonomic account Animalia Anura Megophryidae 37AD6E83-0215-5F9E-B5DE-BBD0498C6F78 Leptobrachella guinanensis https://zoobank.org/412DCAC8-50F4-49D0-9F67-94D160AF1915 Chen, Li, Peng & Liu sp. nov. Figs 5 , 6 Material examined.

Holotype.NNU 00876, adult male, collected at the Shiwandashan National Nature Reserve, Shangsi County, Guangxi, China (21°55'1.2"N, 107°54'10.8"E; elevation 512 m), collected by Wei-Cai Chen on 18 June 2022. Paratypes.NNU 00560–561, two adult males, NNU 00557–559, three adult females, collected at the same locality as the holotype on 10 June 2021; NNU 00569–571, three adult females, collected at the same locality as the holotype on 1 July 2021; NNU 00875, one adult male, NNU 00877–880, four adult females, collected at the same locality and time as the holotype. All specimens were collected by Wei-Cai Chen.

 Etymology.

The species name guinanensis is derived from the geographic distribution of this species, specifically the southern Guangxi region. The suggested English name for this species is Gui Nan Leaf Litter Toad, while the Chinese name is Gui Nan Zhang Tu Chan (桂南掌突蟾).

 Diagnosis.

Leptobrachella guinanensis sp. nov. can be distinguished from its congeners by a combination of the following characters: (1) SVL 30.5–32.5 mm in males; 38.7–41.8 mm in females; (2) 1/3 toe webbing, wide lateral fringes; (3) dorsal surface shagreened with small, raised tubercles and longitudinal ridges; (4) ventral surface creamy white without dark brown spots; (5) throat immaculate creamy white and its margin concentrated brown spots; (6) iris bicoloured, upper half light copper, transitioning to silver in lower half; (7) crossbars of hindlimbs with tubercles; (8) distinct dermal ridges under the toes; (9) a pair of glands under the vent; (10) tibia-tarsal articulation reaching to centre of eye; (11) relatively higher dominant frequency of advertisement calls (7.3–8.3 kHz).

 Description of holotype.

Adult male, SVL = 30.5 mm, head width less than length (HW/HL = 0.93); snout protruding, projecting over the lower jaw; nostril oval, closer to the tip of snout than eye; canthus rostralis distinct; loreal region sloping and slightly concave; interorbital region flat; pupil vertical; eye diameter near equal to snout length (ED/SNT = 0.99); tympanum distinct and rounded, and its diameter conspicuously less than eye diameter (TD/ED = 0.41); supratympanic fold distinct, raised from corner of eye to supra-axillary gland; vomerine teeth absent; vocal sac openings located laterally on the floor of mouth; tongue with a shallow notch at the posterior tip.

Tips of fingers rounded and slightly swollen; relative finger lengths I < II < IV < III; nuptial pad absent; subarticular tubercles absent; prominent inner palmar tubercle, separated from the small outer palmar tubercle; finger webbing and dermal fringes absent. Tips of toes rounded, slightly swollen; relative toe lengths I < II < V < III < IV; subarticular tubercles absent, replaced by distinct dermal ridges; pronounced large, oval inner metatarsal tubercle; outer metatarsal tubercle absent; 1/3 toe webbing; lateral fringes wide. TIB/SVL = 0.51; tibia-tarsal articulation reaching to the centre of eye; heels not meeting when thighs are appressed at right angles to body (Fig. 5).

10.3897/zookeys.1192.98352.figure5 89CFE76E-54FA-5B49-A188-08AE3D40F421

The holotype of L. guinanensis sp. nov. A dorsal view B ventral view C dorsolateral view D rear of the back and dorsal view of thighs E ventral view of hand F ventral view of foot. 1, tubercles on the crossbars; 2, femoral gland; 3, a pair of glands under the vent; 4, toe webbing; 5, wide lateral fringes on toe.

https://binary.pensoft.net/fig/990965

Dorsal surface shagreened with small, raised tubercles and longitudinal ridges; belly and chest smooth without tubercles; anterior throat with several tubercles; ventral surface of limbs with creamy white tubercles; crossbars of hindlimbs with tubercles; flanks with several tubercles; pectoral glands oval, ~ 1.2 mm in diameter; femoral glands oval, ~ 1.3 mm in diameter, located on the posteroventral surface of thighs, closer to the knee than to the vent; supra-axillary glands distinct and rounded, ~ 0.9 mm in diameter; a pair of glands under the vent; and continued ventrolateral glandular line distinct (Fig. 5).

 Colour of holotype in life.

Dorsal surface brown, an inverted triangle marking between eyes, irregular markings on shoulder and the rear of back; flanks with light orange tubercles; tympanum pale brown; supratympanic line black from posterior corner of eye to supra-axillary glands; posterior corner of eye silver; wide brown bars on upper lip; flanks with irregular black spots; brown transverse bars distinct on dorsal surface of forelimbs and hindlimbs; upper arm surfaces light orange; ventral surface creamy white without dark brown spots; throat immaculate creamy white and its margin concentrated brown spots; ventral surfaces of limbs purplish grey; pectoral and femoral glands, and a pair of creamy white glands under the vent, supra-axillary glands light orange; pupil black; iris bicoloured, upper half light copper, transitioning to silver in lower half (Fig. 5).

 Colour of holotype in preservative.

Dorsum and limbs surfaces faded to a uniform grey; brown, inverted triangle marking distinctly visible between eyes; irregular black spots distinct on flanks; throat, chest, and belly creamy white; pectoral, femoral, supra-axillary, and ventrolateral glands creamy white; dark crossbars on limbs, fingers and toes remained distinct; upper arm and tibiotarsus faded to grey.

 Variation.

Measurements of the type series are provided in Table 3 and Suppl. material 1: table S5. The black spots and tubercles on the flanks exhibit variation between individuals. Certain individuals possess more tubercles and longitudinal ridges on their dorsum and hindlimb surfaces (Fig. 6A), while others display a light brown colouration on their dorsum (Fig. 6B).

10.3897/zookeys.1192.98352.figure6 4852FE31-27A3-5A4F-858A-6F8C3840FEE9

A more tubercles and longitudinal ridges on dorsum and hindlimbs surfaces (NNU00875) B light brown on dorsum (NNU00569) C ventral view of the gravid female (NNU00880) D eggs creamy white without black poles.

https://binary.pensoft.net/fig/990966 Ecology and distribution.

Leptobrachella guinanensis sp. nov. was discovered in the evergreen forest at SWDS, at an elevation of 400–600 m. The individuals were observed near rocky streams between 20:00–24:00 h. Males were found calling while sitting on rocks near the stream ~ 0.5–1.0 m. Females were found to be gravid with creamy white eggs (Fig. 6C) and laid their eggs in a bag while being raised indoors (Fig. 6D). Currently, L. guinanensis sp. nov. is only known from SWDS. So far within this reserve, we have identified four species of Leptobrachella, namely L. guinanensis sp. nov., L. shangsiensis, L. shiwandashanensis, and L. sungi.

 Comparison.

Table 2 presents a concise overview of the diagnostic morphological characters of species found north of the Isthmus of Kra. Leptobrachella guinanensis sp. nov. can clearly be distinguished from its phylogenetically close congeners, L. ventripunctata. Leptobrachella guinanensis sp. nov. differs from L. ventripunctata by a larger body size (SVL 30.5–32.5 mm in males; 38.7–41.8 mm in females vs 25.5–28.0 mm in males, 31.5–35.0 mm in females), ventral surface creamy white without brown spots (vs chest and belly creamy white with many scattered brown spots), ventral surfaces of limbs purplish grey (vs ventral surface of limbs grey-brown with dark brown and white speckling or dots), 1/3 toe webbing and toe lateral fringes wide (vs no toe webbing and lateral fringes), dermal ridges distinct under toes (vs absent) (Fig. 7), tibia-tarsal articulation reaching the centre of eye (vs the level between tympanum and posterior of eye), heels not meeting when thighs are appressed at right angles to body (vs heels overlapping). In addition, L. guinanensis sp. nov. differs from L. ventripunctata by relatively high dominant frequencies (7.3–8.3 kHz vs 6.1–6.4 kHz), call durations (mean 25.5 ms, ranging 23–31 ms vs mean 145 ms, ranging 65–430 ms) and call intervals (mean 91.2 ms, ranging 55–133 ms vs mean 134 ms, ranging 31–416 ms) (Table 4). Secondly, L. guinanensis sp. nov. can be easily distinguished from its sympatric species, L. shangsiensis, L. shiwandashanensis, and L. sungi. Leptobrachella guinanensis sp. nov. differs from L. shangsiensis by a larger body size (SVL 30.5–32.5 mm in males, 38.7–41.8 mm in females vs 24.9–29.4 mm in males, 30.8–35.9 mm in females), crossbars of hindlimbs with tubercles (vs lack of tubercles on crossbars of hindlimbs), 1/3 toe webbing (vs toe webbing rudimentary), head width less than length (HW/HL = 0.93 vs HW/HL = 1.15), eye diameter near equal to snout length (ED/SNT = 0.99 vs ED/SNT = 0.78), a pair of glands under the vent (vs absent glands under the vent), dominant frequencies (7.3–8.3 kHz vs 5.5–6.5 kHz), call duration (mean 25.5 ms, ranging 23–31 ms vs mean 66.0 ms, ranging 64–69 ms; Table 4). Leptobrachella guinanensis sp. nov. differs from L. shiwandashanensis by relatively larger body size (SVL 30.5–32.5 mm in males; 38.7–41.8 mm in females vs 26.8–29.7 mm in males, 33.7–35.9 mm in females), 1/3 toe webbing and wide lateral fringes on toe (vs no webbing and no lateral fringes on toe), tibia-tarsal articulation reaching to the centre of eye (vs posterior of eye), a pair of glands under the vent (vs absent glands under the vent), dominant frequencies (7.3–8.3 kHz vs 5.3–5.7 kHz), call duration (mean 25.5 ms vs mean 226.6 ms; Table 4). Leptobrachella guinanensis sp. nov. differs from L. sungi by conspicuously smaller body size (SVL 30.5–32.5 mm in males; 38.7–41.8 mm in females vs SVL 48.3–52.7 mm in males, 56.7–58.9 mm in females); iris bicoloured, upper half light copper, transitioning to silver in lower half (vs uniform gold green iris), finger II longer than finger I (vs finger I and II equal in length), tympanum distinct and rounded (vs indistinct), dorsal surface brown, an inverted triangle marking between eyes, irregular markings on shoulder and the rear of back (vs dorsum uniformly light brown or with light spots), dominant frequencies (7.3–8.3 kHz vs 2.0–2.7 kHz), call duration (mean 25.5 ms vs mean 59.4 ms), call intervals (mean 91.2 ms vs mean 478.4 ms) (Table 4).

10.3897/zookeys.1192.98352.figure7 A1F7F692-1535-5F0A-9725-666515907A48

Morphological characters compared between L. guinanensis sp. nov. and L. ventripunctataA1–6L. guinanensis sp. nov. B1–6L. ventripunctataA1, B1 dorsal view A2, B2 dorsolateral view A3, B3 ventral view A4, B4 ventral view of hand A5, B5 ventral view of foot A6, B6 ventral view of the gravid female.

https://binary.pensoft.net/fig/990967

Finally, L. guinanensis sp. nov. can be differentiated from other species in the genus Leptobrachella based on distinctive bioacoustics and morphological diagnostic characters (for details see Table 2, Suppl. material 1: table S4), as well as genetic divergences (Suppl. material 1: table S3).

 Discussion

In recent years, five new Leptobrachella species have been discovered in the region of Guangxi: L. damingshanensis Chen, Yu, Cheng, Meng, Wei, Zhou & Lu, 2021, L. maoershanensis (Yuan, Sun, Chen, Rowley & Che, 2017), L. shangsiensis, L. shiwandashanensis, and L. wuhuangmontis Wang, Yang & Wang, 2018 (AmphibiaChina 2023). In addition to these five species, previous studies had identified four additional Leptobrachella species: L. alpina (Fei, Ye & Li, 1990), L. bourreti (Dubois, 1983), L. liui (Fei & Ye, 1990), and L. sungi (Fei et al. 2012; Mo et al. 2014). Including the newly herein described L. guinanensis sp. nov. this elevates the known number of Leptobrachella species in the region of Guangxi to at least 10. Additionally, L. ventripunctata, originally found in Zhushihe, Mengla County, Xishuangbanna Dai Autonomous Prefecture, Yunnan, China, is widely distributed in southern Yunnan, Guizhou, China, Laos, northern Vietnam, and northern Thailand (Fei et al. 1990, 1992, 2012; Li et al. 2016; Chen et al. 2018; Luong et al. 2019; Wu et al. 2021; Frost 2023) and also Guangxi. However, this is the first recorded sighting of L. ventripunctata in Guangxi. The JZS specimens were identified as L. ventripunctata based on molecular data and morphological characters. The original diagnostic characters of L. ventripunctata include a relatively small body size (SVL 25.5–28.0 mm in males), absence of webbing and lateral fringes on the toes, creamy white chest and belly with scattered brown spots, relatively short hindlimbs, and tibiotarsal articulation reaching between the tympanum and the corner of the eye (Fei et al. 1990, 1992). These diagnostic characters were found to match those of the JZS specimens. However, L. guinanensis sp. nov. has 1/3 webbing on the toes, wide lateral fringes on the toes, no spots on the chest and belly, and tibiotarsal articulation reaching the centre of the eye, which are inconsistent with the diagnostic characters of L. ventripunctata. The genetic divergences between the new species and L. ventripunctata from the type locality are 1.6–2.4%, which is similar to the genetic divergences observed in other comparisons such as L. brevicrus Dring, 1983 vs L. itiokai Eto, Matsui & Nishikawa, 2016 (1.2%), L. bijie Wang, Li, Li, Chen & Wang, 2019 vs L. oshanensis (Liu, 1950) (1.7%), L. jinshaensis Cheng, Shi, Li, Liu, Li & Wang, 2021 vs L. purpuraventra Wang, Li, Li, Chen & Wang, 2019 (1.8%), L. bijie vs L. chishuiensis Li, Liu, Wei & Wang, 2020 (2.0%), and L. bijie vs L. jinshaensis (2.0%) (Suppl. material 1: table S3). Additionally, L. guinanensis sp. nov. exhibits high dominant frequencies of 7.3–8.3 kHz, which are the highest dominant frequencies ever known in the genus Leptobrachella (Suppl. material 1: table S4). Currently, there are no available advertisement calls of L. ventripunctata from the type locality. However, the advertisement calls from Yingjiang County, Yunnan, China, which is near the type locality, resemble those of the JZS specimens in terms of call durations, call intervals, and dominant frequency. It is important to note that the advertisement calls of the new species do not overlap with those of the JZS specimens, indicating reproductive isolation between them (Köhler et al. 2017).

Leptobrachella sungi is primarily found in northern Vietnam, specifically in the provinces of Vinh Phuc, Yen Bai, Lao Cai, Dien Bien, Phu Tho, Son La, and Tuyen Quang, as well as in Guangxi, China (Frost 2023). Previous studies have indicated that L. sungi was only observed in the SWDS area of Guangxi (Fei et al. 2012; Mo et al. 2014). In our current study, we have identified a new range of L. sungi in Guangxi, specifically in the Sishuihe Nature Reserve, located in Lingyun County, Guangxi, China (SSH, Fig. 1).

The reserve harbors four different species of Leptobrachella, indicating a remarkably high species diversity within the genus. The four species were found in the evergreen forest at SWDS between 400–600 m. However, L. guinanensis sp. nov. was found near a stream that was ~ 0.5–1.0 m wide and had running currents. Leptobrachella shangsiensis and L. shiwandashanensis occur syntopically, but the former tended to call on rocks or near (~ 1.0 m) rocky streams with fast currents, while the latter called near rocky streams ~ 2.0–3.0 m away. Leptobrachella sungi was found to call near rocky streams that were ~ 2.0–3.0 m wide with slower currents. The breeding seasons for these species are as follows: L. guinanensis sp. nov. breeds in June, L. shangsiensis and L. shiwandashanensis in April, and L. sungi in July. Further research is required to understand how these four sympatric species interact and adapt to their respective niches within the reserve.

 Acknowledgements

We would like to express our gratitude to the staff of Shiwandashan and Jinzhongshan National Nature Reserves for their valuable support during our fieldwork and for granting us permission to conduct field surveys. Additionally, we would like to acknowledge Johannes Penner, Tao Thien Nguyen, and the anonymous reviewers for enhancing the manuscript.

 Additional information Conflict of interest

The authors have declared that no competing interests exist.

 Ethical statement

No ethical statement was reported.

 Funding

This work was supported by the National Natural Science Foundation of China (grant numbers 32360128 and 32060116) and Guangxi Natural Science Foundation, China (grant number 2020GXNSFDA238022).

 Author contributions

CWC conceived and designed the study and prepared the manuscript. CWC measured the specimens, performed the molecular experiments, and analysed the data. CWC, LP, LYJ and HY conducted field surveys. PWX drew the figures. All authors read and approved the final version of the manuscript.

 Author ORCIDs

Wei-Cai Chen https://orcid.org/0000-0002-2398-4079

Peng Li https://orcid.org/0000-0001-8311-0544

Wan-Xiao Peng https://orcid.org/0000-0001-5635-9061

You-Jun Liu https://orcid.org/0000-0001-7285-4943

Yong Huang https://orcid.org/0000-0002-3493-9468

 Data availability

All of the data that support the findings of this study are available in the main text or Supplementary Information.

 References Amphibia China (2023) The database of Chinese amphibians. Kunming Institute of Zoology (CAS), Kunming. http://www.amphibiachina.org/ [Accessed 23 April 2023] ChenJMPoyarkovJr NJSuwannapoomCLathropAWuYHZhouWWYuanZYJinJQChenHMLiuHQNguyenTQNguyenSNDuongTVEtoKNishikawaKMatsuiMOrlovNLStuartBLBrownRMRowleyJJLMurphyRWWangYYCheJ (2018) Largescale phylogenetic analyses provide insights into unrecognized diversity and historical biogeography of Asian leaf-litter frogs, genus Leptolalax (Anura: Megophryidae).Molecular Phylogenetics and Evolution124: 162–171. https://doi.org/10.1016/j.ympev.2018.02.020 ChenWCLiaoXZhouSCMoYM (2019) A new species of Leptobrachella (Anura: Megophryidae) from southern Guangxi, China.Zootaxa4563(1): 67–82. https://doi.org/10.11646/zootaxa.4563.1.3 ChenWCYuGDChengZYMengTWeiHZhouGYLuYW (2021) A new species of Leptobrachella (Anura: Megophryidae) from central Guangxi, China.Zoological Research42(6): 783–788. https://doi.org/10.24272/j.issn.2095-8137.2021.179 ChenWCPengWXLiPLiuYJ (2022a) A new species of Nidirana (Anura, Ranidae) from Southern Guangxi, China.Asian Herpetological Research13(2): 109–116. https://doi.org/10.16373/j.cnki.ahr.210065 ChenWCPengWXLiuYJHuangZLiaoXWMoYM (2022b) A new species of Occidozyga Kuhl and van Hasselt, 1822 (Anura: Dicroglossidae) from Southern Guangxi, China.Zoological Research43(1): 85–89. https://doi.org/10.24272/j.issn.2095-8137.2021.252 DuboisA (1983) Note préliminaire sur le genre Leptolalax Dubois, 1980 (Amphibiens, Anoures), avec diagnose d'une espèce nouvelle du Vietnam.Alytes2: 147–153. https://doi.org/10.5962/p.297429 EmmrichMVencesMErnstRKöhlerJBarejMGlawFJansenMRödelMO (2020) A guild classification system proposed for anuran advertisement calls.Zoosystematics and Evolution96(2): 515–525. https://doi.org/10.3897/zse.96.38770 FeiLYeCYHuangYZ (1990) Key to Chinese Amphibians.Publishing House for Scientific and Technological Literature, Chongqing, 364 pp. FeiLYeCYLiSS (1992) Two new species of pelobatid toads of genus Leptolalax from Yunnan Province of China (Amphibia: Anura).Acta Biologica Plateau Sinica11: 45–54. FeiLYeCYJiangJP (2012) Colored atlas of Chinese Amphibians and their distributions.Sichuan Publishing House of Science and Technology, Chengdu, 619 pp. FrostDR (2023) Amphibian Species of the World: An Online Reference. Version 6.1. American Museum of Natural History, New York. https://doi.org/10.5531/db.vz.0001 [Accessed 21 April 2023] KöhlerJJansenMRodríguezAKokPJRToledoLFEmmrichMGlawFHaddadCFBRödelMOVencesM (2017) The use of bioacoustics in anuran taxonomy: Theory, terminology, methods and recommendations for best practice.Zootaxa4251(1): 1–124. https://doi.org/10.11646/zootaxa.4251.1.1 KumarSStecherGTamuraK (2016) MEGA 7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets.Molecular Biology and Evolution33(7): 1870–1874. https://doi.org/10.1093/molbev/msw054 LathropAMurphyRWOrlovNHoCT (1998) Two new species of Leptolalax (Anura: Megophryidae) from northern Vietnam.Amphibia-Reptilia19(3): 253–267. https://doi.org/10.1163/156853898X00160 LiGGWeiGZhangHBSuHJ (2016) A new amphibian record in Guizhou Province – Leptolalax ventripunctatus.Yesheng Dongwu37(2): 178–180. LiuCC (1950) Amphibians of western China. Fieldiana.Zoology Memoirs2: 1–397. https://doi.org/10.5962/bhl.part.4737 LuongAMNguyenHQLeDTNguyenSHLNguyenTQ (2019) New records of amphibians (Anura: Megophryidae, Ranidae) from Dien Bien Province, Vietnam.Herpetology Notes12: 375–387. MillerMAPfeifferWSchwartzT (2010) Creating the CIPRES Science Gateway for inference of large phylogenetic trees.Proceedings of the Gateway Computing Environments Workshop (GCE), New Orleans, 8 pp. https://doi.org/10.1109/GCE.2010.5676129 MoYMJianJPYeCY (2008) A new record of frogs from China: Paramegophrys (Paramegophrys) sungi (Megophryidae, Amphibia). Anhui Shi-da Xuebao.Zhexue Shehui Kexue Ban31(4): 368–370. MoYMWeiZYChenWC (2014) Colored Atlas of Guangxi Amphibians.Guangxi Science and Technology Publishing House, Nanning, 313 pp. MoYMChenWCLiaoXWZhouSC (2016) A new species of the genus Rhacophorus (Anura: Rhacophoridae) from southern China.Asian Herpetological Research7: 139–150. https://doi.org/10.16373/j.cnki.ahr.150070 PosadaD (2008) jModelTest: Phylogenetic model averaging.Molecular Biology and Evolution25(7): 1253–1256. https://doi.org/10.1093/molbev/msn083 QianTYXiaoXCaoYXiaoNWYangDD (2020) A new species of Leptobrachella (Anura: Megophryidae) Smith, 1925 from Wuling Mountains in Hunan Province, China.Zootaxa4816(4): 491–526. https://doi.org/10.11646/zootaxa.4816.4.4 RenJLAnHYangTWangKXuSCWuPCWeiSBHuangXXLiJT (2018) Preliminary herpetological resource survey and analysis in Shiwandashan National Nature Reserve, Guangxi.Sichuan Journal of Zoology37(1): 95–107. https://doi.org/10.11984/j.issn.1000-7083.20160198 RonquistFRHuelsenbeckJP (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models.Bioinformatics19(12): 1572–1574. https://doi.org/10.1093/bioinformatics/btg180 RowleyJJDauVQCaoTT (2017) A new species of Leptolalax (Anura: Megophryidae) from Vietnam.Zootaxa4273(1): 61–79. https://doi.org/10.11646/zootaxa.4273.1.5 SavageJM (1975) Systematics and distribution of the Mexican and Central American stream frogs related to Eleutherodactylus rugulosus.Copeia2(2): 254–306. https://doi.org/10.2307/1442883 SungYHYangJHWangYY (2014) A new species of Leptolalax (Anura: Megophryidae) from southern China.Asian Herpetological Research5(2): 80–90. https://doi.org/10.3724/SP.J.1245.2014.00080 TanWF (2014) Reverses of Guangxi.China Environment Publishing House, Beijing, 243 pp. WangYYLauMWNYangJChenGLiuZYPangHLiuY (2015) A new species of the genus Odorrana (Amphibia: Ranidae) and the first record of Odorrana bacboensis from China.Zootaxa3999(2): 235–254. https://doi.org/10.11646/zootaxa.3999.2.4 WangJLyuZTQiSZengZCZhangWXLuLSWangYY (2020) Two new Leptobrachella species (Anura, Megophryidae) from the Yunnan-Guizhou Plateau, Southwestern China.ZooKeys995: 97–125. https://doi.org/10.3897/zookeys.995.55939 WuYHPawangkhanantPChenJMGaoWSuwannapoomCCheJ (2021) Confirmation of Leptobrachella ventripunctata (Fei, Ye, and Li, 1990), based on molecular and morphological evidence in Thailand. Biodiversity Data Journal 9: e74097. https://doi.org/10.3897/BDJ.9.e74097 YangJHZengZCWangYY (2018) Description of two new sympatric species of the genus Leptolalax (Anura: Megophryidae) from western Yunnan of China. PeerJ 6: e4586. https://doi.org/10.7717/peerj.4586 Supplementary materials 10.3897/zookeys.1192.98352.suppl1 C7D12DD2-D9D1-5C04-AD26-65BC9F65DFE3

Morphological data

xlsx

table S1: References for morphological characters for congeners of the genus Leptobrachella. table S2: Comparative material examined. table S3: Uncorrected p-distance in Leptobrachella species based on 16S gene fragments. table S4: Dominant frequency of advertisement calls of species available in the genus Leptobrachella. table S5: Measurements of adult specimen of L. guinanensis sp. nov. and L. ventripunctata.

 https://binary.pensoft.net/file/990968 This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited. Wei-Cai Chen, Peng Li, Wan-Xiao Peng, You-Jun Liu, Yong Huang 10.3897/zookeys.1192.98352.suppl2 D34635B7-85E4-5AED-9485-58455619D069

Advertisement calls of L. sungi

tif

 https://binary.pensoft.net/file/990969 This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited. Wei-Cai Chen, Peng Li, Wan-Xiao Peng, You-Jun Liu, Yong Huang