Corresponding authors: Guohua Yu (yugh2018@126.com), Zhengjun Wu (wu_zhengjun@aliyun.com)
Academic editor: A. Ohler
In this study, based on morphological and molecular data, a new bush frog species is described from Yunnan, China. Eleven samples of
Huang J, Liu XL, Du L, Bernstein JM, Liu S, Yang Y, Yu G, Wu Z (2023) A new species of Bush frog (Anura, Rhacophoridae,
The genus
Many
In this work we studied specimens allocated to
Fieldwork was conducted at Malipo County, Yunnan Province, China (
The type locality of
Habitat at the type locality of
All the measurements were made with slide calipers to the nearest 0.1 mm. Morphological terminology and measurement methods followed
Measurements (mm) of adult specimens in the type series of
Sex | Males (n = 4) | Females (n = 2) | Males (n = 3) | Females (n = 2) | |||||||
---|---|---|---|---|---|---|---|---|---|---|---|
Catalog No. | |||||||||||
|
17.1 | 17.0 | 16.5 | 14.7 | 19.3 | 19.0 | 17.5 | 17.7 | 17.3 | 18.7 | 18.3 |
|
5.7 | 5.8 | 6.3 | 5.2 | 6.5 | 7.9 | 5.9 | 6.4 | 5.7 | 6.3 | 6.7 |
|
7.7 | 7.5 | 8.2 | 5.5 | 8.2 | 7.9 | 6.5 | 6.8 | 6.4 | 7 | 7 |
|
2.5 | 2.6 | 1.8 | 2.5 | 2.9 | 2.6 | 2 | 2.6 | 2.4 | 2.5 | 2.2 |
|
1.5 | 2.2 | 2.2 | 2.0 | 2.2 | 2.1 | 2.2 | 2.1 | 2.3 | 2.2 | 2 |
|
2.7 | 2.7 | 2.9 | 2.9 | 3.2 | 2.9 | 2.9 | 2.6 | 2.9 | 2.7 | 2.9 |
|
1.2 | 1.2 | 1.9 | 1.4 | 1.6 | 1.7 | 1.6 | 1.3 | 1.4 | 1.4 | 1.7 |
|
2.2 | 2.1 | 2.1 | 2.6 | 2.6 | 2.8 | 2.4 | 2.6 | 2.4 | 2.5 | 2.2 |
|
1.4 | 1.4 | 1.5 | 1.3 | 1.1 | 1.5 | 1.2 | 1.5 | 1.4 | 1.6 | 1.4 |
|
9.3 | 9.3 | 8.8 | 7.0 | 8.6 | 9.6 | 7.8 | 8.2 | 7.2 | 7.3 | 7.1 |
|
5.6 | 5.6 | 5.3 | 4.2 | 5.2 | 5.6 | 5.3 | 5.2 | 5.3 | 4.6 | 5.4 |
|
1.7 | 2.0 | 1.6 | 1.3 | 1.4 | 1.6 | 1.5 | 1.2 | 1.6 | 1.3 | 1.3 |
|
9.1 | 8.7 | 8.4 | 7.5 | 9.1 | 9.2 | 9 | 8.8 | 8 | 8.7 | 8.8 |
|
7.5 | 9.2 | 8.3 | 7.1 | 8.0 | 10.2 | 7.5 | 8 | 7.5 | 8.2 | 7.9 |
|
2.1 | 2.6 | 1.8 | 1.5 | 2.0 | 2.8 | 1.7 | 1.7 | 1.8 | 1.8 | 1.9 |
|
9.8 | 10.9 | 10.6 | 8.8 | 10.0 | 11.8 | 10.8 | 11 | 10.1 | 9.6 | 10.7 |
The source of morphological data for
ID | Literature | |
---|---|---|
3 |
|
|
4 |
|
|
5 |
|
|
6 | ||
7 |
|
|
8 |
|
|
9 |
|
|
10 |
|
|
11 |
|
|
12 |
|
|
13 |
|
Total DNA was extracted using a commercial tissue DNA isolation kit (Chenlu Biotech, China). For seven specimens in this study, the mitochondrial gene 16S ribosomal RNA (16S rRNA) gene was sequenced. The fragments of 16S rRNA were amplified using primers 16Sar-L (5’–CGCCTGTTTATCAAAAACAT–3’) and 16Sbr-H (5’–CCGGTCTGAACTCAGATCACGT–3’) (
Information on voucher numbers, GenBank accession numbers, and localities of specimens used in this study; for collections and their abbreviations see Material and methods.
Species | Voucher No. | GenBank No. | Locality | Resource |
---|---|---|---|---|
|
||||
|
Malipo, Yunnan, China | This study | ||
|
Malipo, Yunnan, China | This study | ||
ROM 30288 |
|
Pac Ban, Tuyen Quang, Vietnam |
|
|
|
Malipo, Yunnan, China | This study | ||
|
Malipo, Yunnan, China | This study | ||
|
Malipo, Yunnan, China | This study | ||
|
Malipo, Yunnan, China | This study | ||
|
Malipo, Yunnan, China | This study | ||
|
KIZ 035082 |
|
Qinlangdang, Yunnan, China |
|
|
CIB 116331 |
|
Xiding, Yunnan, China |
|
|
KIZ 048468 |
|
Unknown |
|
|
LSUHC:11118 |
|
Gunung Stong, Kelantan, Malaysia |
|
|
CIB 116349 |
|
Menglun, Yunnan, China |
|
|
CIB 116365 |
|
Lvchun, Yunnan, China |
|
|
KIZ 015855 |
|
Cangyuanensis, Yunnan, China |
|
|
CESF 148 |
|
Western Ghats, India |
|
|
CESF 1010 |
|
Western Ghats, India |
|
|
AGCZRL |
|
Western Ghats, India |
|
|
CESF 073 |
|
Western Ghats, India |
|
|
CESF 439 |
|
Western Ghats, India |
|
|
CESF 132 |
|
Western Ghats, India |
|
|
CESF 467 |
|
Western Ghats, India |
|
|
CESF 138 |
|
Kudremukh Massif, Western Ghats, India |
|
|
CESF 1365 |
|
Valparai plateau, Western Ghats, India |
|
|
CESF 063 |
|
Western Ghats, India |
|
|
CESF 1164 |
|
Malabar, Western Ghats, India |
|
|
CESF 130 |
|
Western Ghats, India |
|
|
CESF 438 |
|
Western Ghats, India |
|
|
CESF 442 |
|
Nilgiri Massif, Western Ghats,India |
|
|
Unknow |
|
Sri Lanka |
|
|
CESF 1127 |
|
Western Ghats, India |
|
|
CESF 1003 |
|
Western Ghats, India |
|
|
CESF 1061 |
|
Western Ghats, India |
|
|
CESF 1766 |
|
Western Ghats, India |
|
|
CESF 492 |
|
Western Ghats, India |
|
|
CESF 473 |
|
Western Ghats, India |
|
|
CESF 1012 |
|
Western Ghats, India |
|
|
CESF 072 |
|
Western Ghats, India |
|
|
CESF 1342 |
|
Western Ghats, India |
|
|
CESF 094 |
|
Western Ghats, India |
|
|
CESF 386 |
|
Western Ghats, India |
|
|
CESF 1258 |
|
Western Ghats, India |
|
|
CESF 114 |
|
Western Ghats, India |
|
|
CESF 1385 |
|
Western Ghats, India |
|
|
CESF 444 |
|
Western Ghats, India |
|
|
CESF 1259 |
|
Western Ghats, India |
|
|
CESF 1252 |
|
Manalar Plateau, Western Ghats, India |
|
|
CESF 1111 |
|
Western Ghats, India |
|
|
CESF 1187 |
|
Western Ghats, India |
|
|
CESF 483 |
|
Western Ghats, India |
|
|
FB-2008c |
|
Munnar, Idukki, Kerala, India |
|
|
CESF 1199 |
|
Western Ghats, India |
|
|
CESF 044 |
|
Western Ghats, India |
|
|
CESF 1236 |
|
Western Ghats, India |
|
|
CESF 1080 |
|
Western Ghats, India |
|
|
CESF 1260 |
|
Western Ghats, India |
|
|
CESF 1238 |
|
Western Ghats, India |
|
|
CESF 061 |
|
Western Ghats, India |
|
|
||||
|
ROM 33145 |
|
Krong Pa, Gia Lai, Vietnam |
|
The final DNA sequence dataset is consisted of 59 sequences and the length of the sequence alignment is 542 base pairs (bp) (Table
Uncorrected pairwise sequence divergence (%) among 16S ribosomal RNA mtDNA sequences, including
Species | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 |
---|---|---|---|---|---|---|---|---|---|---|
|
4.5 | |||||||||
|
4.8 | 2.0 | ||||||||
|
4.5 | 4.2 | 4.0 | |||||||
|
5.9 | 5.1 | 5.9 | 5.4 | ||||||
|
5.7 | 6.6 | 6.8 | 5.6 | 7.1 | |||||
|
3.1 | 4.7 | 4.9 | 4.0 | 4.0 | 5.6 | ||||
|
5.2 | 4.2 | 4.9 | 5.7 | 2.0 | 5.9 | 4.7 | |||
|
4.3 | 4.9 | 5.2 | 4.3 | 61 | 6.3 | 4.2 | 5.4 | ||
|
6.0 | 6.1 | 6.4 | 5.2 | 45 | 6.8 | 5.4 | 4.5 | 5.4 | |
|
5.2 | 6.1 | 6.4 | 5.0 | 6.6 | 6.6 | 4.2 | 6.2 | 3.3 | 5.7 |
Phylogram of
The genus
Adult male (Fig.
Holotype (
Forelimbs fairly robust (
Foot long and relatively robust (
Dorsal surfaces of head, body, forelimbs, thighs, and tibia rough with small granules; upper eyelid with several small granules; throat, chest, and ventral surfaces of forelimbs smooth; abdomen, ventral side of thigh, and area around vent with granules; dorsolateral folds absent.
For coloration of the holotype in life see Fig.
After preservation in alcohol, the general pattern did not change. Dorsal color changed to grayish brown, the blotches or spots blackish brown, discs on the fingers become pale gray similar to the body color, ventral side become whiter (Fig.
Holotype (
The specific epithet is named for the type locality, Malipo County, Yunnan Province, China. We suggest “Malipo Bush Frog” as its English common name, and “Ma Li Po Guan Shu Wa (麻栗坡灌树蛙)” as its Chinese common name.
Currently known from the type locality, Malipo County (Fig.
The measurements are given in Table
Rather than comparing
Comparison of
Species |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
14.6–17.7, |
16.6–21.6, |
– | 15.0–19.0, |
14.5–17.7, |
17.0–19.6, |
16.1–19.0 mm, |
19.1–25.5, |
18.8–19.0 mm, |
– | 30 mm, |
17.4–18.2 mm, |
21.4–23.9 mm, |
13.5–24.0 mm, |
|
18.3–19.3, |
18.9–20.5, |
23.6, |
– | 17.5, |
21.5, |
– | 15.4–29.8, |
– | 17.0 mm, |
– | – | – | ||
14.6–19.3, |
16.6–21.6, |
23.6, |
15.0–19.0, |
14.5–17.7, |
17.0–21.5, |
16.1–19.0 mm, |
15.4–29.8, |
18.8–19.0 mm, |
17.0 mm, |
30 mm, |
17.4–18.2 mm, |
21.4–23.9 mm, |
13.5–24.0 mm, |
|
– | – | |||||||||||||
HDW/HDL | HDW > HDL | HDW < HDL | HDW > HDL | HDW < HDL | HDW < HDL | HDW > HDL | HDW > HDL | HDW > HDL | HDW > HDL | HDW < HDL | – | HDW > HDL | HDW ≈ HDL | HDW > HDL |
Tympanum | Distinct | Indistinct | Distinct | Distinct | Distinct | Distinct | Indistinct | Indistinct | Indistinct | Distinct | Indistinct | Indistinct | Distinct | Distinct |
Nuptial pad | Small and milky white | white nuptial pad | – | Absent | Present | Present | Reddish nuptial pad | Absent | Absent | – | – | – | Present | – |
Toe web | I 2 – 2 II 2 – 2 III 2 – 3 IV 3 – 2 V | II 1 – 2 III 1 – 21/2 IV 21/2 – 1 V | Webbing present, medium | Rudimentary web | II 1 – 2 III 1–21/2 IV 21/2 – 1 V | II 1 – 2 III 1 – 2 – IV 2 – 1 V | Rudimentary web | I 2 – 2 II 2 – 2½ III 2 – 3 IV 2½ – 2 V | I2 – 2 II 1¾ – 2 III 1½ – 3 IV 2¾ – 2 V | Rudimentary web | 1/3 webbing | Rudimentary web | 1/4 webbing | 1/3 webbing |
Lateral dermal fringe | Present | Absent | – | – | Present | Absent | Present | Present | Absent | Present | – | – | – | – |
Disc color | Yellow | Not orange in life | – | Greyish or orange | – | Orange | Orange | – | Reddish or whitish | – | – | – | Reddish, orange, or whitish | orange |
Inner metacarpal tubercle | Indistinct | Present | Present | Present | Indistinct | Indistinct | – | – | Absent | Present | – | – | Present | Present |
Outer metacarpal tubercle | Indistinct | Present | Present | Present | Indistinct | Indistinct | – | – | Absent | Present | – | – | Present | Present |
Inner metatarsal tubercle | Round | Present | Present | Round | Round | Round | Round | Round | Absent | Absent | – | Present | Present | Present |
Outer metatarsal tubercle | Absent | Present | Absent | Absent | Absent | Absent | Absent | Absent | Absent | Absent | – | Absent | Absent | Absent |
Relative toe lengths | I < II < V < III < IV | III ≈ V, or V > III | I < II < V < III < IV | I < II < V < III < IV | I<II<III<V<IV | I<II<III<V<IV | I<II<V<III<IV | I<II<V=III<IV | I < II < V < III < IV | I < II < V = III < IV | – | I < II ≤ V < III < IV | III ≈ V | I < II < III = V < IV |
Range | Malipo, Yunnan, China and the north of Vietnam | Mengla, Yunnan, China | Indochina Peninsula and peninsular Malaysia | Gongshan, Yunnan, China | Menghai, Yunnan, China | Lvchun, Yunnan, China | Cangyuan, Yunnan, China | Western Ghats, India | Northeastern Bangladesh | Himalayas and northeastern India | Western Ghats, India | Western Ghats, India | Yunnan, China and Lai Chau,Vietnam | India, North Myanmar, Tibet and Yunnan, China |
The new species differs from
The new species differs from
The new species differs from
The new species differs from
The new species differs from
The new species differs from
The new species differs from
The new species differs from
The new species differs from
The new species differs from
The new species differs from
The new species differs from
The new species differs from
Recently,
Morphological comparison between
Character | Species | |
---|---|---|
|
14.6–19.3 mm | 25.0–27.0 mm, |
|
5.2–7.9 mm | 8.0–9.5 mm |
|
5.5–8.2 mm | 10.0–11.0 mm |
|
2.1–2.8 mm | 3.0–3.5 mm |
|
1.8–2.9 mm | 4–4.5 mm |
|
4.2–5.6 mm | 7.5–8.5 mm |
|
7.5–9.2 mm | 12–13 mm |
|
1.1–1.6 mm |
tympanum indistinct |
Tubercles along forearm and foot | absent | present |
Web of toes | I 2 – 2 II 2 – 2 III 2 – 3 IV 3 – 2 V | toes a little more than half webbed |
Web of fingers | no webbing between fingers | fingers free except for a rudiment of a web between the two outer fingers |
Metatarsal tubercle | inner metatarsal tubercle rounded, outer metatarsal tubercle absent | a small inner metatarsal tubercle |
Coloration | dorsal surface beige, with pale brown and dark brown spots, an individual having large black spots on its body surface | dorsal color with pale or dark brown, green, yellow, or grey, many individuals had a bright green patch on the snout, and patches of similar color on the knees and round the vent |
In recent years, many new species have been found along the border between China and Vietnam, such as
We thank reviewers for their comments on the manuscript. This work was supported by grants from the National Natural Science Foundation of China (32060114), Guangxi Natural Science Foundation Project (2022GXNSFAA035526), Key Laboratory of Ecology of Rare and Endangered Species and Environmental Protection (Guangxi Normal University), Ministry of Education (ERESEP2022Z04), ang Guangxi Key Laboratory of Rare and Endangered Animal Ecology, Guangxi Normal University (19-A-01-06).