2urn:lsid:arphahub.com:pub:45048D35-BB1D-5CE8-9668-537E44BD4C7Eurn:lsid:zoobank.org:pub:91BD42D4-90F1-4B45-9350-EEF175B1727AZooKeysZK1313-29891313-2970Pensoft Publishers10.3897/zookeys.1159.9012090120Research ArticleAraneaeHeptathelidaeTaxonomyCenozoicNeogeneAsiaChinaSystematic notes on three new Luthela (Mesothelae, Heptathelidae) spiders from China, with their descriptionsWeiMianhttps://orcid.org/0000-0001-7348-88851Writing - original draftWangShuqiao1LinYuchenglinyucheng@scu.edu.cnhttps://orcid.org/0000-0002-5054-06331SupervisionKey Laboratory of Bio-resources and Eco-environment (Ministry of Education), College of Life Sciences, Sichuan University, Chengdu, Sichuan 610064, ChinaSichuan UniversityChengduChinaThe Sichuan Key Laboratory for Conservation Biology of Endangered Wildlife, Sichuan University, Chengdu, Sichuan 610064, ChinaSichuan UniversityChengduChina
Corresponding author: Yucheng Lin (linyucheng@scu.edu.cn)
Academic editor: Peter Michalik
2023020520231159151168EE0AEE0F-F72A-593B-B9BC-A14345E5298ADEC4657E-FE24-45DB-B132-E916EC4E3A100807202217042023Mian Wei, Shuqiao Wang, Yucheng LinThis is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.http://zoobank.org/DEC4657E-FE24-45DB-B132-E916EC4E3A10
Three new segmented trapdoor spider species belonging to the family Heptathelidae Kishida, 1923, i.e., Luthelaasukasp. nov. (♂♀, Sichuan), L.beijingsp. nov. (♂♀, Beijing), and L.kagamisp. nov. (♂♀, Sichuan), are described from China. Their phylogenetic position and relationships within Heptathelidae are tested and assessed using a combination available COI data downloaded from GenBank with new DNA sequences obtained in this study. The results show that the new species form a clade with eight known and one undescribed species of Luthela. High-definition illustrations of the male palps and female genitalia, diagnoses, and DNA barcodes are provided for these three new species, and their distributions are mapped.
Burrowing spiderCOIheptathelidsmolecular analysisnew speciestaxonomyNational Natural Science Foundation of China501100001809http://doi.org/10.13039/501100001809Citation
Wei M, Wang S, Lin Y (2023) Systematic notes on three new Luthela (Mesothelae, Heptathelidae) spiders from China, with their descriptions. ZooKeys 1159: 151–168. https://doi.org/10.3897/zookeys.1159.90120
Introduction
Mesotheles, commonly known as primitively segmented spiders, are characterized by having a series of plates on the abdomen and the spinnerets situated in the middle of ventral abdomen. The suborder Mesothelae previously included only one extant family Liphistiidae Thorell, 1869 (s.l.), which has now been split into two closely related families, Heptathelidae Kishida, 1923 and Liphistiidae Thorell, 1869 (s.s.) (Petrunkevitch 1939).
The family Heptathelidae currently consists of 107 extant species in seven genera, whose range is limited to the Far East, such as in Japan, the Ryukyu Islands, China, and Vietnam (Xu et al. 2021; WSC 2023). This family was originally described as a tribe (Heptatheleae) of Liphistiidae (s.l.) by Kishida (1923), and subsequently was elevated to the level of a family by Petrunkevitch (1939) and confirmed by Haupt (1983). Raven (1985) synonymized Heptathelidae with Liphistiidae (s.l.). Recent molecular phylogenetic studies (Xu et al. 2015a, 2015b, 2021) have confirmed the monophyly of Liphistiidae (s.l.) as well as that of its two subfamilies, Heptathelinae and Liphistiinae. Li (2022) restored the subfamily Heptathelinae to the family level and circumscribed Liphistiidae (s.s.) to include only all extant species of Liphistius Schiødte, 1849. Based on extensive comparisons of the estimated divergence time in extant spider families and known fossils, Breitling (2022) suggested that it would make more sense to reunite both families into Liphistiidae (s.l.). WSC (2023) took note of Breitling’s viewpoint, but at present rejected his proposal on the grounds that the age of splitting is not sufficient reason to reunite the families.
Luthela Xu & Li, 2022, an endemic genus of northern China, was newly erected and delimited on the basis of morphological characters and molecular data, and it was transferred from Liphistiidae to Heptathelidae (Li 2022; Xu et al. 2022). At present, Luthela includes eight known extant species, which are distributed almost exclusively north of the Yangtze River to the Yellow river basin in China, but no species have been recorded in Beijing and Sichuan.
The aims of this paper are 1) to describe and illustrate the three new species; 2) to provide the COI sequences of them for verifying their sex pairing; 3) to test their phylogenetic position and relationships within heptathelids; and 4) to map the geographic distributions of these extant Luthela species. This paper expands the knowledge of species diversity of Chinese Heptathelidae.
Materials and methodsSpecimens sampling
Specimens studied here were collected from Beijing City and Sichuan provinces, China, on 8 October 2019, 15 June 2022, 16 October 2022, and 30 January to 1 February 2023. All specimens were captured by hand and stored in 95% ethanol at −20 °C.
Molecular data
To test the taxonomic position of the three Luthela species, five individuals were selected from the examined materials for molecular data collection. The first and second legs on the right were used to extract genomic DNA and sequence the gene fragments COI. The rest of the bodies were kept as vouchers. All molecular data were obtained from specimens collected at the type localities of the species, although not from the type specimens themselves. Whole genomic DNA was extracted from tissue samples with the Universal Genomic DNA Kit (CWBIO, Beijing, China) following the manufacturer’s protocol for animal tissue. The COI gene fragments were amplified in 50 µL reactions. Primer pairs and PCR protocols are given in Table 1. Raw sequences were edited and assembled using Mesquite v. 3.02 (Maddison and Maddison 2011). New sequences were deposited in GenBank (Table 2). All molecular vouchers and examined materials are stored in the
Natural History Museum of Sichuan University in Chengdu, China (NHMSU).
Loci, primer pairs, and PCR protocols used here.
Loucus
Annealing temperature/time
Direction
Primer
Sequence 5ʹ → 3ʹ
Reference
COI
49 °C/15 s
F
LCO1409
GGTCAACAAATCATAAAGATATTGG
Folmer et al. 1994
R
HCO2198
TAAACTTCAGGGTGACCAAAAAATCA
To place these new species in a proper taxonomic position within Heptathelidae and verify their sexual pairing, we used these sequences and a selection from previously sequenced taxa to assemble a phylogeny of heptathelid spiders: Ganthela Xu & Kuntner, 2015, Heptathela Kishida, 1923, Luthela, Qiongthela Xu & Kuntner, 2015, Ryuthela Haupt, 1983, Songthela Ono, 2000, and Vinathela Ono, 2000. In addition, a Liphistius species was used as the outgroup (Table 2). Sequences were aligned with MAFFT v. 7.505 (Katoh and Standley 2013) using ‘-auto’ strategy and normal alignment mode. Best partitioning scheme and evolutionary models for three predefined partitions were selected using PartitionFinder2 v. 2.1.1 (Lanfear et al. 2017), with all algorithms and Akaike information criterion (AIC). SYM+I+G, HKY+I+G, and GTR+G were selected for the first, second, and third codon positions of COI, respectively.
List of segmented spider taxa and their COI data used for phylogenetic analysis of heptathelids (including five new DNA sequence data obtained here).
Species
Identifier
COI
Species
Identifier
COI
Liphistiusdesultor
LS054
KR028518
Vinathelacucphuongensis
XUX-2013-008
KT767580
Ganthelacipingensis
XUX-2013-516
KP875509
Vinathelanenglianggu
DQ-2018-036
MN400648
Ganthelajianensis
XUX-2013-534
KP875503
Luthelabadong
XUX-2012-140
KP229863
Ganthelaqingyuanensis
XUX-2012-288
KP875525
Lutheladengfeng
XUX-2012-031
MH172686
Ganthelavenus
XUX-2013-160
KP875483
Luthelahandan
XUX-2011-214
KP229810
Ganthelawangjiangensis
XUX-2012-278
KP875508
Luthelaluotianensis
XUX-2012-079
KP229881
Ganthelaxianyouensis
XUX-2013-153
KP875526
Luthelaschensiensis
XUX-2011-273
MH172701
Heptathelakimurai
XUX-2013-356
MN274707
Luthela sp.
XUX-2016-110
MH172699
Heptathelatokashiki
XUX-2014-051
MN274727
Luthelataian
XUX-2014-143A
MH172722
Qiongthelabaishensis
XUX-2012-087
KP229805
Luthelayiyuan
XUX-2012-051
MH172727
Qiongthelaqiongzhong
XUX-2017-156
MN911987
Luthelayuncheng
XUX-2011-235
MH172738
Ryuthelanishihirai
OKR19
AB778138
Luthelaasuka sp. nov.
WM-2019-A002
OQ661856
Ryuthelaunten
XUX-2012-531
MF078619
Luthelaasuka sp. nov.
WM-2023-A003
OQ661857
Songthelabristowei
XUX-2012-256
KP229808
Luthelabeijing sp. nov.
WM-2022-B001
OQ661858
Songthelaciliensis
XUX-2012-177
KP229918
Luthelakagami sp. nov.
WM-2023-K001
OQ661859
Songthelahangzhouensis
XUX-2013-171
KT767579
Luthelakagami sp. nov.
WM-2023-K002
OQ661860
Bayesian phylogenetic inference (BI) was performed using MrBayes v. 3.2.7 (Ronquist et al. 2012) through Phylosuite v. 1.2.3 (Zhang et al. 2020) using four Markov Chain Monte Carlo (MCMCs) chains with default heating parameters for 50,000,000 generations or until the average standard deviation of split frequencies was <0.01. Markov chains were sampled every 5000 generations, and the first 25% of sampled trees were burn-in. The website iTOL v. 6.7 (Letunic and Bork 2021) was used to analyse the performance of our BI analyses. Maximum-likelihood (ML) phylogenies were also inferred using IQ-TREE v. 2.0 (Nguyen et al. 2015) through Phylosuite v. 1.2.3 (Zhang et al. 2020) under Edge-linked partition model for 1000 ultrafast (Minh et al. 2013) bootstraps, as well as the Shimodaira–Hasegawa-like approximate likelihood-ratio test (Guindon et al. 2010).
Morphological data
Specimens were examined and measured with a Leica M205 C stereomicroscope. All male palps and female genitalia were dissected from the bodies before being examined and photographed. To reveal the internal structure, female genitalia were boiled for 5 min in KOH solution (1 mol/L) at 45 °C, and then a dissection needle was used to remove the remaining soft tissue before being photographed. Photographs of male palps and female genitalia were taken with a Canon EOS 60D wide zoom digital camera (8.5 megapixels) mounted on an Olympus BX 43 compound microscope. The images were montaged using Helicon Focus v. 7.0.2 image stacking software (Khmelik et al. 2006). All measurements are given in millimeters. Eye diameters were measured as the maximum diameter in either dorsal or frontal views. Leg measurements are given in the following sequence: total length (femur, patella + tibia, metatarsus, tarsus). Body length was measured only from the anterior edge of prosoma to the posterior edge of opisthisoma, excluding the chelicerae.
Abbreviations used in the text or figures as follows:
ALE anterior lateral eyes;
AME anterior median eyes;
ASC apical spine of conductor;
BSC basal spine of conductor;
Co conductor;
CT contrategulum;
DT dorsal extension of TA;
E embolus;
EO embolus opening;
MA marginal apophysis of tegulum;
MH middle haematodocha;
PC paracymbium;
PLE posterior lateral eyes;
PME posterior median eyes;
RC receptacular cluster;
ST subtegulum;
T tegulum
TA terminal apophysis of tegulum.
ResultsPhylogenetic analysis
The BI analysis of the dataset of COI genes recovered a single parsimonious tree topology. This tree shows heptathelids are monophyletic but with low support. All 29 heptathelid species included are divided into two major clades, and the seven genera they represent formed the following phylogenetic relationships: (Songthela + (Vinathela + (Ganthela)) + (Luthela + (Qiongthela + (Ryuthela + Heptathela)))). These seven genera are also monophyletic, with high support in clades of Songthela, Vinathela, Qiongthela, Ryuthela, and Heptathela, but low support in the Ganthela and Luthela clades. Three new species (Fig. 1, indicated by red font) are nested within Luthela, which is a clade composed of 12 Luthela species (Fig. 1, indicated by a pink box). The sex pairing of all three new species were confirmed to be correct and highly supported as separate clades and belong to the genus Luthela. The sister group relationship of Luthelaasuka sp. nov. and Luthelakagami sp. nov. has high support. The same relationship occurs between Luthelabeijing sp. nov. and LuthelahandanXu et al., 2022. These results support our taxonomic decision to recognise them as new species and confirm their higher affinities.
Tree topology obtained by Bayesian analysis in MrBayes v. 3.2.7. Numerical values at nodes indicate posterior probabilities. Note: 29 species representing the family Heptathelidae were clustered into a monophyletic group; the high support of three new species (red font) in the genus Luthela (pink box), and the low support of monophyly of 12 Luthela species. Liphistiusdesultor (light grey box) of Liphistiidae was selected as outgroup for this phylogenetic analysis. Habitus images: ALuthelaasuka sp. nov. BLuthelakagami sp. nov. CLuthelabeijing sp. nov. Photographs by Yejie Lin.
https://binary.pensoft.net/fig/844932
The result of ML is consistent with that of the BI on some major clades, but there are some differences (Fig. 2). In the ML tree, all 29 heptathelid species also clustered into a monophyletic group. Different from the topology structure of BI tree, the phylogenetic relationships of the seven genera they represent are as follows: (Vinathela + (Songthela + (Ganthela + (Luthela + (Qiongthela + (Ryuthela + Heptathela)))))). Also, as in the BI tree, the clades of Vinathela, Songthela, Qiongthela, Ryuthela, and Heptathela have high support, but the clades of Ganthela and Luthela have low support. As a sister group, the clade of Luthela is delimited to include eight known, three new, and one still undescribed species. Both BI and ML analyses show that the three new species form a clade which is the sister group to remaining Luthela species. The available molecular evidence supports the taxonomic placement of the three new Luthela species.
Tree topology obtained by maximum likelihood in IQ-TREE v. 2.0. Numbers at nodes are bootstrap values; other conventions as in Fig. 1. The clade of the three new Luthela species (red font) is nested within Luthela (pink box). Further clades are other genera of Heptathelidae (Heptathela, Ryuthela, Qiongthela, Ganthela, Songthela, and Vinathela are from the bottom up).
Luthelayiyuan Xu, Yu, Liu & Li, 2022 by original designation, from Yiyuan Co., Shandong Province, China.
Diagnosis.
Males of Luthela differ from those of other heptathelid genera except Songthela, by the smooth conductor with one or two long spines (see ASC and BSC in Figs 3C, 4B, 5B, 6B), and they can be distinguished from the males of Songthela in having regular larger teeth on the contrategular margin (see CT in Figs 3B, 3C, 4B, 5D, 6B, 6C). Females of Luthela can be recognized from those of other genera by the middle pair of the receptacular clusters being situated at the anterior margin of the bursa copulatrix and the lateral ones at the dorsolateral position of the bursa copulatrix (Fig. 3H, 5F, 5H, 6H).
New species of LuthelaA, B, GL.asuka sp. nov. from Longquanyi District, Chengdu C, D, H, IL.beijing sp. nov. from Zizhuyuan Park, Beijing E, FL.kagami sp. nov. from Guihua Township, Pengzhou City A, C, E male habitus, dorsal view B, D, F female habitus, dorsal view G female haibitus, ventral view H living female, dorsal view I burrow, vertical section, with red arrow pointing to the spider. Photographs by Chao Wu (H, I). Scale bars: 5.00 mm.
https://binary.pensoft.net/fig/844934Composition.
Luthelaasuka Wei & Lin, sp. nov. (♂♀, Sichuan), LuthelabadongXu et al., 2022 (♂♀, Hubei), L.beijing Wei & Lin, sp. nov. (♂♀, Beijing), L.dengfengXu et al., 2022 (♂♀, Henan), L.handanXu et al., 2022 (♂♀, Henan), Luthelakagami Wei & Lin, sp. nov. (♂♀, Sichuan), L.luotianensis (Yin et al., 2002) (♀, Hubei), L.schensiensis (Schenkel, 1953) (♂♀, Shaanxi), L.taianXu et al., 2022 (♂♀, Shandong), L.yiyuanXu et al., 2022 (♂♀, Shandong), and L.yunchengXu et al., 2022 (♂♀, Shanxi).
Distribution.
Northern China, from the Yangtze River to the Yellow river basin.
Holotype ♂, China: Sichuan Province, Chengdu City, Longquanyi District, Longquan Mountain Forest Park, near Tiangong Temple, 30.5305°N, 104.2709°E, 636 m elev., 8.X.2019, M. Wei and Y. Shen leg. Paratypes 1♀, China: Sichuan Province, Chengdu, Longquan District, Longquan Mountain Forest Park, near the expressway of Chengdu to Jianyang, 30.5381°N, 104.3015°E, 740 m elev., 16.X.2022, S. Wang leg.; 1♀, China: Sichuan Province, Chengdu, Longquan District, Longquan Mountain Forest Park, near the expressway of Chengdu to Jianyang, 30.5381°N, 104.3015°E, 740 m elev., 1.II.2023, S. Wang and M. Wei leg. Deposited in NHMSU.
Etymology.
The specific epithet is from “Asuka Langley Soryu”, a fictional character wearing a red combat suit from the animation “Evangelion” (by the Japanese creator Hideaki Anno), refers to the body color; noun (name) in apposition.
Diagnosis.
Males can be distinguished from those of congeners, except L.kagami Wei & Lin, sp. nov., in lacking the BSC (Fig. 4A), contrary to other species (cf. Xu et al. 2022: figs 3B, 5E, 6B, 7E, 10B, 12B, 14D), and in having the contrategulum bearning relatively dense, smaller serrated teeth (Fig. 4B, E), rather than sparse and larger teeth in other species (cf. Xu et al. 2022: figs 3A, 5D, 6B, 7D, 10H, 12D, 14H). Males also differ from L.kagami sp. nov. in having two nearly invisible lateral teeth on the middle portion of the conductor and the longer TA (Fig. 4A–C, E, F), rather than two relatively larger teeth and a shorter TA in the latter (Fig. 7B–D, F). Females differ from those of congeners in having the paired receptacular clusters situated at the relatively short genital stalks and in the relatively smaller size (Fig. 4G, H), rather than the long genital stalks and the larger size (cf. Xu et al. 2022: figs 4, 5H, I, 6H–M, 8, 9, 11, 13, 14H–M). Females differ from those of L.kagami sp. nov. in having the receptacular clusters relatively separated and the lateral pair larger than the middle pair (Fig. 4G, H), rather than closer and nearly equal in size (Fig. 7G, H).
Luthelaasuka sp. nov. A male left palp bulb, prolateral view B male left palp bulb, ventral view C male left palp bulb, retrolateral view D left cymbium, ventral view E left palpal bulb, apical view F right palpal bulb, apical view G vulva, ventral view H vulva, dorsal view. Green arrows indicate small teeth on conductor. Scale bars: 0.50 mm.
https://binary.pensoft.net/fig/844935Description.
Male (holotype) (Fig. 3A). Carapace red; cervical and radial groove distinct. Cephalic region moderately raised. Chelicerae robust; fang furrow with 11 promarginal teeth of variable size. Sternum longer than wide. Abdomen pale yellow, with 5 large dorsal and 2 small posterior tergites, 4 tapering setae near posteromargin of 5 large tergites, and 2 on the rest. Seven spinnerets. Measurements: body 12.06 long. Carapace 5.59 long, 5.09 wide. Abdomen 5.92 long, 4.51 wide. Sternum 2.49 long, 1.91 wide. ALE > PLE > PME > AME. Leg I 18.00 (4.90 + 5.58 + 4.66 + 2.86), leg II 18.08 (4.54 + 5.42 + 5.04 + 3.08), leg III 19.31 (4.20 + 5.41 + 5.87 + 3.83), leg IV 26.76 (6.21 + 7.70 + 8.10 + 4.76).
Palp (Fig. 4A–F): prolateral paracymbium pale, weakly sclerotized, with numerous setae and spines at distal and retrolateral surface. Contrategular margin denticulate, with large teeth on proximal part and smaller but denser teeth on distal part. Marginal apophysis of tegulum serrated, with tapering terminal apophysis of tegulum, margin of dorsal extension of terminal apophysis with teeth varied in size and distance. Conductor smooth, fused to embolic base, with large apical spine and 2 tiny lateral spines on middle portion. Embolus with translucent, flat opening and several ribbed ridges distally.
Female (one of paratypes) (Fig. 3B, G). Carapace red, with dark pattern; cervical and radial grooves distinct, with sparse spines. Cephalic region slightly elevated. Chelicerae more robust than male, fang furrow with 12 promarginal teeth of variable size, larger than male. Sternum longer than wide. Abdomen pale, with five large and five small tergites; chaetotaxy on tergites as in male. Seven spinnerets. Measurements: body 16.12 long. Carapace 7.02 long, 6.94 wide. Abdomen 8.93 long, 8.08 wide. Sternum 3.39 long, 1.86 wide. ALE > PLE > PME > AME. Leg I 14.84 (4.80 + 5.50 + 2.57 + 1.97), leg II 14.96 (4.59 + 4.66 + 3.32 + 2.39), leg III 14.70 (4.64 + 4.61 + 2.94 + 2.51), leg IV 22.24 (6.57 + 6.64 + 5.83 + 3.20).
Female genitalia (Fig. 4G, H). Two pairs of receptacular clusters situated on short and thick stalks; lateral pair relatively larger than middle pair. Middle pair of receptacular clusters separated from each other, situated on anteromargin of bursa copulatrix; lateral receptacular clusters situated slightly dorsolaterally.
Holotype ♂ and paratypes 1♂ 2♀, China: Beijing, Haidian District, near Baishi Bridge, Zizhuyuan Park, 39.9393°N, 116.3110°E, 55 m elev., 15.VI.2022, H. Yang leg. Deposited in NHMSU.
Etymology.
The specific epithet derives from the type locality; noun in apposition.
Diagnosis.
Males of this new species can be recognized from those of other congeners, except L.handan, L.schensiensis, L.yiyuan, and L.yuncheng, by the conductor having 2 spines of nearly equal length and by having a lateral tooth on the middle portion of conductor (Fig. 5B, F), rather than 2 spines in unequal length or lacking a lateral tooth on the conductor (cf. Xu et al. 2022: figs 5B, D, 6A, E, 12A, B, D). Males differ from those of L.schensiensis and L.yuncheng in having 6 or 7 large teeth on the contrategular (Figs 5F, 6A), rather than 7–10 in L.schensiensis and 8 in L.yuncheng. (cf. Xu et al. 2022: figs 10G, K, 14D). Males differ from those of L.yiyuan by the margin of the contrategular having relatively longer teeth and the distal tooth bifurcated (Figs 5B, 6A, D), rather than shorter teeth on contrategular and the distal tooth with 3 serrations. (cf. Xu et al. 2022: fig. 3G, K). And males differ from those of L.handan in having the basal spine of conductor thinner and shorter and the promixal part of the margin of the marginal apophysis with a row of smaller teeth (Figs 5B, F, 6B, D), rather than with a thick, long basal spine on the conductor and the proximal margin of the marginal apophysis with 3 larger teeth. (cf. Xu et al. 2022: fig. 7E, G). Females can be distinguished from those of congeners in having the 2 paired receptacular clusters with longer genital stalks and the lateral pair equal to ca 2× size the middle ones (Fig. 6E–H), rather than shorter genital stalks and the lateral receptacular clusters greater than 3× or less than 2× the middle ones in size (cf. Xu et al. 2022: figs 4, 5H, I, 6H–M, 8, 9, 11, 13, 14).
Luthelabeijing sp. nov., male holotype A left palp, prolateral view B left palp, ventral view C left palp, retrolateral view D right palpal bulb, ventral view E right palpal bulb, dorsal view F right palpal bulb, apical view. Green arrows in B, C, and F indicate small teeth on conductor. Scale bars: 0.50 mm.
Luthelabeijing sp. nov. A–D left palpal bulb E–H female genitalia A, F, H dorsal view B, E, G ventral view C retrolateral view D apical view. Scale bars: 0.50 mm.
https://binary.pensoft.net/fig/844937Description.
Male (holotype) (Fig. 3C). Carapace black in life; cervical and radial grooves distinct, with sparse spines. Cephalic region moderately raised. Chelicerae robust; fang furrow with 9 promarginal teeth of variable size. Sternum longer than wide. Abdomen pale, with short setae, with 4 large dorsal and 6 small posterior tergites. Four tapering setae near posteromargin of large tergites, 2 on the rest. Seven spinnerets. Measurements: body 14.89 long. Carapace 6.22 long, 5.38 wide. Abdomen 7.82 long, 4.08 wide. Sternum 2.99 long, 1.86 wide. ALE > PLE > PME > AME. Leg I 17.62 (5.13 + 5.26 + 4.46 + 2.77), leg II 17.93 (5.26 + 5.49 + 4.36 + 2.82), leg III 19.34 (4.89 + 5.62 + 5.47 + 3.36), leg IV 25.27 (6.04 + 7.29 + 7.79 + 4.15).
Palp (Figs 5A–F, 6A–D): prolateral paracymbium pale, weakly sclerotized; distal and retrolateral sides with numerous setae and spines. Contrategulum with denticulate margin, with 7 teeth, the fifth bifurcated, and only 4 large teeth visible in dorsal view. Posterior part of marginal apophysis of tegulum serrated, with regular, small denticles; terminal apophysis of tegulum relatively long, apex pointed in distal view, margin of dorsal extension of terminal apophysis with teeth nearly equal in size and distance. Conductor smooth, fused to embolic base, 2 long spines separated at a wide angle, a small tooth located between upper spines and lower spines of conductor. Embolus with translucent, flat opening, and several ribbed ridges distally.
Female (one of paratypes) (Fig. 3D, H, I). Carapace red; cervical and radial grooves distinct, with sparse spines. Cephalic region slightly elevated. Chelicerae more robust than male; fang furrow with 10 promarginal teeth of variable size; larger than male. Sternum longer than wide. Abdomen pale, with 4 large and 6 small tergites; chaetotaxy on tergites as in male. Seven spinnerets. Measurements: body 18.12 long. Carapace 7.36 long, 7.29 wide. Abdomen 9.72 long, 7.28 wide. Sternum 3.62 long, 2.49 wide. ALE > PLE > PME > AME. Leg I 15.63 (5.01 + 5.54 + 3.05 + 2.03), leg II 14.80 (4.90 + 4.72 + 3.08 + 2.10), leg III 16.22 (4.99 + 5.29 + 3.70 + 2.24), leg IV 23.23 (6.22 + 7.10 + 6.27 + 3.64).
Female genitalia (Fig. 6E–H). Two pairs of receptacular clusters situated on stalks, middle pair of receptacular clusters separated from each other, on anteromargin of bursa copulatrix, distinctly smaller than lateral pair. Lateral receptacular clusters dorsolateral, stalks thick.
Holotype ♂, China: Sichuan Province, Pengzhou, Guihua County, 31.0548°N, 103.8100°E, 664 m elev., 4.X.2021, Y. He leg.; paratypes 2♀, same data as holotype, 30.I.2023, S. Wang and M. Wei leg. Deposited in NHMSU.
Etymology.
The specific epithet is from “Hiiragi Kagami”, a fictional character from the comic “Lucky Star” (written and illustrated by the Japanese cartoonist Yoshimizu Kagami) with haircut similar to “Asuka Langley Soryu” (see Etymology of Luthelaasuka sp. nov.); the name refers to the great similarity between these two new species; noun (name) in apposition.
Diagnosis.
Males can be distinguished from those of other congeners, except L.asuka sp. nov., in lacking BSC (Fig. 7A), in contrast to other species (cf. Xu et al. 2022: figs 3B, 5E, 6B, 7E, 10B, 12B, 14D), and in the contrategulum having relatively dense, smaller serrated teeth (Fig. 7B, F), rather sparse but larger teeth in other species (cf. Xu et al. 2022: figs 3A, 5D, 6B, 7D, 10H, 12D, 14H). Males differ from those of L.asuka sp. nov. in having two relatively large teeth on the middle portion of conductor and a shorter TA (Fig. 7B–D, F), rather than with two tiny, nearly invisible teeth and a longer TA (Fig. 4A, B, E). Females differ from congeners, except L.asuka sp. nov., in having the paired receptacular clusters with relatively short genital stalks and in their relatively smaller size (Fig. 7G, H), rather than long genital stalks and large size (cf. Xu et al. 2022: figs 4, 5H, I, 6H–M, 8, 9, 11, 13, 14H–M). Females can be distinguished from L.asuka sp. nov. in having the receptacular clusters close and nearly equal in size (Fig. 7G, H), rather than separated and with the lateral pair larger than the middle pair (Fig. 4G, H).
Luthelakagami sp. nov. A male left palp, prolateral view B male left palp, ventral view C male left palp, retrolateral view D right palpal bulb, ventral view E right palpal bulb, dorsal view F right palpal bulb, apical view G vulva, ventral view H vulva, dorsal view. Green arrows in B and F indicate small teeth on conductor. Scale bars: 0.50 mm.
https://binary.pensoft.net/fig/844938Description.
Male (holotype) (Fig. 3E). Carapace red; cervical and radial grooves distinct. Cephalic region moderately raised. Chelicerae robust; fang furrow with 12 promarginal teeth of variable size. Sternum longer than wide. Abdomen pale yellow, with 5 large dorsal and 2 small posterior tergites, 4 tapering setae near posteromargin of 5 large tergites and 2 on the rest. Seven spinnerets. Measurements: body 11.27 long. Carapace 5.50 long, 4.97 wide. Abdomen 5.77 long, 4.28 wide. Sternum 2.41 long, 1.89 wide. ALE > PLE > PME > AME. Leg I 17.84 (4.87 + 5.53 + 4.62 + 2.82), leg II 17.89 (4.50 + 5.37 + 4.97 + 3.05), leg III 19.19 (4.19 + 5.38 + 5.83 + 3.79), leg IV 26.62 (6.18 + 7.67 + 8.05 + 4.72).
Palp (Fig. 7A–F): prolateral paracymbium pale, weakly sclerotized, with numerous setae and spines at distal and retrolateral sides. Contrategular margin denticulate, with large teeth on proximal part, and smaller but denser teeth distally. Marginal apophysis of tegulum serrated, with relatively short terminal apophysis of tegulum; margin of dorsal extension of terminal apophysis with teeth varied in size and distance. Conductor smooth, fused to embolic base, with large apical spine and 2 small lateral spines on middle portion. Embolus with translucent, flat opening and several ribbed ridges distally.
Female (one of paratypes) (Fig. 3F). Carapace red, with dark pattern, cervical and radial grooves distinct, with sparse spines. Cephalic region slightly elevated. Chelicerae more robust than male, fang furrow with 12 promarginal teeth of variable size, larger than male. Sternum longer than wide. Abdomen pale, with 5 large and five 5 tergites; chaetotaxy on tergites as in male. Seven spinnerets. Measurements: body 15.74 long. Carapace 7.00 long, 6.93 wide. Abdomen 8.89 long, 8.21 wide. Sternum 3.24 long, 1.79 wide. ALE > PLE > PME > AME. Leg I 14.70 (4.77 + 5.47 + 2.55 + 1.91), leg II 14.85 (4.57 + 4.63 + 3.30 + 2.35), leg III 14.61 (4.61 + 4.59 + 2.92 + 2.49), leg IV 22.15 (6.54 + 6.63 + 5.82 + 3.16).
Female genitalia (Fig. 7G–H). Two pairs of receptacular clusters on short, thick stalks, close to each other, nearly equal in size. Middle pair of receptacular clusters separated from each other, on anteromargin of bursa copulatrix; lateral receptacular clusters set slightly dorsolaterally.
We thank Dr Robert Raven and an anonymous referee for constructive comments on this manuscript. Special thanks to the subject editor, Prof. Peter Michalik, for his kind help. Yiting He, Yunxiao Shen, and Zixu Yin helped collect samples during the field work. Haocong Yang donated specimens collected in Beijing. Yejie Lin and Chao Wu donated high-quality photographs. This study was supported by the National Natural Science Foundation of China (NSFC-31972870, 31750002).
ReferencesBreitlingR (2022) On the taxonomic rank of the major subdivisions of the extant segmented spiders (Arachnida: Araneae: Mesothelae: Liphistiidaes. lat.).2022: 1–4.FolmerOBlackMHoehWLutzRVrijenhoekR (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates.3: 294–299.GuindonSDufayardJLefortVAnisimovaMHordijkWGascuelO (2010) New algorithms and methods to estimate maximum-likelihood phylogenies: Assessing the performance of PhyML 3.0.59(3): 307–321. https://doi.org/10.1093/sysbio/syq010HauptJ (1983) Vergleichende Morphologie der Genitalorgane und Phylogenie der liphistiomorphen Webspinnen (Araneae: Mesothelae). I. Revision der bisher bekannten Arten.21(4): 275–293. https://doi.org/10.1111/j.1439-0469.1983.tb00296.xKatohKStandleyD (2013) MAFFT multiple sequence alignment software version 7: Improvements in performance and usability.30(4): 772–780. https://doi.org/10.1093/molbev/mst010KhmelikVVKozubDGlazunovA (2006) Helicon Focus 3.10.3. http://www.heliconsoft.com/heliconfocus.html [Accessed on 6 August 2022]KishidaK (1923) Heptathela, a new genus of liphistiid spiders.10: 235–242.LanfearRFrandsenBWrightASenfeldTCalcottB (2017) PartitionFinder 2: New methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses.34(3): 772–773. https://doi.org/10.1093/molbev/msw260LetunicIBorkP (2021) Interactive Tree of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Research 49(W1): 293–296. https://doi.org/10.1093/nar/gkab301LiS (2022) On the taxonomy of spiders of the suborder Mesothelae.31(1): 71–72. https://doi.org./10.3969/j.issn.1005-9628.2022.01.013MaddisonDMaddisonW (2011) Mesquite: a modular system for evolutionary analysis. https://www.mesquiteproject.org/MinhBNguyenMvon HaeselerA (2013) Ultrafast approximation for phylogenetic bootstrap.30(5): 1188–1195. https://doi.org/10.1093/molbev/mst024NguyenLSchmidtHvon HaeselerAMinhB (2015) IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies.32(1): 268–274. https://doi.org/10.1093/molbev/msu300PetrunkevitchA (1939) Catalogue of American spiders. Part one.33: 133–338.RavenR (1985) The spider infraorder Mygalomorphae (Araneae): Cladistics and systematics.182: 1–180.RonquistFTeslenkoMvan der MarkPAyresDDarlingAHöhnaSLargetBLiuLSuchardMHuelsenbeckJ (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space.61(3): 539–542. https://doi.org/10.1093/sysbio/sys029WSC (2023) World Spider Catalog. Version 24. Natural History Museum Bern. [Online at] http://wsc.nmbe.ch [Accessed on 18 April 2023]XuXLiuFChenJLiDKuntnerM (2015a) Integrative taxonomy of the primitively segmented spider genus Ganthela (Araneae: Mesothelae: Liphistiidae): DNA barcoding gap agrees with morphology.175(2): 288–306. https://doi.org/10.1111/zoj.12280XuXLiuFChenJOnoHLiDKuntnerM (2015b) A genus-level taxonomic review of primitively segmented spiders (Mesothelae, Liphistiidae).488: 121–151. https://doi.org/10.3897/zookeys.488.8726XuXKuntnerMBondJOnoHHoSLiuFYuLLiD (2020) Molecular species delimitation in the primitively segmented spider genus Heptathela endemic to Japanese islands. Molecular Phylogenetics and Evolution 151: 106900. https://doi.org/10.1016/j.ympev.2020.106900XuXSuYHoSKuntnerMOnoHLiuFChangCWarritNSivayyapramVAungKPhamDNorma-RashidYLiD (2021) Phylogenomic analysis of ultraconserved elements resolves the evolutionary and biogeographic history of segmented trapdoor spiders.70(6): 1110–1122. https://doi.org/10.1093/sysbio/syaa098XuXYuLLiuFLiD (2022) Delimitation of the segmented trapdoor spider genus Luthela gen. nov., with comments on the genus Sinothela from northern China (Araneae, Mesothelae, Liphistiidae).5091(1): 131–154. https://doi.org/10.11646/zootaxa.5091.1.5ZhangDGaoFJakovlićIZouHZhangJLiWWangG (2020) PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies.20(1): 348–355. https://doi.org/10.1111/1755-0998.13096