Corresponding authors: Yucheng Lin (linyucheng@scu.edu.cn), Shuqiang Li (lisq@ioz.ac.cn)
Academic editor: Dimitar Dimitrov
A new mysmenid genus,
Lin Y, Li S (2022)
The spider family
In Asia, nearly 50 species of nine genera have been recorded.
The aim of this paper is to expand the knowledge about the species diversity of Chinese mysmenid spiders by describing a new genus and two new species and proposing one new combination.
The mysmenid specimens in this study were collected in Taiwan and Hainan, China, between June 2011 and July 2013. All the specimens were collected by sifting leaf litter or by hand and stored in 95% ethanol at –20 °C.
We selected seven specimens from two new species and used the prosoma and all of the legs to extract genomic DNA to amplify COI, H3, 16S, 18S, and 28S. DNA was extracted with the TIANamp Micro DNA Kit (
The loci, primer pairs, and PCR protocols used in this study.
Locus | Annealing temperature/time | Direction | Primer | Sequence 5’→3’ | Reference |
---|---|---|---|---|---|
16S | 46.45°/30s | F | 16sb2_12864 | CTCCGGTTTGAACTCAGATCA | Hormiga et al. 2003 |
R | LR-J-13360 | GTAAGGCCTGCTCAATGA |
|
||
47°/30s | F | 16S-A | CGCCTGTTTATCAAAAACAT | Palumbi et al. 1991 | |
R | 16S-B | CTCCGGTTTGAACTCAGATCA | |||
18S | 52.1°/30s | F | 18s_1F | TACCTGGTTGATCCTGCCAGTAG | Giribet et al. 1996 |
R | 18s_1000R | GTGGTGCCCTTCCGTCAATT | Balczun et al. 2005 | ||
28SD2 | 54.9°/30s | F | 28sa | GACCCGTCTTGAAACACGGA | Rix et al. 2008 |
R | LSUR | GCTACTACCACCAAGATCTGCA | |||
COI | 48.95°/30s | F | LCO1490 | GGTCAACAAATCATAAAGATATTGG | Folmer et al. 1994 |
R | HCO2198 | TAAACTTCAGGGTGACCAAAAAATCA | |||
46°/30s | F | LCO1490 | GGTCAACAAATCATAAAGATATTGG | Simon et al. 1994 | |
R | COI-Nancy | CCCGGTAAAATTAAAATATAAACTTC | |||
H3 | 48°/30s | F | H3af | ATGGCTCGTACCAAGCAGACVGC | Colgan et al. 1998 |
R | H3ar | ATATCCTTRGGCATRATRGTGAC | |||
50°/30s | F | H3nf | ATGGCTCGTACCAAGCAGAC | ||
R | H3nr | ATRTCCTTGGGCATGATTGTTAC |
GenBank accession numbers for newly generated DNA sequences.
Species | Identifier | 16S | 18S | 28S | COI | H3 |
---|---|---|---|---|---|---|
|
TW02 |
|
|
|
|
|
HN01 |
|
|
|
|
|
|
HN02 |
|
|
|
|
|
|
HN05 |
|
|
|
|
|
|
HN08 |
|
|
|
– |
|
|
HN09 |
|
|
|
|
|
|
HN10 | – |
|
|
– |
|
|
|
GlgMY01 |
|
|
|
|
|
GlgMY02 |
|
|
|
|
|
|
GlgMY03 |
|
|
|
|
|
|
GlgMY04 |
|
|
|
|
|
|
GlgMY05 |
|
|
|
|
|
|
GlgMY80 |
|
|
|
|
|
|
GlgMY98 |
|
|
|
|
|
|
|
XZ01 |
|
|
|
|
|
XZ02 |
|
|
|
|
|
|
XZ03 |
|
|
|
|
|
|
XZ04 |
|
|
|
|
|
|
MS_261_MYA |
|
|
|
|
|
|
MS_263_MYA | – |
|
|
|
|
|
MS_250_INN |
|
|
|
|
|
|
MS_251_INN |
|
|
|
|
|
|
INNE02 |
|
|
|
|
|
|
INNE03 |
|
|
|
|
|
We analysed data from 50 species of symphytognathoids including members of the families
We analysed the data using both maximum parsimony (
Specimens were examined and measured under a Leica M205 C stereomicroscope. Further details were examined using an Olympus BX51 compound microscope. Male palps and epigynes were examined and photographed after dissection. They were treated in lactic acid for several minutes, and subsequently embedded in Hoyer’s Solution before photographing. Photos were made with a Canon EOS 60D wide zoom digital camera (8.5 megapixels) mounted on the Olympus BX51 compound microscope. Images were combined using Helicon Focus v.3.10 software (
List of abbreviations used in the text or figures.
Morphological terminologies | |||
---|---|---|---|
|
anterior eye row |
|
fertilization ducts |
|
anterior lateral eyes |
|
male metatarsal nodule at distal-prolaterally |
|
anterior median eyes |
|
male metatarsal clasping spine |
|
basal haematodocha |
|
paracymbium |
|
copulatory ducts |
|
posterior eye row |
|
cheliceral spines rooted at base |
|
posterior lateral eyes |
|
cymbial conductor |
|
posterior median eyes |
|
cymbial fold |
|
spermathecae |
|
setae on cymbial fold |
|
spermatic duct |
|
process on cymbial conductor |
|
scape |
|
process on paracymbium |
|
subtegulum |
|
embolus |
|
palpal tibia |
|
|||
|
Forestry Research Institute of Taipei, Taipei, China | ||
|
|||
|
|||
|
The topologies from both the
Tree topology obtained by maximum likelihood. Numbers at nodes are bootstrap values. Тhe clade of
Bayesian inference tree. Numbers at nodes posterior probabilities. The monophyly of
The generic name is a combination of the first three letters of China and the latter half of
Carapace pear-shaped, cephalic part distinctly raised in male; clypeus slightly concave. Ocular area black,
China (Hainan, Taiwan).
The species epithet, a noun in apposition, refers to ‘qiong’, which is short for Hainan Province.
Males and females are similar to
China (Hainan) (Fig.
6♂13♀ (
China (Taiwan) (Fig.
Although the type specimens of
The new species is named after the type locality; noun in apposition.
China (Taiwan) (Fig.
Distribution records of three
We tested the phylogenetic and taxonomic position of
We thank Yuri M. Marusik (Magadan, Russia) and an anonymous referee for insightful comments, and are especially grateful to Dimitar Dimitrov (Bergen, Norway), the subject editor of this manuscript, for his kind help. Danni Sherwood (UK) and Sarah Crews (San Francisco, USA) kindly checked the English of the final draft. This study was supported by the National Natural Foundation of China (NSFC-31972870, 31772410, 31750002).