Corresponding author: Shinnosuke Teruya (
Academic editor: E. Gittenberger
The patellogastropod limpet genus
Teruya S, Setiamarga DHE, Nakano T, Sasaki T (2022) Molecular phylogeny of
Limpets belonging to the clade
Molecular phylogenetic analysis and comparison of morphological characters have previously been performed for limpets with ambiguous taxonomies (
Species delineations have been completed by comparing shell morphology (
The genus
Molecular phylogenetic analyses of
The purposes of this study were to: (1) assess the taxonomy of
We collected
List of localities. See also Fig.
No. | Locality | Coordinates (Latitude, Longitude) |
---|---|---|
1 | Omachi, Rumoi, Hokkaido |
|
2 | Shukutsu, Otaru, Hokkaido |
|
3 | Masadomari, Suttu, Hokkaido |
|
4 | Genna, Otobe, Hokkaido |
|
5 | Usujiri, Hokkaido |
|
6 | Hebiura, Kazamaura, Aomori Prefecture |
|
7 | Arito, Noheji, Aomori Prefecture |
|
8 | Tsuchiya, Hiranai, Aomori Prefecture |
|
9 | Togashiohama, Oga, Akita Prefecture |
|
10 | Kisakata, Nikaho, Akita Prefecture |
|
11 | Masakicho, Ofunato, Iwate Prefecture |
|
12 | Karakuwa, Ishinomaki, Miyagi Prefecture |
|
13 | Okinoshima, Tateyama, Chiba Prefecture |
|
14 | Mitsuishi, Manazuru, Kanagawa Prefecture |
|
15 | Irouzaki, Minamiizu, Shizuoka Prefecture |
|
16 | Futo, Nishiizu, Shizuoka Prefecture |
|
17 | Iwashigashima, Yaizu, Shizuoka Prefecture |
|
18 | Yutocho, Hamamatsu, Shizuoka Prefecture |
|
19 | Iragocho, Tahara, Aichi Prefecture |
|
20 | Shionomisaki, Kushimoto, Wakayama Prefecutre |
|
21 | Mio, Mihamacho, Wakayama Prefecture |
|
22 | Kada, Wakayama Prefecture |
|
23 | Oki, Tosashimizu, Kochi Prefecture |
|
24 | Ajiro, Ainancho, Ehime Prefecture |
|
25 | Ohira, Oita, Oita Prefecture |
|
26 | Suwacho, Uozu, Toyama Prefecture |
|
27 | Yoroi, Kazumi, Hyogo Prefecture |
|
28 | Tsudacho, Sanuki, Kagawa Prefecture |
|
29 | Shibukawa, Tamano, Okayama Prefecture |
|
30 | Hirano, Suo-Oshima, Yamaguchi Prefecture |
|
31 | Higashifukawa, Nagato, Yamaguchi Prefecture |
|
32 | Nishinoura, Nishi-ku, Fukuoka Prefecture |
|
33 | Hiranitago, Higashisonogi, Nagasaki Prefecture |
|
34 | Kujima, Omura, Nagasaki Prefecture |
|
35 | Nagatamachi, Nagasaki Prefecture |
|
36 | Odatoko Bay, Amakusa, Kumamoto Prefecture |
|
37 | Wakimoto, Akune, Kagoshima Prefecture |
|
38 | Sagata, Akune, Kagoshima Prefecture |
|
39 | Okawa, Akune, Kagoshima Prefecture |
|
40 | Bonotsu, Minamisatsuma, Kagoshima Prefecture |
|
41 | Kaimon, Ibusuki, Kagoshima Prefecture |
|
42 | Kishira, Kimotsuki, Kagoshima Prefecture |
|
43 | Chichijima, Ogasawara Islands |
|
44 | Koajiro, Misaki, Miura, Kanagawa Prefecture |
|
Collection localities of the specimens used in this study. The numbers are shown in Table
Animals were preserved in 99% ethanol. Preliminary identification of specimens prior to DNA sequencing was based on shell characters (
List of specimens used in this study.
Species | Loc. no. (Fig. |
Accession no. | Figure(s) | ||||
---|---|---|---|---|---|---|---|
|
|
12S | 16S | ||||
|
RM31815 | 43* |
|
|
|
|
Figs |
RM31816 | 43* |
|
|
|
|
Figs |
|
RM31817 | 43* |
|
|
|
|
Figs |
|
|
RM31818 | 10 |
|
|
|
|
|
RM31819 | 10 |
|
|
|
|
||
RM31820 | 11 |
|
|
|
|
Fig. |
|
RM31821 | 11 |
|
|
|
|
||
RM31822 | 17 |
|
|
|
|
||
RM31823 | 19 |
|
|
|
|
Fig. |
|
RM31824 | 21 |
|
|
|
|
Fig. |
|
RM31825 | 21 |
|
|
|
|
||
RM31826 | 29 |
|
|
|
|
||
RM31827 | 30 |
|
|
|
|
||
RM31828 | 30 |
|
|
|
|
Fig. |
|
RM31829 | 32 |
|
|
|
|
||
RM31830 | 34 |
|
|
|
|
Fig. |
|
RM31831 | 34 |
|
|
|
|
Fig. |
|
RM32353 | 35* |
|
|
|
|
Figs |
|
|
RM31832 | 1 |
|
|
|
|
|
RM31833 | 1 |
|
|
|
|
||
RM31834 | 1 |
|
|
|
|
Fig. |
|
RM31835 | 1 |
|
|
|
|
||
RM31836 | 1 |
|
|
|
|
||
RM31837 | 4 |
|
|
|
|
||
RM31838 | 4 |
|
|
|
|
||
RM31839 | 4 |
|
|
|
|
||
RM31840 | 8 |
|
|
|
|
||
RM31841 | 10 |
|
|
|
|
||
RM31842 | 10 |
|
|
|
|
||
RM31843 | 10 |
|
|
|
|
||
RM31844 | 10 |
|
|
|
|
||
RM31845 | 10 |
|
|
|
|
||
RM31846 | 10 |
|
|
|
|
Fig. |
|
RM31847 | 13 |
|
|
|
|
Fig. |
|
RM31848 | 32 |
|
|
|
|
||
RM31849 | 32 |
|
|
|
|
||
RM31850 | 32 |
|
|
|
|
||
RM31851 | 32 |
|
|
|
|
||
RM31852 | 32 |
|
|
|
|
||
RM31853 | 36 |
|
|
|
|
||
RM31854 | 36 |
|
|
|
|
||
RM31855 | 36 |
|
|
|
|
||
RM31856 | 36 |
|
|
|
|
||
RM31857 | 39* |
|
|
|
|
||
RM32354 | 39* |
|
|
|
|
Figs |
|
RM31858 | 42 |
|
|
|
|
Figs |
|
RM31859 | 42 |
|
|
|
|
Fig. |
|
|
RM31860 | 13 |
|
|
|
|
Figs |
RM31861 | 14 |
|
|
|
|
Fig. |
|
RM31862 | 14 |
|
|
|
|
Fig. |
|
RM31863 | 14 |
|
|
|
|
||
RM31864 | 16 |
|
|
|
|
||
RM31865 | 27 |
|
|
|
|
||
RM31866 | 27 |
|
|
|
|
||
|
RM31867 | 27 |
|
|
|
|
|
RM31868 | 40 |
|
|
|
|
||
RM31869 | 41 |
|
|
|
|
Fig. |
|
RM32355 | 41 |
|
|
|
|
Figs |
|
|
RM31870 | 2 |
|
|
|
|
Fig. |
RM31871 | 3 |
|
|
|
|
||
RM31872 | 3 |
|
|
|
|
Fig. |
|
RM31873 | 5** |
|
|
|
|
Figs |
|
RM32357 | 5** |
|
|
|
|
Fig. |
|
RM31874 | 12 |
|
|
|
|
Fig. |
|
RM31875 | 13 |
|
|
|
|
Fig. |
|
RM32356 | 13 |
|
|
|
|
Figs |
|
RM32364 | 13 |
|
|
|
|
Fig. |
|
|
RM31876 | 1 |
|
|
|
|
|
RM31877 | 3 |
|
|
|
|
||
RM31878 | 3 |
|
|
|
|
||
RM31879 | 3 |
|
|
|
|
||
RM31880 | 3 |
|
|
|
|
||
RM31881 | 4 |
|
|
|
|
||
RM31882 | 4 |
|
|
|
|
||
RM31883 | 7 |
|
|
|
|
||
RM31884 | 11 |
|
|
|
|
||
RM31885 | 12 |
|
|
|
|
||
RM31886 | 15 |
|
|
|
|
Fig. |
|
RM31887 | 15 |
|
|
|
|
Fig. |
|
RM32358 | 20* |
|
|
|
|
Fig. |
|
RM32359 | 20* |
|
|
|
|
Fig. |
|
RM32360 | 20* |
|
|
|
|
Fig. |
|
RM32361 | 20* |
|
|
|
|
Fig. |
|
RM32362 | 20* |
|
|
|
|
Fig. |
|
RM31888 | 22 |
|
|
|
|
||
RM31889 | 22 |
|
|
|
|
||
RM31890 | 22 |
|
|
|
|
||
RM31891 | 26 |
|
|
|
|
||
RM31892 | 32 |
|
|
|
|
Fig. |
|
RM31893 | 33 |
|
|
|
|
||
RM31894 | 33 |
|
|
|
|
||
RM31895 | 33 |
|
|
|
|
Fig. |
|
RM31896 | 33 |
|
|
|
|
||
RM31897 | 33 |
|
|
|
|
Fig. |
|
|
RM31898 | 18 |
|
|
|
|
Fig. |
RM31899 | 31 |
|
|
|
|
Fig. |
|
RM31900 | 31 |
|
|
|
|
Fig. |
|
RM31901 | 34 |
|
|
|
|
||
RM31902 | 34 |
|
|
|
|
Fig. |
|
RM31903 | 34 |
|
|
|
|
||
RM31904 | 34 |
|
|
|
|
Figs |
|
RM32363 | 37* |
|
|
|
|
Figs |
|
|
|
6 |
|
|
|
|
|
RM31906 | 6 |
|
|
|
|
Figs |
|
RM31907 | 6 |
|
|
|
|
||
RM31908 | 6 |
|
|
|
|
Figs |
|
RM31909 | 9 |
|
|
|
|
||
RM31910 | 9 |
|
|
|
|
||
RM31911 | 9 |
|
|
|
|
||
RM31912 | 14 |
|
|
|
|
||
|
RM31913 | 14 |
|
|
|
|
|
RM31914 | 23 |
|
|
|
|
||
RM31915 | 30 |
|
|
|
|
Fig. |
|
RM31916 | 35* |
|
|
|
|
Figs |
|
|
RM31917 | 13 |
|
|
|
|
Fig. |
RM31918 | 13 |
|
|
|
|
||
RM31919 | 21 |
|
|
|
|
||
RM31920 | 21 |
|
|
|
|
||
RM31921 | 24 |
|
|
|
|
||
RM31922 | 24 |
|
|
|
|
Fig. |
|
RM31923 | 25 |
|
|
|
|
||
RM31924 | 25 |
|
|
|
|
Fig. |
|
RM31925 | 28 |
|
|
|
|
Fig. |
|
RM31926 | 28 |
|
|
|
|
Fig. |
|
RM31927 | 30 |
|
|
|
|
||
RM31928 | 30 |
|
|
|
|
Fig. |
|
RM31929 | 32 |
|
|
|
|
||
RM31930 | 32 |
|
|
|
|
Fig. |
|
RM31931 | 38* |
|
|
|
|
||
RM31932 | 38* |
|
|
|
|
||
|
RM31933 | 44 |
|
|
|
|
|
|
RM31934 | 44 |
|
|
|
|
|
|
RM31935 | 44 |
|
|
|
|
Total genomic DNA was extracted from the mantle using the cetyltrimethylammonium bromide (
List of PCR primers.
Gene | Primer name | Sequence (5’→3’) | Source |
---|---|---|---|
|
LCO1490 (F) | GGTCAACAAATCATAAAGATATTGG |
|
HCO2198 (R) | TAAACTTCAGGGTGACCAAAAAATCA |
|
|
|
cobF (F) | GGWTAYGTWYTWCCWTGRGGWCARAT |
|
cobR (R) | GCRTAWGCRAAWARRAARTAYCAYTCWGG |
|
|
12S | 12Sma (F) | CTGGGATTAGATACCCTGTTAT |
|
12Smb (R) | CAGAGAGTGACGGGCGATTTGT |
|
|
16S | 16LRN13398 (F) | CGCCTGTTTAACAAAAACAT |
|
16SRHTB (R) | ACGCCGGTTTGAACTCAGATC |
|
All sequences were aligned using MEGA 6.06 (
Phylogenetic analyses were conducted using a maximum-likelihood (
Bayesian analysis was performed for 4,000,000 generations (for the four genes concatenated), 4,500,000 generations (
The genetic distances among and within species were calculated using the Kimura-2-Parameter (
Sequenced specimens were dissected under a binocular microscope. After observations of the animal including the snout pigmentation, cephalic tentacles, and foot lateral wall, the visceral mass was dissected to reveal the configuration of the radular sac. Removed radulae were cleaned in diluted commercial bleach, coated with platinum vanadium, and observed with a scanning electron microscope (Keyence VE-8800). The color of the ovary was recorded before ethanol fixation for specimens collected in breeding season, since gonad color fades when stored in ethanol.
Three shell characters were measured for a total of 130 sequenced specimens: shell length (L), shell width (W), and shell height (H). All individuals were measured with a digital caliper (to 0.01 mm). Allometric analyses were performed among species and genetic groups to determine relationships among length, width, and height using Welch’s t-test. Canonical discriminant analysis was performed among species using the three shell characters (L, W, and H). Discriminant functions also calculated the percentage of individuals that were classified correctly. Canonical discriminant analysis was conducted using R software package version 3.1.0 (
A total of 130
Genetic distances among
1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | |
---|---|---|---|---|---|---|---|---|---|---|
|
||||||||||
1 |
|
|||||||||
2 |
21.5–23.7 |
|
||||||||
3 |
22.1–25.1 | 21.7–22.9 |
|
|||||||
4 |
24.9–28.1 | 22.1–23.1 | 22.1–23.1 |
|
||||||
5 |
23.5–24.7 | 23.7–24.1 | 24.1–25.1 | 19.6–20.8 |
|
|||||
6 |
23.1–25.1 | 22.5–23.1 | 23.3–24.5 | 18.6–19.6 | 17.8–18.4 |
|
||||
7 |
22.9–24.9 | 24.3–25.3 | 23.7–24.3 | 19.4–20.9 | 19.6–20.2 | 20.8–21.9 |
|
|||
8 |
25.1–27.3 | 23.1–26.9 | 25.7–26.9 | 23.3–24.9 | 18.8–21.7 | 21.5–23.1 | 21.7–23.7 |
|
||
9 |
26.7–29.2 | 27.5–28.1 | 26.3–27.5 | 26.5–27.5 | 26.9–27.9 | 26.5–27.7 | 24.9–26.3 | 29.4–32 |
|
|
10 |
25.0–27.0 | 24.5–24.7 | 24.7–25.1 | 25.9–26.9 | 26.9–27.1 | 25.7–26.3 | 25.3–25.9 | 25.3–27.5 | 28.1–28.5 |
|
|
||||||||||
1 |
|
|||||||||
2 |
20.5–22.0 |
|
||||||||
3 |
24.8–27.0 | 23.8–24.5 |
|
|||||||
4 |
23.0–24.8 | 24.0–24.8 | 23.3–24.3 |
|
||||||
5 |
21.3–22.8 | 20.5–20.8 | 21.8–22.5 | 17.1–17.3 |
|
|||||
6 |
24.8–27.0 | 22.0–22.8 | 23.0–24.8 | 19.8–21.0 | 21.0–21.8 |
|
||||
7 |
26.0–27.5 | 26.2–27.0 | 23.0–23.8 | 18.8–19.8 | 19.1–19.8 | 21.5–22.3 |
|
|||
8 |
24.5–30.0 | 22.0–24.0 | 21.8–22.5 | 21.0–21.5 | 21.0–22.3 | 18.6–20.0 | 21.8–22.3 |
|
||
9 |
21.8–23.8 | 20.3–21.3 | 23.8–25.2 | 23.3–24.8 | 24.0–24.5 | 23.3–24.3 | 24.5–26.5 | 23.5–25.0 |
|
|
10 |
26.2–27.0 | 32.4–32.4 | 28.2–28.7 | 28.0–28.2 | 28.7–28.7 | 31.2–31.4 | 29.7–30.2 | 30.0–30.4 | 30.2–31.2 |
|
12S rRNA | ||||||||||
1 |
|
|||||||||
2 |
10.5–11.1 |
|
||||||||
3 |
12.7–13.6 | 13.0 |
|
|||||||
4 |
15.4–16.0 | 14.8–15.1 | 14.2–14.5 |
|
||||||
5 |
16.0–16.7 | 14.8 | 14.8 | 5.6–5.9 |
|
|||||
6 |
16.0–16.7 | 14.8 | 16.4 | 7.7–8.0 | 9.0 |
|
||||
7 |
14.8–15.4 | 12.7 | 14.5 | 8.6–9.0 | 7.7 | 9.6 |
|
|||
8 |
20.1–21.3 | 16.7–17.6 | 14.5 | 9.6–11.1 | 12.0–12.7 | 12.0–13.0 | 14.2–14.5 |
|
||
9 |
21.6–23.1 | 21.3–22.5 | 22.2–23.5 | 24.4–25.0 | 23.5–24.1 | 21.9–22.2 | 22.2–22.5 | 25.0–25.9 |
|
|
10 |
23.8–24.1 | 23.1 | 25.3 | 25.3–25.6 | 24.7 | 25.3 | 25.3 | 28.1–28.4 | 24.4–25 |
|
16S rRNA | ||||||||||
1 |
|
|||||||||
2 |
9.3–9.5 |
|
||||||||
3 |
8.7–9.4 | 8.9–9.1 |
|
|||||||
4 |
12.6–13.4 | 14.9–15.2 | 11.1–11.6 |
|
||||||
5 |
11–11.7 | 14.3–14.3 | 11.3–11.5 | 9.3–9.5 |
|
|||||
6 |
12.8–13.5 | 13.8–14.3 | 12.5–13.2 | 10.7–11.4 | 8.2–8.4 |
|
||||
7 |
11.2–12.1 | 11.7–12 | 10.4–10.9 | 9.0–9.5 | 7.9–8.2 | 8.0–8.4 |
|
|||
8 |
11.5–12.6 | 12.7–13.4 | 11.3–12.3 | 9.3–9.7 | 8.7–10.7 | 8.9–10.7 | 8.2–9.3 |
|
||
9 |
26.1–26.4 | 22.4–22.7 | 24.3–24.9 | 28.1–28.5 | 24.9–25.2 | 22.3–23.2 | 26.4–27.0 | 25.8–26.1 |
|
|
10 |
25.2–25.5 | 22.8–22.8 | 26.2–26.5 | 29.9–30.0 | 27.9–27.9 | 28.8–29.5 | 27.8–28.1 | 28.5–29.9 | 28.8–28.8 |
|
The resultant phylogenetic tree using the four genes is shown in Fig.
Maximum likelihood phylogenetic tree generated from 1809 bp constructed from the concatenated
Separate analyses of the four genes resulted in slightly different phylogenetic relationships that are described below. The divergence within
Shell morphology and color pattern of
Although the monophyly of Clade A was well supported, branching order within the clade was not (
Shell morphology and color pattern of
In this study, we tested the identification of
Diagnostic characters of
Species | Shell sculpture | Animal pigmentation | Radula sac | Radular teeth | Ovary | |||
---|---|---|---|---|---|---|---|---|
Granules | Riblets | Snout | Cephalic tentacles | Foot | ||||
|
Elongate and thin | Fine and sparse | Non-pigmented | Non-pigmented | Non-pigmented | Short | Blunt | Red |
|
Elongate and thin | Fine and sparse | Non-pigmented | Black | Non-pigmented | Long, posterior and right loops | Acute | Green |
|
Absent | Fine and dense | Non-pigmented | Black | Gray | Intermediate | Slightly blunt | Red |
|
Elongate and thin | Fine and sparse | Black | Black | Black | Intermediate | Acute | Green |
|
Rounded | Absent | Black | Black | Black | Long, posterior and right loops | Acute | Brown |
|
Pointed | Fine and sparse | Gray | Black | Gray | Long, posterior and right loops | Acute | Brown |
|
Elongate and thcik | Thick and dense | Gray | Black | Gray | Short | Acute | Brown |
|
Elongate and thin | Fine and dense | Black | Black | Black | Variable from long to short loops | Acute to blunt | Brown |
|
Elongate and thin | Absent | Black | Black | Black | Short | Acute | Brown |
(1) Granules: Granules on the shell exterior exhibited five character states: (a) rounded (
(2) Riblets: Exterior riblets were either fine, rough, or absent, depending on species. In Clade A, the riblets were fine and sparse in
(3) Animal pigmentation: Pigmentation in the snout, cephalic tentacles, and side of the foot was divergent among species, including black, grey, or non-pigmented types (Fig.
Pigmentation of side of foot
(4) Radular sac: The configuration of the radular sac was different among the species (Fig.
Configuration of radula sac of nine species of
(5) Radular teeth: The lateral teeth were short and blunt in
Scanning micrographs of radular teeth of of
(6) Ovary: The color of the ovary can be classified into three categories: green in
The relationships among length, width, and height are indicated in Fig.
Canonical discriminant analysis for individuals of
Observed classification | Predicted classification | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | % correct | |
1 |
8 | 0 | 0 | 3 | 0 | 0 | 0 | 0 | 0 | 72.7 |
2 |
0 | 23 | 0 | 0 | 1 | 1 | 2 | 0 | 2 | 79.3 |
3 |
0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0.0 |
4 |
3 | 0 | 0 | 8 | 0 | 0 | 0 | 0 | 1 | 66.7 |
5 |
0 | 7 | 0 | 0 | 7 | 0 | 0 | 1 | 0 | 46.7 |
6 |
0 | 4 | 0 | 0 | 2 | 1 | 0 | 1 | 0 | 12.5 |
7 |
0 | 3 | 0 | 0 | 0 | 0 | 23 | 1 | 0 | 85.2 |
8 |
0 | 1 | 0 | 0 | 0 | 0 | 6 | 2 | 0 | 66.7 |
9 |
0 | 9 | 0 | 1 | 0 | 0 | 0 | 0 | 6 | 37.5 |
Relationships among shell length, width, and height.
Plot of the results of discriminant function analysis of shell length, width, and height for individuals of
The monophyly of Japanese
Holotype specimens, type localities, and geographic distribution of
Species | Holotype | Type locality | Geographic distribution |
---|---|---|---|
National Museum of Nature and Science,Tsukuba, NSMT-Mo 100675 | Urado, Kochi Prefecture | Pacific coast from Choshi to Kyushu, the Sea of Japan from Oga Peninsula to Kyushu, and rare in Seto Inland Sea; China. | |
Teramachi Collection in Toba Aquarium, missing | Akune, Kagoshima Prefecture | Pacific coast and the Sea of Japan from southern Hokkaido to Kyushu, and Ryukyu Islands; Korea, China. | |
National Museum of Nature and Science,Tsukuba, NSMT-Mo 64445 | Yagyu-san, Chichijima Island, Ogasawara Islands | Hachijo Island, Ogasawara Islands, and Northern Mariana Islands (Asuncion and Maug Islands) | |
Unknown | Nagasaki City | Tsugaru Strait to Kyushu, and Seto Inland Sea; Korea, China. | |
Unknown | Nagasaki City | Pacific coast and the Sea of Japan from Hokkaido to Kyushu, and Seto Inland Sea; Korea. | |
Osaka Museum of Natural History, Kira Collection 525 | Akune, Kagoshima Prefecture | Pacific coast from Shizuoka Prefecture to Kyushu, the Sea of Japan from Yamaguchi Prefecture to Kyushu, and Seto Island Sea; Korea, China. | |
Osaka Museum of Natural History, Kira Collection 540 | Shionomisaki, Kii Peninsula | Pacific coast and the Sea of Japan from Hokkaido to Kyushu, and Seto Inland Sea; Korea, China, Taiwan. | |
National Museum of Nature and Science,Tsukuba, NSMT-Mo 69985 | Shiragami-misaki, Matsumae, Hokkaido | Pacific coast from Hokkaido to Izu Peninsula, the Sea of Japan from Hokkaido to Niigata Prefecutre | |
Osaka Museum of Natural History, Kira Collection 554 | Akune, Kagoshima Prefecture | Pacific coast from Ojika Peninsula to Kyushu, western and northern Kyushu, and Seto Inland Sea; Korea, China. | |
Natural History Museum, London, No. 1977167 | Northern Taiwan | Taiwan | |
Zoological Museum of Far East State University, No. 18852 | Gulf of Tonkin | Vietnam | |
Zoological Museum of Far East State University, No H 2666 | Japan Sea, Sukhoputnaya Bay | Far East Russia |
In this study, the maximum genetic distance within species was noticeably smaller than the minimum among species; therefore, the genetic distances were consistent with morphology-based species taxonomy. The maximum genetic distance within Japanese
A comparison of holotype and sequenced specimens from type localities (topotypes) is useful to confirm species identity. We investigated holotypes of seven species (
The results of the molecular phylogenetic analysis in this study revealed three major clades (
Clade A was robustly supported with high bootstrap values by
The monophyly of Clade B was supported with relatively lower bootstrap values than that of Clade A (
Differences exist in the aims and taxa sampled between our studies and previous research focused on
The species taxonomy of
(1)
(2)
Two morphologically similar species are known from Taiwan and Vietnam.
(3)
(4)
(5)
(6)
(7)
(8)
The arrangement of the radular sac and the morphology of the lateral teeth are more variable in
(9)
Morphology-based studies of patellogastropods have explored various animal characteristics (
(1) Shell color pattern: the degree of variability in the shell color pattern is different among species, and the patterns are categorized into three types: (i) striking variations (
The shell of
(2) Shell sculpture: concerning shell sculpture, ribs and granules on the shell exterior are differentiated among species (Table
(3) Apex height:
In
The topology of the phylogenetic tree implies that the high-apex group could be derived from the low-apex species, since the most basal species,
(4) Animal pigmentation: we confirmed that the pigmentation of the snout, cephalic tentacle, and side of the foot is different among species (Fig.
(5) Radular sac: the configuration of the radular sac has been regarded as a useful character for identification of
(6) Radula: the radula morphology is useful for classifying patellogastropod species (
(7) Ovary: the ovaries of
In gastropods, the color of the ovary might be constrained according to taxonomic group (e.g., green in vetigastropods such as
In this study, we confirmed that current species identified of the Japanese
We would like to thank Hirofumi Kubo, Jun Nawa, Kazuyoshi Endo, Kei Sato, Keisuke Shimizu, Kozue Nishida, Masanori Okanishi, Masashi Yamaguchi, Naoki Hashimoto, Rei Ueshima, Rie Nakano, Shigeaki Kojima, Takanobu Tsuihiji, Takashi Okutani, Takuma Haga, Tomoyasu Yamazaki, Yoshihisa Kurita, You Usami, Yusuke Takeda for assistance in sampling and useful suggeston. Also we thank Nobuyuki Suzuki, Hiroaki Fukumori, Rie Sakai, Ryo Nakayama, Saki Kamiyama, Takashi Muranaka, Tatsuki Tsuhako, Toshiaki Shitamitu, Youhei Otaki, Youichi Maeda who helped us to collect samples. This work was supported by Grants-in-Aid for Scientific Research (KAKENHI) no. 14J09937 to S. Teruya and 26291077, 19K21646 and 20H01381 to T. Sasaki from the Japan Society for Promotion of Science.
Figure S1
Phylogenetic tree
Fig. S1. Maximum likelihood phylogenetic tree of
Figure S2
Phylogenetic tree
Fig. S2. Maximum likelihood phylogenetic tree of
Figure S3
Phylogenetic tree
Fig. S3. Maximum likelihood phylogenetic tree of 12S rRNA. Numbers above or below the branches are
Figure S4
Phylogenetic tree
Fig. S4. Maximum likelihood phylogenetic tree of 16S rRNA. Numbers above or below the branches are