Corresponding author: Chunsheng Wang (
Academic editor: Pavel Stoev
Holothurians of the family
Yu C, Zhang D, Zhang R, Wang C (2022) New psychropotid species (Echinodermata, Holothuroidea, Elasipodida) of the Western Pacific with phylogenetic analyses. ZooKeys 1088: 99–114.
Holothurians of the family
An expedition of the Jiaolong Human Operated Vehicle (
Red dots show the location of
The samples described in the present study were collected by the Jiaolong
Total genomic DNA was extracted from 100 mg of muscle tissue using a DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. Two partial mitochondrial genes, 16S rRNA and cytochrome oxidase subunit 1 (
PCR amplification procedures.
Primer | Sequence 5′→ 3' | PCR procedure |
---|---|---|
ATAATGATAGGAGGRTTTGG | Pre denaturation: 95 °C for 3 min | |
GCTCGTGTRTCTACRTCCAT | 40 cycles: | |
Denaturation: 95 °C for 40 s | ||
Annealing: 45 °C for 40 s | ||
Extension: 72 °C for 50 s | ||
16S-arL | CGCCGTTTATCAAAAACAT | Pre denaturation:95 °C for 3 min |
16S-brH | CCGGTCTGAACTCAGATCACG | 35 cycles: |
Denaturation: 95 °C for 40 s | ||
Annealing: 50 °C for 40 s | ||
Extension: 68 °C for 50 s |
For a more comprehensive phylogenetic analysis, we not only used the sequences of
Details of specimens and GenBank accession numbers in this study.
Family | Species | GenBank accession number | |
---|---|---|---|
|
|
||
|
|
||
|
|||
|
|
||
|
|
||
|
|
||
|
|||
|
|
||
|
|
||
|
|
||
|
|
||
|
|
||
|
|
||
|
|||
|
|
||
|
|||
|
|||
|
|
||
|
|
||
|
|||
|
|||
|
|
||
|
|
||
Pelagothuriide Ludwig, 1893 |
|
|
|
|
|
||
|
|
RSIO590504, adult specimen, collection number: DY59-ROV05-B04,
Body elongated and subcylindrical when fixed. Skin red with violet, thin, soft. No obvious large papillae arranged on dorsal surface. Some minute papillae, conical with tips, on the anterior dorsum. Brim narrow, thin, flattened. Mouth ventral, anus terminal. Eighteen tentacles; circum-oral papillae present. Dorsal ossicles include rods and primary crosses with four arms. Rods present in tentacles. Ossicles of ventrum not observed.
(RSIO6017101). Length was approximately 25 cm before preservation in 10% seawater formalin. Color violet in life (Fig.
RSIO3710601. Specimen approximately 22 cm in length, 5 cm wide at maximum point. Color red-violet
RSIO590504.Specimen approximately 22 cm in length before preservation in 10% seawater formalin. Color red-violet on deck, skin transparent; white color after preservation. During sampling, a piece of sponge was stuck in the ROV pump sampler, and the specimen was damaged by the sponge, meaning that the tentacles could not be determined and the dorsal tips could not be distinguished. Quantity of midventral tube feet could not be determined. Mouth ventral, anus terminal. Ossicles not observed.
RSIO590506. Specimen approximately 13 cm in length before preservation in 99% alcohol and heavily damaged. Color red-violet at sea surface, skin transparent. The specimen was stained with sponge as was RSIO590504 and many external characters could not be distinguished. Mouth ventral, anus terminal. Few rods observed on dorsal region (Fig.
The name is derived from the first Chinese
Kyushu-Palau Ridge, tropical Western Pacific. Depth: 2453–2692 m.
Known from Weijia Guyot and Kyushu-Palau Ridge.
The first group was characterized by the regular crosses, ossicles with bipartite central apophysis and well-developed dorsal papillae. This group included five species:
Recently, five more species were identified:
In general, the morphological features of
The characteristics of
Catalog number: RSIO6018004, adult specimen, collection number: DY60-JL180-B04,
RSIO6018004. Specimen resembles a barbell after collection, approximately 20 cm in length before preservation 10% seawater formalin (Fig.
A giant cross with four arms visible in each wart. Arms 800–1000 μm in length, and maximum width between large arms approximately 500 μm. Arm flexion approximately 250 / 400 μm (Fig.
RSIO6017005. Specimen approximately 18 cm in length, height of appendage approximately 40 mm, and width at base approximately 20 mm. Mouth and anus ventral. Skin transparent, light brown color. Dorsal skin and appendage covered with warts; warts also present in dorsum of brim. Giant ossicles visible in warts. Tentacles damaged, more than 12. Ossicles as in RSIO6018004.
Jiaolong Seamount, South China Sea, Western Pacific Ocean, sandy bottom, depth 3615 m.
Known from Jiaolong Seamount of South China Sea and Kyushu-Palau Ridge.
The specimens were clearly a new record for the South China Sea, as the species was previously known only from the Jiaolong seamount. The present specimens differed from those of
The intraspecific differences can be listed as follows: (1) In the present specimens, the skin was transparent and the color was darker than that of the type specimen; (2) The width of the appendage at the base was also larger than that of the type specimen; (3) The length of the primary crossing arms distributed in the dorsum, ventrum, and brim was longer than that of the type specimen. Furthermore, the spinous rod of the dorsal ossicles was not present in the type specimen, and the ventral body wall of the specimens did not possess the tripartite ossicles of the type specimens; and (4) Most of the ossicles of the tentacles in our specimens were the same as those of type specimen, but longer.
Owing to limited genetic sequences, the phylogenetic relationships of
To obtain clearer phylogenetic relationships, we concatenated 25
Bayesian inference (
Based on the morphological and phylogenetic analyses,
We are grateful to all the scientists and crew on the R/V “Shen Hai Yi Hao” and “Xiang yang hong 9”, and the Jiaolong