Corresponding author: Takato Izumi (
Academic editor: Bert W. Hoeksema
Izumi T, Fujii T (2021) Gems of the southern Japanese seas – four new species of
The superfamily
The genus
During recent surveys of Japanese waters, we recorded two previously described species of
We formally describe the new species as
Specimens of
Localities of the specimens of the
Histological sections of all specimens were made following standard protocols (Presnell and Schreibman, 1997); The materials were dissected by scissors, serially dehydrated by ethanol and xylene, embedded in paraffin, and sliced into serial sections each 8–10 μm thick. Thereafter, sections were mounted on glass slides. All sections were stained by hematoxylin and eosin, and finally they were mounted using the medium EUKITT (ORSAtec).
Cnidae were extracted from the tentacles, actinopharynx, nemathybomes, column, and filaments. Concerning the column of some
DNA was extracted from subsamples of each tissue that were preserved in 99% ethanol by using ChargeSwitch gDNA Micro Tissue Kit (Invitrogen). In addition, some tissue samples for DNA were processed following the guanidine extraction protocol (
Primers and protocols of polymerase chain reactions of every molecular marker.
Marker | Primer | Sequences (5‘-3‘) | PCR protocol | Reference | |
---|---|---|---|---|---|
12S | 12S1a | TAAGTGCCAGCAGACGCGGT | (95 °C for 4 min) + 4 × [(94°C for 30 sec) → (50°C for 1 min) → (72°C for 2 min)]+30 × [(94°C for 30 sec) → (55°C for 1 min) → (72°C for 2 min)] + (72°C for 4 min) |
|
|
12S3r | ACGGGCAATTTGTACTAACA | ||||
16S | ANEM16SA | CACTGACCGTGATAATGTAGCGT | (95°C for 4 min) + 30 × [(95°C for 30 sec) → (46°C for 45 sec) → (72°C for 1 min)] + (72°C for 5 min) |
|
|
ANEM16SB | CCCCATGGTAGCTTTTATTCG | ||||
16Sant1a | GCCATGAGTATAGACGCACA | (95°C for 4 min) + 30 × [(95°C for 30 sec) → (46°C for 45 sec) → (72°C for 1 min)] + (72°C for 5 min) |
|
||
16SbmoH | CGAACAGCCAACCCTTGG | ||||
18S | PCR | 18SA | AACCTGGTTGATCCTGCCAGT | (94°C for 4 min) + 35 × [(94°C for 20 sec) → (57°C for 20 sec) → (72°C for 1 min 45 sec)] + (72°C for 7 min) |
|
18SB | TGATCCTTCCGCAGGTTCACCT | ||||
Only sequence | 18SL | CCAACTACGAGCTTTTTAACTG | |||
18SC | CGGTAATTCCAGCTCCAATAG | ||||
18SY | CAGACAAATCGCTCCACCAAC | ||||
18SO | AAGGGCACCACCAGGAGTGGAG |
The phylogenetic analyses were performed on the family
Base sequences in the phylogenetic analyses. Sequences indicated by accession numbers were obtained from GenBank, and those indicated by bold were newly obtained in this study.
Higher taxon | Family | Genus | Species | Localities | Catalog numbers | 12S | 16S | 18S | ||
---|---|---|---|---|---|---|---|---|---|---|
|
|
|
Edwards |
|
|
Amami Island |
|
|
|
|
|
Ishigaki Island | – |
|
|
||||||
|
Kataburu_Yonaguni |
|
|
|
||||||
|
Otsuki_Kochi |
|
|
|
||||||
|
Oura Bay |
|
|
|
||||||
|
Amami Island |
|
|
|
||||||
|
Oura Bay |
|
|
|
||||||
|
|
Misaki |
|
|
|
|||||
|
|
|
|
|
||||||
|
|
- |
|
|||||||
|
|
|
|
|
||||||
|
|
|
|
|
||||||
|
|
|
|
|||||||
|
|
|
|
|
||||||
|
|
|
Off Ishigaki Island |
|
|
|
The substitution models of phylogenetic analyses on each marker.
Mitochondrial | Nuclear | ||
---|---|---|---|
12S rDNA | 16S rDNA | 18S rDNA | |
GTR+Gamma | GTR+Gamma | GTR+Gamma | |
Bayesian inference | HKY85+Gamma | HKY85+Gamma | K80+Gamma |
All constructed Maximum Likelihood and Bayesian trees were rooted and combined using FigTree ver. 1.4.3 (
(revised from the diagnosis given by England, 1987). Body divisible into physa, scapus, and capitulum. physa short, without nemathybomes or cuticle. Scapus long, generally with nemathybomes but sometimes without, sunk in mesoglea; cuticle present. Tentacles usually 20, inequal number at inner and outer cycle: five-eight inner and 12–15 outer. Siphonoglyph weak or absent, ventral. Mesenteries eight macrocnemes and six pairs of microcnemes, minute and restricted to distal part of column. Microcnemes never paired with macrocnemes. Gametogenic tissue, filaments, and parietal and retractor muscles on macrocnemes only. Parietals well developed; retractors strong-diffuse to restricted-reniform. Cnidom: spirocysts, basitrichs, microbasic
This name is constructed from
Since
In the present study, sea anemones resembling
Cnidoms of the species of
|
|
|
||||||||||||||
|
|
|
||||||||||||||
Length × Width (µm) | Mean (µm) | SD (µm) | n | frequency | Length × Width (µm) | Mean (µm) | SD (µm) | n | frequency | Length × Width (µm) | Mean (µm) | SD (µm) | n | frequency | ||
Tentacle | ||||||||||||||||
basitrichs | 20.1–34.0 × 2.9–4.2 | 27.4 × 3.6 | 3.09 × 0.30 | 57 | numerous | 13.2–26.4 × 2.8–4.6 | 20.5 × 3.6 | 3.23 × 0.44 | 50 | numerous | 25.9–34.6 × 2.7–4.3 | 30.0 × 3.3 | 2.05 × 0.29 | 94 | numerous | |
spirocysts | 11.9–20.1 × 2.2–3.6 | 15.1 × 2.9 | 1.88 × 0.32 | 25 | numerous | 8.5–14.3 × 3.0–4.4 | 11.0 × 3.4 | 1.43 × 0.35 | 12 | few | 11.8–21.0 × 2.5–3.7 | 16.6 × 3.1 | 1.83 × 0.28 | 57 | numerous | |
Actinopharynx | ||||||||||||||||
basitrichs | S | 17.4–24.2 × 1.9–3.0 | 20.8 × 2.5 | 2.02 × 0.44 | 15 | numerous | 16.3–21.1 × 2.4–3.9 | 18.4 × 3.1 | 1.24 × 0.39 | 12 | few | 14.3–16.9 × 3.5–3.9 | 16.0 × 3.7 | 0.99 × 0.19 | 4 | rare |
L | 34.8–42.6 × 3.3–5.4 | 38.4 × 4.5 | 1.80 × 0.44 | 47 | numerous | 26.5–34.3 × 3.0–4.5 | 30.8 × 3.7 | 1.71 × 0.35 | 66 | numerous | 36.1–48.8 × 3.2–5.0 | 42.5 × 4.2 | 2.85 × 0.40 | 76 | numerous | |
microbasic |
30.3–35.6 × 6.6–7.1 | 33.4 × 6.7 | 1.92 × 0.17 | 5 | few | 28.9–35.5 × 6.6–8.4 | 32.5 × 7.6 | 2.71 × 0.78 | 3 | rare | – | – | – | – | – | |
Nemathybome | ||||||||||||||||
basitrichs | S | – | – | – | – | – | – | – | – | – | – | 16.6–19.9 × 3.9–4.1 | 18.4 × 4.0 | 1.35 × 0.08 | 4 | rare |
L | 46.8–56.6 × 3.2–5.6 | 41.7 × 51.7 | 1.95 × 0.43 | 44 | numerou | 34.0–45.2 × 3.0–4.8 | 39.6 × 3.8 | 2.02 × 0.38 | 75 | numerous | 46.8–56.6 × 3.2–5.6 | 51.7 × 4.3 | 2.08 × 0.47 | 44 | numerous | |
Column | ||||||||||||||||
basitrichs | 15.8–17.5 × 3.4–3.8 | 16.8 × 3.7 | 0.72 × 0.18 | 3 | rare | 9.8–14.4 × 2.8–4.1 | 12.0 × 3.3 | 1.12 × 0.41 | 12 | few | 47.9–53.8 × 3.4–4.8 | 50.8 × 4.0 | 1.62 × 0.33 | 24 | numerous | |
Filament | ||||||||||||||||
basitrichs | S | 25.1–31.7 × 2.4–4.1 | 29.0 × 3.3 | 1.69 × 0.34 | 49 | numerous | 12.9–19.2 × 2.8–4.2 | 14.8 × 3.4 | 1.32 × 0.33 | 61 | numerous | 22.4–32.2 × 3.2–5.0 | 28.3 × 4.0 | 2.29 × 0.43 | 43 | numerous |
L | 29.4–42.7 × 4.2–5.9 | 37.3 × 4.9 | 3.09 × 0.31 | 29 | numerous | – | – | – | – | – | 27.6–44.3 × 4.1–5.8 | 34.8 × 4.8 | 5.87 × 0.51 | 11 | few | |
microbasic |
29.7–34.1 × 5.2–7.6 | 31.6 × 6.2 | 1.26 × 0.62 | 11 | few | 33.0–38.4 × 8.2–10.9 | 36.3 × 9.3 | 1.63 × 0.72 | 12 | few | 30.1–31.8 × 5.3–5.9 | 30.9× 5.6 | 0.87 × 0.29 | 2 | rare |
External and internal morphology of
Cnidae of
see the derivation of genus name.
This specimen from Amami Oshima Island resembled the features of
External and internal morphology of
External and internal morphology of
The species epithet refers to ruby, a kind of gemstone, and is named so after the scarlet, vivid red, color of its tentacles. Derivation of the Japanese name is the same as that of the Latin species name.
This species can be distinguished from
Cnidoms of the species of
|
|
|
||||||||||||||
Length × Width (µm) | Mean (µm) | SD (µm) | n | frequency | Length × Width (µm) | Mean (µm) | SD (µm) | n | frequency | Length × Width (µm) | Mean (µm) | SD (µm) | n | frequency | ||
Tentacle | ||||||||||||||||
basitrichs | 27.5–37.3 × 3.0–4.8 | 33.1 × 3.9 | 2.27 × 0.40 | 55 | numerous | 25.4–40.3 × 3.0–4.7 | 30.4 × 3.8 | 2.72 × 0.41 | 67 | numerous | 17.0–32.6 × 2.7–4.3 | 27.7 × 3.6 | 3.15 × 0.38 | 55 | numerous | |
spirocysts | 14.9–23.6 × 2.8–4.9 | 19.1 × 3.9 | 1.78 × 0.46 | 64 | numerous | 12.1–21.7 × 2.5–5.1 | 18.0 × 3.8 | 2.07 × 0.49 | 61 | numerous | 14.6–24.1 × 3.0–4.9 | 20.6 × 4.0 | 1.96 × 0.37 | 53 | numerous | |
Actinopharynx | ||||||||||||||||
basitrichs | S | 20.2–25.9 × 2.3–3.6 | 22.1 × 3.1 | 1.49 × 0.40 | 13 | few | 20.5–23.6 × 2.5–3.0 | 22.2 × 2.7 | 1.03 × 0.20 | 6 | few | 12.3–18.2 × 2.7–4.7 | 14.2 × 3.7 | 1.18 × 0.48 | 48 | numerous |
L | 34.1–44.1 × 3.6–5.6 | 39.1 × 4.7 | 2.24 × 0.42 | 44 | numerous | 34.9–47.7 × 3.5–5.9 | 40.0 × 4.5 | 2.46 × 0.44 | 71 | numerous | 28.9–49.1 × 3.8–4.7 | 38.6 × 4.1 | 9.60 × 0.34 | 4 | rare | |
microbasic |
– | – | – | – | – | 35.1–42.0 × 7.2–8.5 | 38.3 × 7.8 | 2.73 × 0.49 | 5 | few | – | – | – | – | – | |
Nemathybome | (No nematocyst was observed) | |||||||||||||||
basitrichs | S | 16.9–20.5 × 3.2–3.9 | 18.5 × 3.4 | 1.05 × 0.22 | 8 | few | 16.5–17.1 × 3.0–3.7 | 16.8 × 3.3 | 0.31 × 0.35 | 2 | rare | |||||
L | 39.8–75.2 × 2.8–4.9 | 56.0 × 3.7 | 4.98 × 0.47 | 43 | numerous | 48.7–61.6 × 3.0–4.7 | 54.4 × 3.8 | 2.75 × 0.41 | 59 | numerous | ||||||
Filament | ||||||||||||||||
basitrichs | S | 25.2–29.8 × 2.6–3.9 | 27.1 × 3.4 | 1.71 × 0.48 | 4 | few | 18.6–32.2 × 2.5–4.1 | 28.2 × 3.1 | 2.23 × 0.33 | 61 | numerous | 12.6–17.3 × 2.9–4.8 | 15.2 × 3.6 | 1.15 × 0.45 | 42 | numerous |
L | 38.4–50.5 × 4.3–6.2 | 44.6 × 5.1 | 2.97 × 0.41 | 54 | numerous | 39.3–52.0 × 4.6–7.1 | 46.1 × 5.8 | 2.77 × 0.51 | 45 | numerous | 27.4–46.3 × 3.6–5.2 | 36.7 × 4.3 | 5.98 × 0.41 | 23 | numerous | |
spirocysts | – | – | – | – | – | 15.6–18.2 × 3.0–4.2 | 16.9 × 3.7 | 1.31 × 0.57 | 2 | rare | 13.3–23.6 × 3.2–6.1 | 19.5 × 4.8 | 2.14 × 0.57 | 27 | numerous | |
microbasic |
33.1–42.3 × 5.9–8.3 | 36.9 × 7.4 | 2.69 × 0.55 | 16 | numerous | 30.9–41.2 × 6.6–8.6 | 35.0 × 7.8 | 2.91 × 0.70 | 13 | few | 35.1 × 7.8 | – | – | 1 | rare |
To complete the description of this species, it is necessary to collect and examine specimens with complete proximal ends. However, this species was collected only once from the type locality, and no additional field observations are known, even despite the presence of its characteristic red tentacles. This species is the only
External and internal morphology of
Cnidae of
The species epithet refers to a sapphire, a gemstone, and is named so after the brilliant metallic blue color of the species’ tentacles. Derivation of the Japanese name is the same as that of the Latin species name.
This species is one of the largest species of its family. It is not only characterized by its gigantic body size, and bluish metallic tentacle coloration, but also by the strange club-like shape of its parietal muscles. Congeneric species have parietal muscles with simple or slightly branched processes, and there are no confirmed cases of parietal muscles with such secondary branched muscular processes in other species. Thus, the shape of parietal muscle of this species is very conspicuous within its genus, allowing
There have been several observations of the metallic blue tentacles resembling this species reported during SCUBA diving in Amami Oshima by Takuma Fujii and some other divers (Atetsu Bay and some other places). However, it was too difficult to dig out such large edwardsiid sea anemones that are buried deeply in the substrate, as they usually retract their whole bodies quickly into the substrate. Therefore, we think that the difficulty in collecting multiple specimens is the most serious issue that needs to be overcome in order to make additional progress in the study of edwardsiids.
External and internal morphology of
This species epithet refers to an emerald, a gemstone, and is named so after the bright green coloration of its tentacles. Derivation of the Japanese name is the same as that of the Latin species name.
In the phylogenetic tree (Fig.
External and internal morphology of
This species epithet refers to amethyst, a kind of gemstone, and is named after this species’ dark purple tentacle coloration. Derivation of the Japanese name is the same as that of the Latin species name.
The most characteristic feature of this species is the nemathybome-like features without nematocysts. Nemathybomes are pocket-like features on columns of some genera of
The concatenated phylogenetic tree of 12S, 16S, and 18S rDNA (total 2886 bp) is shown in Fig.
Maximum-likelihood tree of the order
In addition, the most basal position of our phylogenetic tree of
We thank the researchers below for sample collection as indicated in parentheses: Kensuke Yanagi (Coastal Branch of Natural History Museum and Institute, Chiba;
The correct shape of Maximum-likelihood tree of the order
phylogenetic tree