Corresponding author: Yuki Matsui (
Academic editor: B. Landry
Matsui Y, Naka H, Jinbo U (2021) DNA barcoding and morphology reveal a new cryptic species of
Two species,
Most specimens of
Female moths were placed in plastic cups (Clean Cup 129 Pi 860B, with lid Clean Cup 129 Pi FSL [Risupack, Gifu, Japan]; diameter 129 mm, height 130 mm) with fresh leaves of
The holotype of the new species is deposited in the National Museum of Nature and Science (
Before examining the male and female genitalia, the abdomen was detached from the specimen and soaked in a 10% potassium hydroxide (KOH) solution. The soaked abdomen was kept at room temperature overnight and then incubated at 60 °C for 3–6 h. After incubation, the abdomen was transferred into a glass dish with 70% ethanol, and the genitalia were detached from the abdomen under a stereomicroscope (LW-820T; Wraymer Inc., Osaka, Japan) using scissors and tweezers. The genitalia were stained with merbromin in 70% ethanol and mounted on a glass slides in Euparal. The photographs of the whole genitalia were captured with a stereomicroscope (SZX10; Olympus Corp., Tokyo, Japan) and a digital camera (DP25; Olympus Corp., Tokyo, Japan). The magnified views of genital structures were captured by an upright microscope (BX53; Olympus Corp., Tokyo, Japan) with a digital camera (DP21; Olympus Corp., Tokyo, Japan). Genital structures were measured on the screen by Fiji (
Total DNA was extracted from the middle legs of the moths using the DNeasy Tissue Kit (Qiagen, Hilden, Germany). The legs were crushed using BioMasher II (FUJIFILM Wako Pure Chemical Co., Osaka, Japan) and incubated with Proteinase K (Takara Bio Corp., Shiga, Japan) for 3–7 d at 60 °C to elute DNA. Subsequent procedures followed the manufacturer’s protocol of the DNeasy Tissue Kit.
The mitochondrial COI gene was amplified using the primers TY-J-1460-Spilo (forward: TACAATTTATCGCTTAATACTCAGCC) and TL2-N-3014-Spilo (reverse: TCCATTACATATAATCTGCCATATTA). These primers were based on TY-J-1460 and TL2-N-3014 (
The PCR products were checked by electrophoresis on a 1% agarose gel and were purified using NucleoSpin Gel and PCR Clean-up (Takara Bio Corp., Shiga, Japan). Sequencing was conducted at Premix2 analysis service (Fasmac Co., Ltd, Kanagawa, Japan) using the primers LCO1490 (forward: GGTCAACAAATCATAAAGATATTGG) and HCO2198 (reverse: TAAACTTCAGGGTGACCAAAAAATCA) (
Genetic sample information for the material included in this study with accession numbers.
Species | Location | DDBJ accession no. |
---|---|---|
|
Japan: Yamaguchi, Akiyoshidai |
|
|
Japan: Tottori, Wakasa, Hyonosen |
|
|
Japan: Shimane, Iinan, Kusandao |
|
|
Japan: Tottori, Daisen |
|
|
Japan: Tottori, Tottori, Sourokubara |
|
|
Japan: Tottori, Tottori, Uemachi |
|
|
Japan: Tottori, Tottori, Sourokubara |
|
|
Japan: Tottori, Tottori, Hashimoto |
|
To construct the phylogenetic tree, we downloaded the sequences of
DNA barcoding employs DNA sequences in a short and standardized gene region to facilitate species identification. BOLD (
We successfully obtained 626 bp sequences of the COI barcode region of the seven specimens of
Mean number of intra (in bold) / interspecific substitutions in mitochondrial COI (626 bp) among four
Species |
|
|
|
|
---|---|---|---|---|
|
||||
35.5 |
|
|||
36.7 | 28.8 |
|
||
40.3 | 36.5 | 18.3 |
|
In the BOLD database, the sequence of
The
Neighbour-joining (
1 | Forewing length 15.5–18 mm; cilia creamy white at Cu2 to A1+2 for forewing, Cu2 to CuP for hindwing; gnathos of male genitalia slender and elongated; signum of female genitalia with sharp projections at both edges of posterior margin |
|
– | Forewing length less than 13 mm; cilia of both wings concolorous with ground color; gnathos of male genitalia nearly triangular, short and small; signum of female genitalia small and rounded, without projections |
|
2 | Ground color of both wings lighter, postmedial line distinct especially in the hindwing; large, comma-shaped white spots at end of discal cell in each wing, usually larger; subdiscal white spot of forewing usually quadrilateral, distinct; base of discal cell of hindwing white; valva of male genitalia dorsally straight margined subapically; anterior apophysis of female genitalia slightly incurved to dorsally, expansion of the base sharply triangular; signum of female genitalia circular, small (diameter 0.05–0.06 mm) |
|
– | Ground color of both wings darker, postmedial line obscure; large, comma-shaped, white spots at end of discal cell in each wing, usually smaller, especially in the hindwing; subdiscal white spot of forewing rounded, small and blurry; base of discal cell of hindwing concolorous with ground color; dorsal margin of valva of male genitalia slightly incurved subapically; anterior apophysis of female genitalia straight and narrow, expansion of the base broadly triangular; signum of female genitalia nearly elliptic, larger (diameter 0.09–0.14 mm) |
|
The specific epithet refers to the darker wing color in comparison to that of
This new species is similar to
Male genitalia of
In Honshu, Japan, adults are found in May to September, and they are considered bivoltine. They appear to be hardly attracted to light. Larvae feed on
Japan: Honshu (Tokyo, Shizuoka, Aichi, Tottori, Yamaguchi), Kyushu (Kagoshima), Ryukyu Islands (Yakushima, Amamioshima, Tokunoshima, Okinawajima).
The shapes of the uncus and gnathos show intraspecific variations, i.e., in several specimens, the posterior margin of the uncus is slightly notched medially, and the projection of the gnathos is smaller than that shown on Figure
Japan: 1♂, Tohro, Hokkaido, 3 Jul. 1962, T. Ebato leg., (
Adult (Fig.
Male genitalia of
Japan, mainland China, Taiwan, Korea, Russia (southeast), India.
Our identification of this species is based on characters of external morphology (
Japan: 1♂, Marumori, Onikôbe, Narugo, Miyagi Pref., 30 Jul. 1997, M. Tanaka leg. (
Adult (Fig.
Male genitalia of
Japan, mainland China, Taiwan, Korea, Russia (southeast), Southeast Asia, Nepal, India.
Female genitalia of
Female genitalia of
Our identification of this species in this study was based on external morphology (
Female genitalia of
Recently, the integration of DNA barcoding and morphological approaches has accelerated various stages of taxonomic studies, such as species identification and description, re-investigation of taxa, as well as detecting cryptic species, also in
The
As the species of the genus
Host plant records of
The species of
We are grateful to Prof. Nobuo Tsurusaki and Prof. Masaaki Azuma (Tottori University, Japan) who helped with photographing the genitalia, to Mr Jôhei Oku (Kyushu University, Japan) who supplied valuable information about dissection of genitalia. We also grateful to Drs Richard Mally (Czech University of Life Sciences Prague, Czech), Xicui Du (Southwest University in Chongqing, China), and Bernard Landry (Muséum d’histoire naturelle, Switzerland) who provided critical reviews and careful linguistic corrections to our manuscript. Special thanks to the student members of the Laboratory of Applied Entomology in the Faculty of Agriculture, Tottori University who cooperated in the rearing of insects. This work was supported by a grant-in-aid for JSPS Research Fellow (JP18J22206).