Corresponding author: Dana Carrison-Stone (
Academic editor: Niel Bruce
Two new species of
The Gulf of Guinea island chain consists of Bioko, São Tomé, Príncipe, and Annobón. This study focuses on São Tomé and Príncipe, which are approximately 140 km apart and 274 km west of northern Gabon. They are the products of large shield volcanoes originating 3,000 m below the ocean’s surface along the Cameroon line. São Tomé and Príncipe are old islands, 13 and 30 myo, respectively, and have never been connected to the African mainland.
There are three known species of
Morphologically
Approximately 40 individuals of
Barnacle cirri, mouthparts and opercular plates from São Tomé, Príncipe, and Portugal specimens were dissected for morphological comparisons. These physical traits, along with shell shape, in particular basis shape and presence/absence of longitudinal tubes in shell wall plates, are traditionally used for identification. The cirri and mouthparts were mounted on microslides and photographed at 100x with a Leitz microscope imaging system. Images of the opercular plates were taken with a scanning electron microscope (SEM, LEO/Zeiss 1450VP).
Identification of host gorgonians was based on external and sclerite morphology. Branching patterns, polyp shape, color and sclerite types were examined. Sclerites were isolated by dissolving small amounts of gorgonian tissue in sodium hypochlorite solution, followed by rinsing with water and then 75% ethanol. Images of the sclerites were taken with SEM and Leitz optical microscope imaging systems. All gorgonians harboring barnacles were identified using
Genomic DNA was extracted from adductor muscle tissue using the Qiagen DNeasy Blood and Tissue kit (Valencia, CA). The cytochrome c oxidase subunit I (COI) primers COI-N: TGAGAAATTATTCCGAAGGCTGG (
Molecular phylogeny was determined by Bayesian and likelihood analyses.
Data associated with the specimens used in this study.
Barnacle taxon | Gorgonian host | CASIZ Catalog | GenBank accession’s | Collection Locality |
---|---|---|---|---|
|
|
175916 | Porto Covo, Portugal | |
|
|
175917 | Porto Covo, Portugal | |
|
|
180065 | Porto Covo, Portugal | |
|
unknown | 106216 | St.Catherine Is., Georgia | |
|
unknown | 184331 | South Padre Is., Texas | |
|
|
183496 | Port Aransas, Texas | |
unknown | 184416A 184416B | Mexico Beach, Florida | ||
|
173189 | Diogo Vaz, São Tomé | ||
|
173190 | Diogo Vaz, São Tomé | ||
|
174321 | Ilheu Santana, São Tomé | ||
|
174804 | Diogo Vaz, São Tomé | ||
|
174805 | Diogo Vaz, São Tomé | ||
|
174806 | Diogo Vaz, São Tomé | ||
|
175525 | Diogo Vaz, São Tomé | ||
|
175526 | Diogo Vaz, São Tomé | ||
unknown | 178662 | Diogo Vaz, São Tomé | ||
|
178655 | Bom Bom Is., Príncipe | ||
unknown | 178656 | Bom Bom Is., Príncipe | ||
180025 |
|
Pedra de Galé, Príncipe | ||
|
185253 | Diogo Vaz, São Tomé | ||
|
174803A 174803B | Diogo Vaz, São Tomé | ||
|
174320 | Ponta Baleia, São Tomé | ||
|
174322A 174322B | Ponta Baleia, São Tomé | ||
|
178651A 178651B | Pedra de Galé, Príncipe | ||
|
185252 | Ponta Baleia, São Tomé |
Two major clades resulted from molecular analysis. One clade contains
Pairwise uncorrected p-distances (
Uncorrected pairwise distances among groups, COI (lower half of matrix) and H3 (upper half of matrix).
Barnacle taxon |
|
|
||
0.022 | 0.014 | 0.110 | ||
0.082 | 0.013 | 0.106 | ||
|
0.088 | 0.104 | 0.102 | |
|
0.148 | 0.165 | 0.166 |
Bayesian phylogeny based on concatenated H3 nDNA and COI mtDNA sequences. Posterior probabilities of 0.95 or greater are shown. The relationship among the Gulf of Guinea species and
Subclass Cirripedia Burmeister, 1834
Superorder Thoracica Darwin, 1854
Order Sessilia Lamarck, 1818
Suborder Balanomorpha Pilsbry, 1916
Superfamily Balanoidea Leach, 1817
Family Archaeobalanidae Newman & Ross, 1976
Genus
Holotype: CASIZ185253, separated from CASIZ175526, 95% EtOH. Diogo Vaz, São Tomé, Gulf of Guinea,
Paratypes: CASIZ173189 (4 specimens) and CASIZ174804, Diogo Vaz, São Tomé, Gulf of Guinea (
Exterior of shell with minute bumps, most prominent on parieties. Color variable, white with varying shades of purple concentrated on parietes and basis often at carina side of shell. Radii usually white but can be colored, basis lighter shade of purple to light purplish-red (
Scutum (
Tergum (
Labrum (
Mandibular palp (
Mandible (
Maxilla I (
Maxilla II (
Cirrus I (
Cirrus II (
Cirrus III (
Cirrus IV (
Cirrus V (
Cirrus VI (
All cirral setae simple.
Penis long, covered in sparse fine setae, large basidorsal point (
Cirral formula for
Cirrus | I | II | III | IV | V | VI |
---|---|---|---|---|---|---|
Anterior ramus | 15–18 | 13–16 | 11–13 | 17–25 | 27 | 21–27 |
Posterior ramus | 10–17 | 11–13 | 9–12 | 21–25 | 22–28 | 24–29 |
Holotype: CASIZ185252, separated from CASIZ174322, 95% EtOH. Ponta Baleia, São Tomé, Gulf of Guinea,
Paratypes: CASIZ174803 (2 specimens), Diogo Vaz, São Tomé, Gulf of Guinea (
Exterior of shell covered in very small bumps; color variable, white with pink or light purple on parietes and basis, radii usually white or lighter in color, rostrum often white (
Scutum (
Tergum (
Labrum (
Mandibular palp (
Mandible (
Maxilla I (
Maxilla II (
Cirrus I (
Cirrus II (
Cirrus III (
Cirrus IV (
Cirrus V (
Cirrus VI (
All cirral setae simple.
Penis long with large basidorsal point (
Morphological differences between
Morphological differences between
Cirral formula for
Cirrus | I | II | III | IV | V | VI |
---|---|---|---|---|---|---|
Anterior ramus | 14–17 | 11–12 | 11–12 | 19–21 | 23–24 | 23–25 |
Posterior ramus | 9–11 | 9–10 | 10–11 | 21–22 | 24–26 | 23–26 |
COI has been shown to be useful for delimiting species within the Crustacea (
The barnacles collected from the Gulf of Guinea for this study were originally identified as
Attempts to obtain specimens of
Barnacles are found permanently attached to many different types of living and non-living substrata. Locating a living substratum, especially one that is mobile or spatially rare, can be challenging for a small marine larva. For example; a gorgonian, a turtle, or a whale is harder to locate than a rock bed. When barnacle larvae locate and settle onto a gorgonian they may be recognizing the substratum, the presence of conspecifics, or both. It has been shown that barnacle larvae can determine where to settle by recognizing pheromone cues from their cohorts (
Although the details of the settling barnacle larvae and gorgonian interaction are not completely known, it appears, from our observations (specifically that
The possibility that
The authors would like to thank Robert Drewes (California Academy of Sciences) for initiating and organizing biodiversity research on the Gulf of Guinea Islands; Sarah Cohen (San Francisco State University/RTC) for academic support; Ned Seligman of the Step-Up Foundation for help with collecting permits and making local contacts on the islands; Africa’s Eden for lodging in São Tomé and Príncipe and dive operations in Príncipe; Mary Wicksten for specimens of