Corresponding author: Thomas G. Dahlgren (
Academic editor: Chris Glasby
We present DNA taxonomy of abyssal polychaete worms from the eastern Clarion-Clipperton Zone (CCZ), central Pacific Ocean, using material collected as part of the Abyssal Baseline (ABYSSLINE) environmental survey cruises ‘AB01’ and ‘AB02’ to the UK Seabed Resources Ltd (UKSRL) polymetallic nodule exploration contract area ‘UK-1’, the Ocean Mineral Singapore exploration contract area ‘OMS-1’ and an Area of Particular Environmental Interest, ‘APEI-6’. This is the fourth paper in a series to provide regional taxonomic data with previous papers reporting on
Wiklund H, Neal L, Glover AG, Drennan R, Rabone M, Dahlgren TG (2019) Abyssal fauna of polymetallic nodule exploration areas, eastern Clarion-Clipperton Zone, central Pacific Ocean: Annelida: Capitellidae, Opheliidae, Scalibregmatidae, and Travisiidae. ZooKeys 883: 1–82.
In the last decades there has been rapid growth in the commercial exploration of the abyssal deep sea for mineral resources (
In terms of recent molecular studies,
The DNA taxonomy part of the UK Seabed Resources (
Map over sampling sites.
The first UKSR ABYSSLINE cruise (AB01), sampling the UK-1 exploration contract area, took place in October 2013 aboard the RV
A comprehensive description of our DNA taxonomy pipeline is provided in
In the laboratory, specimens were re-examined using stereo and compound microscopes, identified and described to the best possible taxonomic level with key morphological features photographed with digital cameras and a small tissue-sample taken for DNA extraction. Shirlastain A and Methyl Green stain were used during the morphological examination on some specimens, in order to better observe certain characters. Methyl Green stain was limited to
Extraction of DNA was done with DNeasy Blood and Tissue Kit (Qiagen) using a Hamilton Microlab STAR Robotic Workstation. About 1800 bp of 18S, 450 bp of 16S, and 650 bp of cytochrome c oxidase subunit I (COI) were amplified using primers listed in Table
Primers used for PCR and sequencing of 18S, COI and 16S.
Primer | Sequence 5’-3’ | Reference |
---|---|---|
|
||
18SA | AYCTGGTTGATCCTGCCAGT |
|
18SB | ACCTTGTTACGACTTTTACTTCCTC |
|
620F | TAAAGYTGYTGCAGTTAAA |
|
1324R | CGGCCATGCACCACC |
|
|
||
LCO1490 | GGTCAACAAATCATAAAGATATTGG |
|
HCO2198 | TAAACTTCAGGGTGACCAAAAAATCA |
|
COI-E | TATACTTCTGGGTGTCCGAAGAATCA |
|
polyLCO | GAYTATWTTCAACAAATCATAAAGATATTGG |
|
polyHCO | TAMACTTCWGGGTGACCAAARAATCA |
|
|
||
ann16SF | GCGGTATCCTGACCGTRCWAAGGTA |
|
16SbrH | CCGGTCTGAACTCAGATCACGT |
|
The field and laboratory work created a series of databases and sample sets that are integrated into a data-management pipeline. This includes the transfer and management of data and samples between a central collections database, a molecular collections database and external repositories (GenBank, WoRMS, OBIS, GBIF, GGBN, ZooBank) through DarwinCore archives and usage of the GGBN data standard (
Future studies of biogeographic and bathymetric ranges, gene-flow, extinction risks, natural history, reproductive ecology, functional ecology and geochemical interactions of CCZ species are dependent on accurate taxonomic identifications. This taxonomy is dependent on a sound theoretical underpinning—a species concept—coupled with the availability of both raw data and voucher samples. Here we use a phylogenetic species concept sensu
Taxon treatments presented in this paper. Includes family, DNA taxonomy ID (a species-level identification based on combined DNA and morphological evidence), GUID (Global Unique Identifier link to data record at
Family | DNA taxonomy ID | ABYSSLINE record | GUID | NHMUK Record no. | NHMUK MCF no. | Genbank no. |
---|---|---|---|---|---|---|
|
NHM_613 | be34eb86-fc0c-411c-8eb9-e86774c6515a | 2019.7105 | 0109494702 |
|
|
|
||||||
NHM_1486 | 05d46c60-8b4d-4623-b7ff-2e8089453d7e | 2019.7106 | 0109494649 |
|
||
|
||||||
NHM_162 | f34e2921-7b6d-4c14-b217-690d9315f073 | 2019.7100 | 0109494624 |
|
||
|
||||||
NHM_915B | 98291a2a-c89a-4f62-bde5-91171368c749 | 2019.7101 | 0109494712 |
|
||
NHM_1025D | 3e34e783-a51b-4a84-bc2e-6a19bac82b4e | 2019.7102 | 0109494679 |
|
||
NHM_1200 | 2612dd53-cce5-47b9-aeed-c321bda6c3d8 | 2019.7103 | 0109494687 |
|
||
NHM_1948J | 24374a21-17b6-4de5-8436-18c160aa5c8d | 2019.7104 | 0109494636 |
|
||
|
NHM_1166C | 483c6faa-0338-4cf5-a21d-6f448c72f4aa | 2019.7109 | 0109494704 |
|
|
|
||||||
NHM_1250 (holotype) | 1514d25d-b485-4b90-8981-3e84381bf250 | 2019.7110 | 0109494644 |
|
||
|
||||||
|
||||||
NHM_1871 (paratype) | d93680b5-a3a3-4623-afc4-17062e1a1a58 | 2019.7111 | 0109494707 |
|
||
NHM_1949 | cff2696d-06ab-42a1-843e-6ef894872f32 | 2019.7112 | 0109494683 |
|
||
NHM_254 (holotype) | 3441cd68-7432-4dee-8415-966b104c3077 | 2019.7107 | 0109494672 |
|
||
|
||||||
|
||||||
NHM_1653 | a2f7ed04-7275-4a57-a058-bd750cacc715 | 2019.7108 | 0109494685 |
|
||
|
||||||
|
||||||
NHM_2114 | f4492dd1-8088-47c6-97d9-32e43ae99552 | 2019.7113 | 0109494699 |
|
||
|
||||||
NHM_2112 (holotype) | c1554f01-2324-4d8d-b775-dca42f5918e7 | 2019.7131 | 0109494716 |
|
||
|
||||||
NHM_245 | 3a34b9cb-504b-48a3-a8e9-93077ec69520 | 2019.7140 | 0109494696 |
|
||
|
||||||
|
||||||
NHM_248 | e67f7724-8c9f-4463-943e-7cda20441728 | 2019.7141 | 0109494197 |
|
||
NHM_473 | 79dcab18-936b-430e-b770-6aab60d285c5 | 2019.7142 | 0109494671 |
|
||
|
||||||
NHM_598 (paratype) | 2fa20a59-8bb3-4ef8-b2e9-efccbe2c9414 | 2019.7143 | 0109494713 |
|
||
NHM_708 | 2077c6c6-0e3e-4dfa-97a0-16d6c386ff07 | 2019.7144 | 0109494665 |
|
||
NHM_1098 | 5661fb64-83a2-4e9a-b3c3-a8405705ed1a | 2019.7145 | 0109494631 |
|
||
NHM_1137 (holotype) | 11616c16-bdb5-4813-9d17-7170bb62702b | 2019.7146 | 0109494711 |
|
||
NHM_1309 (paratype) | 1ff41b52-9801-4b2e-8e01-ea34597b708d | 2019.7147 | 0109494639 |
|
||
|
NHM_1073 (holotype) | f7330230-224b-49e7-aa80-41e8654ea087 | 2019.7132 | 0109494655 |
|
|
|
||||||
NHM_681 (holotype) | 0de17415-a8bf-4461-a663-dea9a3e6a2b9 | 2019.7116 | 0109494717 |
|
||
|
||||||
|
||||||
NHM_718 | f6e2fa9b-a479-4e0d-aec6-57efff6987b2 | 2019.7117 | 0109494693 |
|
||
|
||||||
NHM_883 | d9a3a3b3-c16e-4359-8eb0-f09deed98401 | 2019.7118 | 0109494627 |
|
||
|
||||||
NHM_994 | 4f6d2b7a-169f-46a9-8b3b-5d91a021aa34 | 2019.7119 | 0109494626 |
|
||
NHM_1066 | 972f9cb1-79d7-4296-a6d6-e04543c9105c | 2019.7120 | 0109494664 |
|
||
NHM_1766 (paratype) | dc754b1c-e66b-4a58-a93e-796ebfd32f6a | 2019.7121 | 0109494658 |
|
||
|
||||||
NHM_1870 | b6247e8d-d155-4646-87d7-e5358ada5352 | 2019.7122 | 0109494708 |
|
||
NHM_2088 | 7dd04f2c-435b-44b1-a85f-3b05dd3014d7 | 2019.7123 | 0109494669 |
|
||
NHM_2092 | 1a095836-fa97-48b8-ad4c-07ed28356ecb | 2019.7124 | 0109494650 |
|
||
NHM_2102 | 93e91313-61a3-4cd7-8221-66bf20232f14 | 2019.7125 | 0109494645 |
|
||
|
||||||
NHM_2116 (paratype) | d439156e-657d-4dd5-8bb5-3531e150961e | 2019.7126 | 0109494692 |
|
||
|
||||||
NHM_2144 | 79767cab-eb56-4ef1-acd0-5067ec3736de | 2019.7127 | 0109494668 |
|
||
NHM_2149 | 1caa9eb3-3281-4ed6-8424-dfaebcf1e20b | 2019.7128 | 0109494675 |
|
||
NHM_2150 | 993f577c-ee86-4660-b2d9-af0146606f92 | 2019.7129 | 0109494651 |
|
||
|
||||||
NHM_1241 (holotype) | 920d8670-507e-4126-a42b-6e208bbe66d3 | 2019.7130 | 0109494220 |
|
||
|
||||||
NHM_683 (holotype) | 220fa671-4576-45b7-930d-efde148f223f | 2019.7133 | 0109494235 |
|
||
|
||||||
|
||||||
NHM_700 (paratype) | 63115f48-bcf1-4b3b-9c2e-c339b97845bd | 2019.7134 | 0109494678 |
|
||
NHM_783F | 376a42db-0497-4b4a-851b-c1d5e07bd2b6 | 2019.7135 | 0109494630 |
|
||
NHM_1273 (paratype) | a3540563-8a0c-475b-96b5-12969fb8c2ba | 2019.7136 | 0109494663 |
|
||
NHM_1309A | 25066e63-ecc9-439a-9907-eaeaeb72e78c | 2019.7137 | 0109494656 |
|
||
|
||||||
NHM_1769 | 8a2cbe4f-277d-4355-a34f-0b53c797bef0 | 2019.7148 | 0109494637 |
|
||
|
||||||
|
||||||
NHM_2017 | 9ebcd947-c53b-4616-81d4-da42afaeca03 | 2019.7149 | 0109494660 |
|
||
NHM_689 | 6755d584-a20a-4ce5-a4f1-32ce0965128e | 2019.7114 | 0109494689 |
|
||
|
||||||
NHM_1068 | b28fd52f-5717-45e3-b0cc-369172a690e5 | 2019.7138 | 0109494646 |
|
||
|
||||||
NHM_1874 | c3ffe5f4-6ca3-4816-966c-25ec98bbb003 | 2019.7139 | 0109494684 |
|
||
NHM_1331 | 06d48d7f-7339-4cc5-8445-b51a980e4e0f | 2019.7115 | 0109494710 |
|
||
|
||||||
|
NHM_032 | 43545746-b8ad-43a8-92b7-53637dd131d6 | 2019.7150 | 0109494647 |
|
|
NHM_404 | 5fda0cac-0a77-4ec7-a2fa-5cd529548a19 | 2019.7151 | 0109494694 |
|
||
NHM_684 (paratype) | d84c37ed-138e-4064-a11d-a11a2470dfdf | 2019.7152 | 0109494698 |
|
||
|
||||||
|
||||||
NHM_823 (holotype) | 74781dbb-1f65-4839-a766-24d6cde63ed0 | 2019.7153 | 0109494676 |
|
||
NHM_1423 (paratype) | d949e987-6e03-4092-8492-c51dd7fcf4d7 | 2019.7154 | 0109494681 |
|
||
NHM_1895 | 02aaa9c0-837a-4836-8b34-5e68296c958e | 2019.7155 | 0109494643 |
|
||
NHM_773A (paratype) | 4b673a6a-9090-4c24-a4eb-231190507b60 | 2019.7156 | 0109494629 |
|
||
|
||||||
|
||||||
NHM_1454 (holotype) | 67d3f58a-9c13-423e-93b7-3ddcf98a361e | 2019.7157 | 0109494662 |
|
||
NHM_1480J | d47f17aa-c0c1-44f0-a448-d3f3c395fc47 | 2019.7158 | 0109494633 |
|
||
NHM_1665 (paratype) | eca166ae-3fe0-4367-860f-08c7410165dd | 2019.7159 | 0109494661 |
|
||
|
||||||
NHM_822 (holotype) | dde1c8f9-f87a-430b-be9d-5e34685772bb | 2019.7160 | 0109494667 |
|
||
|
||||||
NHM_2308 | 7b9d4ab8-4b7b-45c4-9cf4-6fd6b1229f48 | 2019.7161 | 0109494623 |
|
||
|
NHM_140 (paratype) | ed10356b-32a0-4b45-9fe3-c56fbc696e87 | 2019.7162 | 0109494719 |
|
|
|
||||||
NHM_188 | c8a0ef70-e7f7-4605-bf78-dc54ed9151eb | 2019.7170 | 0109494718 |
|
||
NHM_241 | 5c0ac0b7-60cc-473e-a23b-2f49a40540f4 | 2019.7163 | 0109494648 |
|
||
NHM_356 | 8d2cbf0e-6522-403d-a58a-905fb13c70d6 | 2019.7164 | 0109494697 |
|
||
NHM_364 | ef6e520f-7ef5-4ff9-87b5-985b8576271f | 2019.7165 | 0109494673 |
|
||
NHM_748B (paratype) | db527676-1030-4bf0-b28d-2382825bc6bf | 2019.7166 | 0109494654 |
|
||
NHM_753 | 393203b1-cb80-4185-9e40-fca6e1b6fe34 | 2019.7167 | 0109494715 |
|
||
NHM_760 | d3e8ec3c-d7f3-4908-b315-84f3758aecc1 | 2019.7168 | 0109494691 |
|
||
NHM_792 | 5d30a61b-5894-484f-b79a-df1cd4268ec1 | 2019.7169 | 0109494641 |
|
||
NHM_909 (paratype) | 5f570dab-4b56-4f74-b126-ed6ceab344e3 | 2019.7171 | 0109494670 |
|
||
NHM_970 | 4ccb364c-35f4-458c-9c71-6f77e71493ca | 2019.7172 | 0109494703 |
|
||
NHM_1097 | 939ba16d-b844-49ca-a740-bb42f039cc11 | 2019.7173 | 0109494625 |
|
||
NHM_1310 | 16844478-de27-448c-9acb-057835026447 | 2019.7174 | 0109494690 |
|
||
NHM_1311 | 192cbbb3-680b-4bcd-9cc4-a420f42af578 | 2019.7175 | 0109494700 |
|
||
NHM_1431 (holotype) | fd6bab0e-0cda-4b42-808f-a6006d409535 | 2019.7176 | 0109494211 |
|
||
NHM_1543 (paratype) | c78cc5fd-ca98-43b0-a0fb-8804fb606c71 | 2019.7177 | 0109494628 |
|
||
|
NHM_1873 | 24409a12-2a50-4689-80dc-902cdeb5af69 | 2019.7178 | 0109494642 |
|
|
NHM_1883 | 9e8c22f7-a94b-45ed-a1d0-cae287a7ac2d | 2019.7179 | 0109494666 |
|
||
NHM_1911 | 489dd5a6-2c68-416b-9a06-ed773d4791d6 | 2019.7180 | 0109494632 |
|
||
NHM_2019 | 2684a5f8-b4d4-4bcb-b386-65775506cf87 | 2019.7181 | 0109494659 |
|
||
NHM_2024 | cf54f81e-5836-4684-94dc-151f589ebab4 | 2019.7182 | 0109494653 |
|
||
NHM_1244 | f6906eae-67ec-4d37-83c6-590f3c53df76 | 2019.7183 | 0109494714 |
|
||
NHM_1863 | fa708aca-6dd1-4b53-8d54-c76a93f43363 | 2019.7184 | 0109494652 |
|
||
|
At least two species were recognised in the UKSR material, five poorly preserved representatives of a species in the diverse genus
NHM_613 NHMUK ANEA 2019.7105, coll. 17 Feb. 2015,
Species represented by one anterior fragment and one body fragment only. Specimen NHM_1486 posteriorly incomplete, 8 mm long and 0.6 mm wide for about 22 chaetigers (posterior part of fragment is damaged). Preserved specimens creamy white in ethanol (Fig.
Prostomium conical, anteriorly broadly rounded, slightly longer than wide (Fig.
Chaetigers 1–10 (= thorax) with capillaries only. First chaetiger with chaetae in notopodia only, subsequent nine chaetigers with chaetae in both noto- and neuropodia. All thoracic chaetae slender, bilimbate capillaries (Fig.
Chaetigers 11–12 are considered transitional between thorax and abdomen marked by appearance of hooded hooks only in neuropodia, but segments are of similar thickness to those in anterior part of body (Fig.
Abdominal segments enlarged (inflated), without lobe (Fig.
Prostomium, chaetigers 4–6 and abdominal chaetigers do not stain (or at best stain very lightly). Peristomium, chaetigers 1–3 and 7–12/13 stain more strongly (Fig.
GenBank
This species is unusual amongst
Found in the eastern polymetallic nodule province of the CCZ.
NHM_162 NHMUK ANEA 2019.7100, coll. 13 Oct. 2013,
All specimens short anterior fragments, posteriorly incomplete with thorax only or thorax and 2–5 abdominal segments only. Small species, 2–4 mm long and 0.3–0.8 mm wide for 11–16 chaetigers. Preserved specimens creamy white in ethanol; live specimens white to light brown semi-opaque/translucent. Epithelium of peristomium and first two chaetigers smooth or at best weakly annulated, on chaetigers 3–11 epithelium tessellated, distinctly bi-annulated (Fig.
Prostomium low, rounded mound (Fig.
Thorax with 11 chaetigers, first with notochaetae only. All thoracic chaetae long, slender, bilimbate capillaries (Fig.
Abdominal segments with hooded hooks only in both rami. Noto- and neuropodia free laterally, notopodia widely separated dorsally. Abdominal notopodia coalesce into lobe, which protrudes from dorsum (Fig.
Anterior fragment with 13 chaetigers staining more or less uniformly; more pronounced in chaetigers 6–11 (Fig.
GenBank
Phylogenetic analysis of
This species is consistent with the genus
Found in the eastern polymetallic nodule province of the CCZ.
Due to their simple morphology, there is much confusion in the taxonomic literature dealing with
Unfortunately, the ABYSSLINE material provides very few specimens (often just one) per species, which complicates the morphological interpretation. Nevertheless, in combination with DNA data, we believe it is important to provide the currently best possible morphology, which can be amended as more and better-preserved examples become available in the future. As a result, only 8 out of 15 opheliid species found in the ABYSSLINE material are here formally described. Morphologically, the ABYSSLINE material can be assigned to two known genera,
The confused taxonomic history of
As a taxonomic revision is beyond the scope of this study, we follow the definition of
Body long and thin, with ventral groove along whole length of body. Prostomium bluntly rounded to conical with small palpode, peristomium indistinct. Eyes absent. Parapodia embedded into lateral groove in median region, becoming more distinct in posterior region. Parapodia with branchiae in third quarter of body. All chaetae simple. Branchiae flat, wide at base, tapering to top. Anal tube present.
Several morphotypes with branchiae restricted to the posterior part of the body were encountered in the UKSR material, which is consistent with genus
Additionally,
Our molecular analysis revealed the presence of four distinct CCZ species, forming a well-supported clade. Three of those species (
NHM_1166C NHMUK ANEA 2019.7109, coll. 26 Feb. 2015,
Pacific Ocean, CCZ,
This is a small to medium-sized species (6–16 mm long), represented by four specimens. NHM_1250 and NHM_1871 are complete specimens in good condition 12 mm long and 0.8 mm wide for 38 chaetigers and 16 mm long and about 1 mm wide respectively for 38 chaetigers. NHM_1166C and NHM_1949 are complete, but much smaller specimens in poor condition, 6–7mm long, with mid-body region twisted and damaged, therefore the exact number of chaetigers cannot be established, but at least 34 chaetigers observed in both specimens.
Body cylindrical, iridescent and smooth, no annulation detectable. Ventral groove along the entire body length. Preserved specimen pale yellow in ethanol (Fig.
Prostomium conical with distinct, slightly elongated palpode (NHM_1871, NHM_1166C) (Fig.
Branchiae present, but limited to posterior region only, where at least 10 or 11 pairs present in chaetigers 22(23)–32, but only seven pairs were observed in smaller specimens (NHM_1166C and NHM_1949). All branchiae cirriform; first two pairs observed in NHM_1781 reduced in size, with the first pair (ch. 22) smallest (Fig.
Parapodia distinct, biramous; observed as broad lobes in chaetigers 1–5 (Fig.
Anal tube the length of about half of the length of abranchiate posterior region, elongated, cylindrical; distal end with circlet of about four tightly packed cushion-like pads and thickened ventral pad observed in specimen NHM_1250 (damaged in other specimens) (Fig.
GenBank
Posterior distribution of branchiae and variously preserved cylindrical tube was observed in all specimens examined, irrespective of their size. These specimens represent one of several species consistent with genus
Found in the eastern part of polymetallic nodule province in the CCZ.
Named in honor of Edward Keenan, boatswain onboard RV Melville on the AB01 ABYSSLINE cruise in 2013.
NHM_254 (
Pacific Ocean, CCZ,
This species is represented by a single specimen in very good condition, although now split into two fragments, following tissues sampling for molecular analysis. Specimen (when complete) 31 mm long and 1.5 mm wide for 36 chaetigers. Body cylindrical, iridescent and smooth, no annulation detectable (Fig.
Prostomium of preserved specimen oval and broad (about as long as wide) and anteriorly blunt, somewhat truncated and bearing very distinct short, button-like palpode (Fig.
Branchiae present, but limited to posterior region only, where present in chaetigers 22–28, seven pairs. All branchiae cirriform, of similar length, with red pigment in live specimen (Fig.
Parapodia distinct, biramous; observed as a broad lobe in chaetigers 1–7 (Fig.
Posterior achateous end (it is unclear if it represents anal tube) the length of two posterior chaetigers, a funnel-shaped structure with broad distal opening, distal margin smooth (Fig.
Ovigerous specimen with eggs of 200–250 µm in size clearly observed in mid through to posterior part of the body (Fig.
GenBank
The anal tube commonly becomes detached in opheliids and when short anal tubes have been described in the past, it is important to be mindful that the anal tube may in fact be missing. The posterior achateous end in UKSR species is rather short, but it appears to have a distinct form, and therefore we suggest it may possibly represent anal tube rather than damaged posterior end. However, other
Found in the eastern polymetallic nodule province of the CCZ.
Named in honor of Oliver Kersten, member of the science party of both ABYSSLINE cruises.
NHM_1653 NHMUK ANEA 2019.7108, coll. 10 Mar. 2015,
This small species is represented by a single complete specimen in reasonable condition, except for some damage to anal tube (Fig.
Prostomium conical (longer than wide) anteriorly tapering into blunt tip and bearing very distinct, round palpode (Fig.
Branchiae present, but limited to posterior region only, where present in chaetigers 22–28, seven pairs. All branchiae cirriform; large, of similar length except for the last branchial pair, which is reduced (Fig.
Parapodia distinct, biramous; observed as a small lobe in chaetigers 1–7, becoming smaller in subsequent chaetigers; parapodia embedded in distinct lateral grooves (Fig.
Anal tube the length of three posterior chaetigers (Fig.
GenBank
This is another species with branchiae limited to the posterior end consistent with the genus
Found in polymetallic nodule province.
NHM_2114 NHMUK ANEA 2019.7113, coll. 20 Mar. 2015,
Single, minute, damaged specimen; now with posterior part of the body removed for molecular analysis. Anterior fragment 1.6 mm long 0.2 mm wide for about 16 chaetigers (chaetae observed on only 11 of these, the rest of the fragment damaged with chaetae missing). Ventral groove along the entire length of the fragment. First six chaetigers crowded. Preserved specimens pale yellow in ethanol; live specimen translucent with orange gut (Fig.
Upon collection the live specimen was imaged and appears to be complete. Presence and distribution of branchiae cannot be established from the image. The anal tube was probably missing upon collection of the specimen.
GenBank
Although important diagnostic features cannot be fully confirmed in this specimen, in the phylogenetic tree it falls into a well-supported clade containing
The diagnosis of
Body elongate, with deep ventral groove and two lateral grooves along entire length of body. Prostomium conical, sometimes with terminal palpode; eyes present or absent. Branchiae present or absent; if present, beginning on chaetiger 2, continuing to posterior end, sometimes absent from middle or far posterior chaetigers; branchiae single, cirriform. Segmental lateral eyes absent. Noto- and neuropodia with small fascicles of capillary chaetae; small ventral cirrus present. Pygidium with anal funnel sometimes bearing long unpaired cirrus and additional lateral cirri.
NHM_2112 (
Pacific Ocean, CCZ,
This species is represented by a single specimen 30 mm long and 1 mm wide for 28 chaetigers.
Ventral and lateral grooves distinct along whole length of body. Colour in alcohol yellow to light tan (Fig.
Prostomium conical (longer than wide), with distinct, tear-shaped terminal palpode (Fig.
Branchiae absent. Parapodia biramous, embedded in lateral grooves; parapodia small conical lobes, best observed on anterior seven chaetigers; no distinct pre- or postchaetal lobes observed (Fig.
Chaetae all slender, smooth capillaries (Fig.
Anal tube attached; narrow and smooth; no cirri observed (Fig.
GenBank
Morphologically this species is very similar to
The main difference between
The morphologically similar species
Found in polymetallic nodule province of the eastern CCZ.
Named in honor of Cassidy Curl, Ordinary Seaman onboard RV Melville on the AB01 ABYSSLINE cruise in 2013.
NHM_245 NHMUK ANEA 2019.7140, coll. 16 Oct. 2013,
Pacific Ocean, CCZ,
Small species (4.5–8 mm long without anal tube), represented by eight specimens; all preserved specimens without anal tube (likely missing due to damage). Holotype is 7 mm long and 0.3 mm wide for 17 chaetigers. Paratypes 7–8 mm long and 0.33–0.35 mm wide for 17 chaetigers. Body cylindrical and smooth without distinct annulation. Preserved specimen yellow in ethanol (Fig.
Prostomium elongate, conical with small acute terminal palpode (Fig.
Chaetae all slender, smooth capillaries (Fig.
Branchiae absent. Anal tube not observed in preserved specimens (e.g. Fig.
GenBank
Molecular analysis of the UKSR-collected material revealed presence of three distinct small abranchiate species that morphologically resemble
Found in polymetallic nodule province of the eastern CCZ.
Named in honor of Bin Qi Gan, member of the science party of the ABYSSLINE AB02 cruise onboard the RV
NHM_1073 (
Pacific Ocean, CCZ,
This species is represented by a single specimen 17 mm long and 0.5 mm wide for 29 chaetigers. Ventral and lateral grooves distinct along whole length of body. Live specimens translucent, with orange-red gut (Fig.
Prostomium conical (longer than wide), with distinct, tear-shaped terminal palpode (Fig.
Branchiae absent. Parapodia biramous, embedded in lateral grooves; parapodia small conical lobes, best observed on anterior seven chaetigers (Fig.
Anal tube attached; narrow, cylindrical structure, symmetrical, smooth (no cirri observed) and distally slightly narrowing (Fig.
GenBank
Morphologically similar to
Found in polymetallic nodule province of the eastern CCZ.
Named in honor of Bob Juhazi, Oiler onboard RV
NHM_681 (
Pacific Ocean, CCZ,
This is a medium-sized species (8–14 mm long), represented by 14 specimens.
Body cylindrical, iridescent, some annulation detectable in first five to eight and last eight chaetigers, rest of body very smooth, no annulation detectable (Fig.
Prostomium of all preserved specimens oval and broad (about as long as wide) and anteriorly bluntly rounded, somewhat truncated; bearing very distinct palpode, mostly short button-like sometimes distinctly bi-articulated with distal article oval in specimen NHM_2116 (Figs
Branchiae present, with disjointed distribution in anterior and posterior chaetigers only, absent in mid-body chaetigers. Six very small (easily overlooked) branchial pairs observed consistently in chaetigers 2–7, with those on chaetigers 3–5 slightly longest. The number of attached posterior branchial pairs observed varied from one to eight pairs, with the most complete set observed in NHM_883 and NHM_1766, where eight pairs present in chaetigers 24–31 (the last chaetiger); first posterior pair small (1/2 the length of the subsequent pairs), others very long and robust in NHM_883, but all branchiae large in NHM_1766. All branchiae cirriform (Figs
Parapodia distinct, biramous; well developed in anterior part of the body, then becoming smaller in subsequent chaetigers. Parapodia with short rounded dorsal cirrus present; provided with a tongue-shaped lobe bearing lateral organs (observable under SEM) (Fig.
Anal tube best preserved in specimen NHM_1766; anal tube relatively short (about the length of two posterior chaetigers) and thick distally asymmetrical with dorsal margin slightly longer than ventral one; distally with several short cirri, particularly on dorsal margin (Fig.
Holotype ovigerous, with eggs of roughly 100 mm size clearly observed in mid through to posterior part of the body (Fig.
This species is represented by the greatest number of specimens (
GenBank
This species superficially resembles
Of the known
Found in polymetallic nodule province of the eastern CCZ. This species is represented by 13 sequenced specimens, with potentially another 28 specimens available in material that has not been sequenced yet, making it the most abundant opheliid species in the UKSR samples.
Named in honor of Pedro Martinez Arbizu, member of the science party of the first ABYSSLINE cruise.
NHM_1241(
Pacific Ocean, CCZ,
This is a medium-sized species represented by a single specimen. Body cylindrical, iridescent, some annulation detectable in first five and few posterior chaetigers, the rest of body smooth, no annulation detectable (Fig.
Prostomium of preserved specimen oval and broad (about as long as wide) and anteriorly bluntly rounded, somewhat truncated; bearing very distinct oval palpode (Fig.
Branchiae present in all chaetigers, except for first chaetiger; branchiae remain attached in most chaetigers, including ch. 29, but are occasionally missing (lost) in some chaetigers. Branchiae easy to detect, although rather slender, best observed in anterior chaetigers (Fig.
Parapodia distinct, biramous; with a broad lobe in chaetigers 2–10, becoming smaller in subsequent chaetigers; parapodia embedded in distinct lateral grooves (Fig.
Anal tube well preserved; relatively short (about the length of two posterior chaetigers) and thick; distally symmetrical; distal opening with circlet of about 20 short, slender cirri with the exception of ventral part of the margin, which is smooth; ventral cirrus not observed (Fig.
GenBank
Similar to
Found in polymetallic nodule province of the eastern CCZ.
Named in honor of Kirstin Meyer-Kaiser, member of the science party onboard RV
NHM_683 (
Pacific Ocean, CCZ,
This species is represented by five complete specimens, none in an excellent condition, anal tube damaged and not clearly observed. However, images of live specimens are available to observe some now missing or damaged features such as anal tube.
Small to medium-sized species 9–14 mm long and 0.25–0.8 mm wide, for 33 chaetigers. Body cylindrical and smooth without distinct annulation. Preserved specimen yellow semi-translucent, iridescent in ethanol (Fig.
Prostomium of preserved specimen conical (longer than wide), anteriorly pointed and extending into very long, thick palpode (Fig.
Branchiae observed in anterior chaetigers only, some missing (broken off), present from chaetigers 4–9 (Fig.
Parapodia biramous, embedded in lateral grooves; observed as distinct conical lobes throughout the body (Fig.
Anal tube attached (in holotype, NHM_783F and NHM_1309A), but now poorly preserved and variably damaged, always separated from the rest of the body by a shallow constriction (Fig.
In addition to the material examined here, several more specimens consistent with this species have been found, but no DNA sequencing has been carried out on these and thus they are not included in this manuscript. Where the anal tube was observed, it is scoop-shaped, but the preservation of cirri is variable. In some specimens, short slender cirri can be detected on the lateral margins of the anal tube. Chaetiger counts consistent with 33 chaetigers. Branchiae were consistently observed on chaetigers 4–9. However, in the absence of DNA data we are reluctant to ascribe these specimens formally to
GenBank
Other than sp. NHM_1068 (see Remarks under sp. NHM_1068), the DNA suggest similarity of
The first occurrence of branchiae from chaetiger 4 is very unusual in
Found in polymetallic nodule province of the eastern CCZ.
Named in honor of Clifton Nunnally, member of the science party of both the ABYSSLINE cruises.
Three small, abranchiate morphospecies found in the UKSR material,
Such confused taxonomic history is further complicated by the fact that published (
The anal tube, an important feature upon which opheliid species have been differentiated in the past is mostly missing in these morphotypes even where hundreds of specimens are available (Neal pers. obs.). Where the anal tube has been observed (
Clearly, additional morphological characters are needed to distinguish small abranchiate species currently lumped under
NHM_1769 NHMUK ANEA 2019.7148, coll. 11 Mar. 2015,
This species is represented by a single specimen, in reasonable condition, but anal tube is missing. Small species, 5.3 mm long and 0.3 mm wide; the exact number of chaetigers is difficult to establish, but at least 16 counted, although 17 may be present.
Body cylindrical and smooth without distinct annulation (Fig.
Prostomium elongate, conical with small acute terminal palpode (Fig.
Chaetae all slender, smooth capillaries (Fig.
Branchiae absent. Anal tube not observed. Shirlastained specimens without distinct pattern (Fig.
GenBank
Please refer to section “General comments on
This species is represented by a single specimen, in reasonable condition, but anal tube is missing. Small species, 4 mm long and 0.35 mm wide; exact number of chaetigers difficult to establish, but at least 17 counted, although 18 may be present.
Body cylindrical and smooth without distinct annulation (Fig.
Prostomium elongate, conical with small acute terminal palpode (Fig.
Chaetae all slender, smooth capillaries (Fig.
Branchiae absent. Anal tube not observed. Shirlastained specimens with wide, dark red, strongly stained stripe on the dorsum (Fig.
GenBank
Please refer to section “General comments on O
NHM_689 NHMUK ANEA 2019.7114, coll. 20 Feb. 2015,
This species is represented by a single specimen in poor condition, with anal tube and most of branchiae missing. Posteriorly incomplete specimen 4.7 mm long and 0.35 mm wide for at least 22 chaetigers (exact number of chaetigers is difficult to count in places). Body cylindrical and smooth without distinct annulation (Fig.
Prostomium of preserved specimen conical, broad (only slightly longer than wide), anteriorly bluntly rounded (but prostomium appears damaged) (Fig.
Branchiae present, but many are likely missing. Branchiae observed in chaetigers 2–4 (Fig.
Parapodia distinct, biramous; embedded in lateral grooves (Fig.
GenBank
Due to the condition of the single specimen representing this morphospecies, important diagnostic characters such as the structure of the anal tube and distribution of the branchiae cannot be determined. See Remarks under
NHM_1068 NHMUK ANEA 2019.7138, coll. 26 Feb. 2015,
This species is represented by two specimens, both in poor condition; specimen NHM_1874 posteriorly incomplete, specimen NHM_1068 mostly complete, but anal tube damaged. Large species 25–30 mm long and 0.8 mm wide, for minimum of 30 chaetigers (exact number of chaetigers cannot be established). Body cylindrical and smooth without distinct annulation (Fig.
Prostomium of preserved specimen conical (longer than wide), anteriorly pointed and extending into very large and long thick palpode (Fig.
Parapodia biramous, embedded in lateral grooves; parapodia small conical lobes, no distinct pre- or postchaetal lobes observed (Fig.
Anal tube missing in specimen NHM_1874; damaged in NHM_1068, but probably scooped-shaped (Fig.
GenBank
According to our molecular results, this species forms a clade with
NHM_1331 NHMUK ANEA 2019.7115, coll. 01 Mar. 2015,
This species is represented by a single complete specimen in relatively good condition. Specimen about 4.5 mm long and 0.5 mm wide for about 28 chaetigers. Body cylindrical and smooth with some annulation detectable (Fig.
Prostomium of preserved specimen conical, broad (only slightly longer than wide) and anteriorly bluntly rounded; palpode not observed (Fig.
Branchiae present; with disjointed distribution, with three pairs on chaetigers 2–4 (Fig.
Parapodia distinct, biramous; embedded in lateral grooves on chaetigers 1–24; no distinct pre- or postchaetal lobes. Chaetae are capillaries only; all very long but longest on chaetiger 1 where they are nearly twice the length of chaetae of subsequent chaetigers.
Anal tube attached, but not well preserved; cylindrical; appears distally asymmetrical with dorsal lobe overlapping the ventral lobe (but this may be an artefact of poor preservation) (Fig.
GenBank
Phylogenetic analysis of
Morphologically,
Of known species of
The lack of branchiae in midbody has been described in some of these species, but for
The family
The characters used to differentiate genera are the prostomial shape, presence and development of branchiae, presence of spines in anterior notopodia (and sometimes also in neuropodia), presence and development of branchiae and development of dorsal and ventral cirri, particularly in posterior part of the body (e.g.
Although
The diagnosis of
Body elongate and arenicoliform. Prostomium T-shaped with two prominent frontal horns. Eyes present or absent, nuchal organs present. Peristomium achaetous, surrounding prostomium dorsally and forming upper and lower lips of mouth ventrally. Branchiae absent. Parapodia well developed, with dorsal and ventral cirri on posterior chaetigers; interramal papillae present or absent. Large acicular spines present on anterior chaetigers. Capillaries present in all parapodia; lyrate chaeta present. Some species with short, slender, blunt or pointed spinous chaetae anterior to capillaries of chaetigers 1, 2 or 3, representing homologues of lyrate chaetae. Pygidium with anal cirri.
NHM_032 NHMUK ANEA 2019.7150, coll. 09 Oct. 2013,
Pacific Ocean, CCZ,
Small species, represented by six specimens. Holotype posteriorly incomplete, but otherwise in good condition, 9 mm long and 1 mm wide at the widest point for 24 chaetigers; paratypes complete, 6.0–6.5 mm long and 0.5–0.7 mm wide for 26 chaetigers. Body most expanded (inflated) through chaetigers 5–9, thereafter narrowing to posterior end. Colour in alcohol creamy white, without body pigment (Fig.
Anterior body segments smooth, no obvious annulation of raised pads detected (even after staining) (Fig.
Prostomium broadly rounded anteriorly, weakly expanded laterally, narrowing posteriorly; with two short, rounded lobes (horns) emerging anterolaterally from anterior prostomial margin (Figs
Parapodia biramous; inconspicuous in chaetigers 1–7, becoming longer posteriorly and prominent from around chaetiger 14. Tiny dorsal cirri detectable from chaetigers 14 in holotype, whereas ventral cirri occur from chaetiger 15 where well developed; both cirri large on subsequent segments; conical with broad base (Fig.
Curved acicular spines present in notopodia and neuropodia on chaetigers 1–4 (Fig.
Single achaetigerous ring subsequent to the last chaetiger. Pygidium missing in holotype, but observed in paratypes; broad, triannulated, distally broadly rounded lobe; with few terminal, short anal cirri still attached in paratype NHM_684 (Fig.
Morphological variation: Some variability was noticed between different sized specimens. In the slightly bigger holotype (NHM_823) the spines can be observed on chaetigers 1–4 in both rami, and the dorsal cirri can be detected from chaetiger 14. In the smaller paratype (NHM_684), the spines cannot be unambiguously confirmed in ch. 4, particularly in neuropodia and dorsal cirrus can be detected from chaetiger 13.
GenBank
Currently, there are nine valid species assigned to the genus
More specifically,
Found in polymetallic nodule province of the eastern CCZ.
Named in honor of Madeleine Brasier, member of the science party of the ABYSSLINE AB02 cruise onboard the RV
NHM_773A (
Pacific Ocean, CCZ,
Small species, represented by four posteriorly incomplete specimens, 4–4.5 mm long and 0.4–0.7 mm wide. Holotype posteriorly incomplete, but otherwise in good condition, 4.5 mm long and 0.7 mm wide at the widest point for 18 chaetigers long fragment. Colour in alcohol creamy white, without body pigment (Fig.
Prostomium broad (wider than long), nearly oval; with two very prominent, distinctly rounded lobes (horns) emerging from anterior prostomial margin (Fig.
Parapodia biramous; inconspicuous in chaetigers 1–14, becoming conical and prominent from around chaetiger 15. Tiny dorsal cirri detectable from chaetiger 13 in holotype, whereas ventral cirri occur from chaetiger 15; both cirri best developed from chaetigers 16 and 17, remaining small and conical (less than 1/2 the size of corresponding podial lobes) (Fig.
Curved acicular spines present in notopodia only on chaetigers 1‒4 (Fig.
GenBank
The UKSR-collected species is most similar to
Comparison of
Distribution of spines in chaetigers 1–4 | Annulation of chaetigers | Appearance of podial cirri | No. of chaetigers | Presence of furcate chaetae | |
---|---|---|---|---|---|
|
In both rami | 1–2 uni-; 3–4 bi-; 5–12 or 15 quadriannulate | Chaetigers 20–22 | 43 (complete) | From chaetiger 6 |
|
In both rami | 1–4 triannulate | In posterior chaetigers, detail not given | 22+ (incomplete) | In mid and posterior chaetigers |
|
In notopodia only | Anterior quadriannulate; posterior with 5 annuli | Chaetigers 13–14 | 28 (complete) | From chaetiger 5 |
In both rami, spines hirsute | Anterior smooth, posterior quadriannulate | Chaetigers 13–15 | 26 (complete) | From chaetiger 5 | |
In notopodia only, spines hirsute, transitional in ch. 4 | Not observed | Chaetigers 13–15 | 18 (incomplete) | From chaetiger 5 | |
In both rami | Anterior smooth, midbody quadriannulate | Chaetiger 14 | 26 (incomplete) | First observed from chaetiger 11 |
Found in polymetallic nodule province of the eastern CCZ.
Named in honor of Koh Siang Tan, member of the science party of the ABYSSLINE AB02 cruise onboard the RV
NHM_822 (
Pacific Ocean, CCZ,
Large species, represented by a single, posteriorly incomplete specimen, with 26 chaetigers, 16 mm long and about 2 mm wide at widest (inflated) region (first eight chaetigers, particularly chaetigers 3–8), with another widening of the body in chaetigers 23–26, likely due to sediment ingestion. Colour in alcohol creamy white, without body pigment, live specimens semi-translucent (Fig.
Prostomium broadly rounded anteriorly, weakly expanded laterally, narrowing posteriorly; with two well-developed, anterior rounded lobes (horns) emerging from anterior prostomial margin (Fig.
Parapodia biramous; conspicuous even in anterior-most segments (Fig.
Curved acicular spines present in notopodia and neuropodia on chaetigers 1‒4. Notopodia with about 15 spines arranged in irregular row, accompanied posteriorly by single row of capillaries; neuropodial spines fewer in numbers arranged irregularly. Spines slightly curved, narrowing to slender elongated tip (Fig.
GenBank
The UKSR-collected species
Found in polymetallic nodule province of the eastern CCZ.
Named in honor of Jeremy Whaley, Able Seaman onboard RV
NHM_2308 NHMUK ANEA 2019.7161, coll. 01 Mar. 2015,
This species is represented by a single, small, posteriorly incomplete specimen, 2.5 mm long and 0.4 mm wide for about 12 chaetigers, in poor condition. Colour of preserved specimen creamy yellow (Fig.
Prostomium small, broadly rounded anteriorly, weakly expanded laterally, narrowing posteriorly; with two short, rounded lobes (horns) emerging anterolaterally from anterior prostomial margin (Fig.
Heavily curved acicular spines present in notopodia only on chaetigers 1 and 2 (Fig.
Parapodia biramous, podial lobes not developed in 12 chaetigers long fragment. Dorsal and ventral cirri not observed in 12 chaetiger long fragment. Rest of the body unknown.
GenBank
Poor preservation of mid body and missing posterior part prevents reliable identification to genus level. Observations from the anterior part (the absence of branchiae and presence of acicular spines) suggest that this may be yet another representative of genus
These distinctive, grub-like polychaetes with rugose epidermis were first described by
The higher taxonomic position of
NHM_140 (
Pacific Ocean, CCZ,
This species is represented by 21 specimens. It is a small species 1.2–7.5 mm long and 0.25–0.8 mm wide for 21–24 segments, 19 or 20 of which chaetigerous and 2–4 posterior-most achaetigerous. Preserved specimens pale yellow (Fig.
Holotype in good condition, 6 mm long and 0.8 mm wide (at the widest point). Body robust, compact, grub like, anteriorly (commonly on chaetigers 1–7) somewhat enlarged then tapering posteriorly and relatively slender. Body surface rugose, with transverse rows of small squarish lobes.
Prostomium short, smooth, conical (Fig.
Branchiae absent. Parapodia biramous, located on row with largest lobes, both rami well separated (Fig.
Pygidium short, thick (only slightly longer wide), ventrally with keel-like very thick lobe. In distal view (Fig.
Prostomium stains strongly and stain is retained even after one week. Interramal sense organs observed as darkly red stained spots (Fig.
Number of segments is slightly variably and appears to be linked to size, with the smallest specimens possessing 21 segments (19 of which chaetigerous), while the largest specimen possessed 24 segments (20 of which chaetigerous). Body shape remains mainly consistent, although some specimens were slightly thinner or thicker. Thick, keel-like ventral lobe on pygidium observed consistently, but the detection of slenderer lobes differs (probably an artefact of preservation) and some occasionally appear inflated (Fig.
Differences between the known
GenBank
Found in polymetallic nodule province of the eastern CCZ.
Named in honor of Amanda Ziegler, member of the science party of the ABYSSLINE AB02 cruise onboard the RV
NHM_1244 NHMUK ANEA 2019.7183, coll. 01 Mar. 2015,
This species is represented by two specimens only. It is a small species 5.5–6 mm long and 0.7 mm wide for 24 segments, 20 of which chaetigerous and four posterior-most achaetigerous. Preserved specimens pale yellow (Fig.
Prostomium short, smooth, conical (Fig.
Branchiae absent. Parapodia biramous, located on row with largest lobes, both rami well separated (Fig.
Pygidium very short, thick (slightly longer wide); in distal view with a tightly packed circlet of around 11 lobes (Fig.
Stain retained uniformly. Interramal sense organs observed as darkly red stained spots (Fig.
GenBank
Both UKSR-collected species are morphologically very similar, in having a similar number of segments and in being abranchiate. They can be distinguished by a suite of subtle characters, which in case of
Comparison between
Of the known species of
Phylogenetic analysis of
We have added 23 annelid species and 85 records to the total available knowledge of the benthic macrofauna of the CCZ. While this is certainly less than 10% of the estimated annelid diversity (based on the around 350 DNA-delineated species that are present in the UKSR collections), it represents a substantial increase in the published taxonomic knowledge linked to accessible voucher material, online genetic data and imagery of morphological features. Several of the taxa we report on are likely to be common and may have wide distributions across at least the eastern CCZ.
In terms of comparison to other studies, there are few sequences from just a few benthic faunal groups from the CCZ available on GenBank, for example echinoderms (Glover et al. 2016), cnidarians (
The UKSR ABYSSLINE (ABYSSal baseLINE) environmental surveys were supported by a collaborative partnership between six non-profit global academic research institutes (University of Hawaii at Manoa, Natural History Museum, NORCE Norwegian Research Centre, National Oceanography Centre, Senckenberg Institute) and through an arrangement with UKSRL. Additional support was provided by the Swedish research council FORMAS (TGD). We acknowledge Magdalena Georgieva and Madeleine Brasier from the Natural History Museum team and Swee Cheng Lim from National University of Singapore for support with sampling on board ship, and Chief Scientist Craig R. Smith for organizing. We also acknowledge the expert support from the Senckenberg Institute team in the deployment and recovery of successful Brenke Epibenthic Sledge samples. Comments from the editor and one reviewer greatly improved this manuscript. This study was made possible only by the dedicated help from the entire scientific party, the Masters and Crew of the RV