Corresponding author: Jan Klimaszewski (
Academic editor: Michael Ivie
Experimental research on beetle responses to removal of logging residues following clearcut harvesting in the boreal balsam fir forest of Quebec revealed several abundant rove beetle (Staphylinidae) species potentially important for long-term monitoring. To understand the trophic affiliations of these species in forest ecosystems, it was necessary to analyze their gut contents. We used microscopic and molecular (DNA) methods to identify the gut contents of the following rove beetles:
Rove beetles (
Rove beetles are a diverse group exhibiting a wide variety of trophic relationships and occupying numerous microhabitats in forest ecosystems. Many
In this study we use both microscopic examination and molecular analysis of gut contents to more precisely characterize the feeding habits and trophic role of 10 rove beetle species common in the boreal forest of Quebec. There are few published data on gut contents, of these species and little is known of their food affiliations, except for some general statements on habitat preferences of
Rove beetles were collected as part of a large field experiment examining the impacts of biomass harvesting on forest ecosystem functioning (
Six dried and mounted specimens of each species were selected from samples collected in 2012. Individual specimens were softened in distilled water and ammonia solution for about 15 minutes and their guts were dissected in distilled water under a stereoscopic microscope. The colon and rectum of the hindgut were transferred directly to absolute alcohol, placed on a glass slide with Canada balsam, and pressed by dissecting needles to liberate gut contents and then covered with a cover slip. Slides were studied under a compound microscope (Reichert, Vienna, Austria) and photographs were taken using an Olympus DP73 digital camera. The following publications were consulted for fungal spore illustrations:
DNA from gut contents was extracted from 10 individuals of each species of rove beetle using the QIAamp DNA Micro kit from Qiagen, according to the manufacturer’s specifications. Gut contents from the 10 individuals were pooled for DNA extraction. DNA samples were eluted from the columns in 100 µL of PCR grade nuclease-free water and the concentration was determined spectrophotometrically by reading absorbance at 260 nm and 280 nm with the Synergy Mx microplate reader (BioTek).
PCR amplifications were performed using three primers universal to the internal transcribed spacer (ITS) regions of the nuclear ribosomal repeat and used in the following combinations (ITS9mun+ITS4 or ITS5+ITS4). The detailed sequences of the primers are given in
Primers used in this study.
Primer name | Primer sequence, 5’-3’ | Primer source study |
---|---|---|
ITS9mun | TGTACACACCGCCCGTCG |
|
ITS5 | GGAAGTAAAAGTCGTAACAAGG |
|
ITS4 | TCCTCCGCTTATTGATATGC |
|
Map of ribosomal RNA genes and ITS regions.
Body images of rove beetles in dorsal view:
Body images of rove beetles in dorsal view:
The PCR reactions contained 30 ng of DNA, 2X HotStarTaq Plus Master Mix from Qiagen, which contains one unit of HotStarTaq Plus DNA Polymerase, PCR Buffer with 1.5 mM MgCl2, 200 μM of each dNTP and 0.3 μM of each primer in a 30 µL final reaction. PCR amplification was carried out using an initial denaturation step at 95°C for 15 min, followed by 35 cycles: 15s at 95°C, 30s at 52°C, 30s at 72°C, and a final extension for 10 min at 72°C. Cycling was performed on a PTC200 Peltier Thermal Cycler (MJ Research). Amplified fragments were inserted directly in the TA cloning vector (Invitrogen) and transformed into
We observed no cuticle characteristic of arthropods in the guts of any dissected individuals. The only identifiable material was yeasts and fungal spores. Through microscopic observation of spore morphology, we were unable to discriminate among the yeast species, so these were recorded simply as “yeasts” (
Distribution of yeast and spores in different rove beetle species from microscopical observation. Subfamilies are: A,
Rove beetle species | Spore Type | |||||||
---|---|---|---|---|---|---|---|---|
Yeast | 1 | 2 | 3 | 4 | 5 | 6 | 7 | |
× | ||||||||
× | ||||||||
× | ||||||||
× | × | |||||||
× | × | |||||||
× | × | |||||||
× | × | × | × | |||||
× | × | × | × | |||||
× | × | |||||||
× |
Images of hindgut content of the following rove beetle species:
Images of hindgut content of the following rove beetle species:
Images of hindgut content of the following rove beetle species:
Images of hindgut content of the following rove beetle species:
Images of hindgut content of the following rove beetle species:
Images of hindgut content of the following rove beetle species:
In total, we obtained 186 fungal and bacterial sequences from the 10 species of rove beetles, ranging from 19–33 sequences per species (
Number and identity of genetic sequences extracted from the gut contents of 10 species of
Specific taxon |
|
|
|
|
|
|
|
|
|
|
Total |
---|---|---|---|---|---|---|---|---|---|---|---|
|
|||||||||||
2 |
2 |
||||||||||
1 | 1 | ||||||||||
1 | 1 | ||||||||||
1 | 1 | ||||||||||
1 | 1 | 16 | 18 | ||||||||
12 | 8 | 12 | 14 | 5 | 9 | 4 | 20 | 8 | 92 | ||
1 | 1 | ||||||||||
1 | 1 | ||||||||||
1 | 1 | ||||||||||
1 | 1 | ||||||||||
1 | 2 | 1 | 4 | ||||||||
1 | 1 | ||||||||||
1 | 1 | ||||||||||
1 | 1 | ||||||||||
1 | 1 | ||||||||||
1 | 1 | ||||||||||
1 | 1 | ||||||||||
Uncultured fungus clone 50-p12-A5 ( |
2 | 5 | 7 | ||||||||
|
|||||||||||
Ten species from this study | 6 | 8 | 1 | 5 | 10 | 7 | 37 | ||||
|
|||||||||||
1 |
2 |
3 |
|||||||||
4 |
1 |
1 |
2 |
16 |
24 |
||||||
|
4 | 3 | 1 | 2 | 1 | 1 | 3 | 0 | 0 | 8 | 23 |
|
19 | 20 | 21 | 22 | 19 | 22 | 25 | 22 | 20 | 33 | 223 |
a Sequences with 86 to 90% sequence similarity.
b Sequences with 78 to 85% sequence similarity.
In all, we identified 17 fungal taxa in the phyla
Both dissection and molecular analysis of guts strongly suggest that rove beetles in this study may feed primarily on yeasts. Yeasts are ubiquitous (in soil, on decaying plant material including deadwood, and on berries) and they are an important part of the diet of at least some fungivorous beetle species (
With the exception of the relatively broad consumption of
The prevalence of other fungi in addition to yeasts and the presence of spores in rove beetle guts was not unexpected, as many rove beetle species are associated with fungi (
Although we isolated bacteria less commonly than fungi, we did find them in six beetle species. The second most commonly detected sequence, in fact, was from the bacterium
It is notable that no arthropod cuticle or evidence of animal DNA sequences were found in the guts of any of these species despite the fact that predation on arthropods (especially mites, springtails, and smaller insects) is common in the family (
In work conducted to characterize rove beetle responses to removal of logging residues following clearcut harvesting in boreal balsam fir forests of Quebec (
Feeding associations between rove beetles and yeasts provide some insight into potential mechanisms by which biomass harvesting may impact rove beetles. Our results may suggest that dominant rove beetles are feeding on yeasts and other fungi that may or may not be directly associated with sporocarps growing on deadwood substrates. It is important to understand the complexity of factors linking the studied beetles to biomass removal treatments. The removal of additional forest biomass may be affecting beetles not only via potential food linkages, but also by other non-trophic mechanisms such as changes in physical conditions following the removal of the forest overstory (
In addition to characterizing food sources for some abundant species of rove beetles, many of which are good ecological indicators, our work provides some possible explanations for beetle response patterns in the wake of forest disturbance. The relatively easy application of DNA sequencing to gut contents and the steadily increasing wealth of sequence data available to serve as an identification resource means that these techniques can now be readily applied in disturbance ecology research to investigate species response patterns and habitat preferences. We encourage broader use of this approach to support future work.
We are grateful to the following individuals for contributing to our research: M. Blais, G. Laflamme, P. DesRochers, and J. Bérubé (Laurentian Forestry Centre – LFC) for useful advice and reference recommendations; S. Dagnault and J. Morissette (LFC) for their help with site preparation, and casual employees R. Batista (Montreal) and A. Gilbert (Québec) for helping with site preparation and collecting and processing insect samples at the Montmorency Experimental Forest. Julie Bouliane and Patrick Pineault of Université Laval, Quebec, helped us with the logistics, site preparation and helpful advice. Pamela Cheers and Isabelle Lamarre (LFC) edited the manuscript and prepared it for publication.
Members of this genus, including
Hyperlinks for microorganism identification.
NCBI Taxonomy Browser | MycoBank | |
---|---|---|
|
||
|
||
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
||
|
|
|
|
|
|
|
|
|
|
||
|
|
|
|
||
|
||
|
|
|
|
||
|
|
|
|
|
|
|
||
|
||
|
|
|
|
|