Corresponding author: Marco Cosimo Simeone (
Academic editor: Z. T. Nagy
Since the pre-historic era, humans have been using forests as a food, drugs and handcraft reservoir. Today, the use of botanical raw material to produce pharmaceuticals, herbal remedies, teas, spirits, cosmetics, sweets, dietary supplements, special industrial compounds and crude materials constitute an important global resource in terms of healthcare and economy. In recent years, DNA barcoding has been suggested as a useful molecular technique to complement traditional taxonomic expertise for fast species identification and biodiversity inventories. In this study,
The “core barcode” for land plants (
This work illustrates current limitations in the applicability of DNA barcoding to taxonomic forest surveys. These difficulties urge for an improvement of technical protocols and an increase of the number of sequences and taxa in public databases.
Forests figure prominently among the world’s most important ecosystems. The importance of trees in sustaining biodiversity and habitat stability, as well as to provide a large variety of environmental services is well acknowledged. Nevertheless, the increasing human impact, the recent environmental decay, and the on-going climate change are among the main factors affecting forest communities, especially at local and regional scales within the Mediterranean basin (
Temperate and boreal forests are a traditional source, not only for timber, but also for many products that have been extracted from forests for millennia, including resin, tannin, fodder, litter, medical plants, fruits, nuts, roots, mushrooms, seeds, honey, ornamentals and exudates. Today there is an institutional rediscovery of the value of forest products and services other than timber, and the total value of Non-Wood Goods (NWGs) reported in Europe has almost tripled since 2007 (
Besides wood trade, Mediterranean woody flora includes numerous valuable species used as ornamentals or for secondary products processing and marketing (edibles, industrial and medicinal compounds). The option of stimulating the production of non-timber forest products has long been considered promising (
Molecular technology is considered a reliable alternative tool for the identification of plant species (e.g.
Based on the relative ease of amplification, sequencing, multi-alignment and the amount of variation displayed (sufficient to discriminate among sister species without affecting their correct assignation through intraspecific variation), three plastid loci are currently used in plants:
Tree taxa have peculiar biological, evolutionary and taxonomic features that are likely to constitute a challenge to species recognition through DNA barcodes, viz. the generally low mutation rate of the plastid DNA, their ability to hybridize, and their narrowly defined species limits (
Sixty eight trees belonging to 24 species (ten genera, nine families) were sampled in the wild (Italy, Greece and adjacent areas) and/or Botanic Gardens (
Sample list.
Familia | Species | Relevance | No. of samples |
---|---|---|---|
|
|
Ornamental/afforestation | 3 |
|
Ornamental/afforestation | 3 | |
|
Ornamental/afforestation/conservation | 3 | |
|
|
Medicinal/ornamental | 3 |
|
Medicinal/ornamental | 2 | |
|
Food industry/conservation | 4 | |
|
/ | 3 | |
|
Ornamental/conservation | 2 | |
|
Medicinal/food industry | 3 | |
|
Valuable wood industry | 3 | |
|
|
Medicinal/ornamental | 3 |
|
/ | 3 | |
|
|
Medicinal/food industry | 5 |
|
/ | 3 | |
|
/ | 2 | |
|
|
Medicinal | 5 |
|
/ | 2 | |
|
/ | 1 | |
|
|
Medicinal/ornamental | 2 |
|
Food industry | 1 | |
|
|
Medicinal/food industry/ornamental | 4 |
|
|
Medicinal/food industry | 3 |
|
|
Medicinal/ornamental/conservation | 4 |
|
/ | 1 |
DNA extractions were performed with the DNeasy Plant Minikit (QIAGEN), following the manufacturer’s instructions. The universal applicability of the technical analyses was considered a prerequisite for exploring the DNA barcoding potential in a practical floristic case study: uniform PCR procedures were thus performed for all taxa and barcoding loci. Genomic DNAs (ca. 40 ng) were amplified with RTG PCR beads (GE Healthcare) in 25 μl final volume according to the manufacturer’s protocol. Thermocycling conditions were as follows: 94 °C for 3 min, followed by 35 cycles of 94 °C for 30 s, 53 °C for 40 s and 72 °C for 40 s, with a final extension step of 10 min at 72 °C. Primers for the investigated barcoding region are shown in
Primers list.
Marker region | Primers | Reference |
---|---|---|
|
Fw - ATGTCACCACAAACAGAAAC | Kress et al. (2005) |
Rev - TCGCATGTACCTGCAGTAGC | ||
|
Fw - CGCGCATGGTGGATTCACAATCC | Shaw et al. (2007) |
Rev - GTTATGCATGAACGTAATGCTC | ||
|
Fw - CGTACAGTACTTTTGTGTTTACGAG | Kim (unpublished) |
Rev - ACCCAGTCCATCTAAATCTTGGTTC | ||
|
Fw - GAACTCGTCGGATGGAGTG |
|
Rev - TAAACGATCCTCTCATTCACGA |
Sequences were aligned with MEGA5 (
Species discrimination power of the investigated loci was also assessed using the genetic distance approach, to evaluate whether the amount of variation displayed was sufficient to discriminate sister species without affecting their correct assignation through intraspecific variation. This approach is at the basis of the “barcoding gap” definition, i.e. the assumption that the amount of sequence divergence within species is smaller than that between species. Uncorrected p-distance matrices of sequence divergences within and among congeneric species were calculated for each gene fragment and for the two joined markers (
Finally, we simulated a barcode identification scenario using each sequence as an unknown query and GenBank (
Optimal amplification rates were obtained with
The alignment–free method implemented in BLUSTClust produced for each marker the haplotypes shown in
Haplotypes generated by BLASTClust in the investigated dataset with both markers and their combination. Shaded: species where unique haplotypes (either single or in combination) were detected.
Species | Samples | Unique haplotypes | Inter-species shared haplotypes | ||||
---|---|---|---|---|---|---|---|
trnH-psbA | Combined | trnH-psbA | Combined | ||||
|
3 | 2 | 2 | 2 | / | / | / |
|
3 | 1 | 1 | 1 | / | / | / |
|
3 | 1 | 1 | 1 | / | / | / |
|
3 | / | / | / | 1 | 1 | 1 |
|
2 | / | 1 | 1 | 1 | 1 | 1 |
|
4 | / | 2 | 2 | 1 | / | / |
|
3 | 1 | 3 | 3 | / | / | / |
|
2 | 1 | 1 | 1 | 1 | 1 | 1 |
|
3 | / | 1 | 1 | 1 | 1 | 1 |
|
3 | 1 | 1 | 1 | / | / | / |
|
3 | 1 | 2 | 2 | / | / | / |
|
3 | 1 | 3 | 3 | / | / | / |
|
5 | 2 | 4 | 5 | 1 | / | / |
|
3 | / | 1 | 1 | 1 | 1 | 1 |
|
2 | / | / | / | 1 | 1 | 1 |
|
5 | 1 | 4 | 4 | 1 | / | / |
|
2 | 1 | 2 | 2 | 1 | / | / |
|
1 | 1 | 1 | 1 | / | / | / |
|
2 | 2 | 2 | 2 | / | / | / |
|
1 | 1 | 1 | 1 | / | / | / |
|
4 | 1 | 1 | 1 | n.d. | n.d. | n.d. |
|
3 | 1 | 1 | 1 | n.d. | n.d. | n.d. |
|
4 | / | / | / | 1 | 1 | 1 |
|
1 | / | / | / | 1 | 1 | 1 |
|
|
|
|
|
|
|
|
In this study, the two potential DNA barcodes displayed different levels of intra- and inter-specific distances. With
The values of the maximum intra- and minimum interspecific sequence divergence of the two combined barcoding loci are shown in
Values of maximum inter- and minimum intraspecific uncorrected p-genetic distances resulting from the combination of
Samples | Max. Intrasp. distance | Min Intersp. distance | Barcoding gap | |
---|---|---|---|---|
|
3 | 0.0015 | 0.0015 | 0 |
|
3 | 0 | 0.0015 | 0.0015 |
|
3 | 0 | 0.0023 | 0.0023 |
|
3 | 0.002898554 | 0.000950571 | -0.0019 |
|
2 | 0.0058 | 0 | -0.0058 |
|
3 | 0.0009 | 0 | -0.0009 |
|
3 | 0 | 0.0009 | 0.0009 |
|
3 | 0.0009 | 0 | -0.0009 |
|
2 | 0.0019 | 0 | -0.0019 |
|
4 | 0 | 0 | 0 |
|
3 | 0 | 0.0064 | 0.0064 |
|
3 | 0 | 0.0064 | 0.0064 |
|
5 | 0.00568 | 0.00284 | -0.0028 |
|
3 | 0.0036 | 0 | -0.0036 |
|
2 | 0 | 0 | 0 |
|
5 | 0.0017 | 0 | -0.0017 |
|
2 | 0.0101 | 0 | -0.0101 |
1 | n.d. | 0.0142 | n.d. | |
|
2 | 0.02397 | 0.01588 | -0.0081 |
1 | n.d. | 0.0158 | n.d. | |
4 | 0 | n.d. | n.d. | |
3 | 0 | n.d. | n.d. | |
|
4 | 0 | 0 | 0 |
1 | n.d. | 0 | n.d. |
The NCBI Taxonomy database screening revealed that all the species in our dataset were represented by
When BLASTed to GenBank, all our
TrnH-psbA was outperformed by
Summary of the species identification success achieved with
Species | Identification success | ||
---|---|---|---|
Haplotype specificity | Min. inter- > max. intraspecific distance | GenBank correct match | |
|
|
- |
|
|
|
|
|
|
|
|
|
|
- | - | - |
|
- | - | - |
|
|
- |
|
|
|
- | - |
|
- | - | - |
|
- | - |
|
|
|
|
|
|
|
|
- |
|
|
|
|
|
|
- |
|
|
- | - | - |
|
- | - | - |
|
|
- |
|
|
|
- | - |
|
|
n.d. |
|
|
|
- |
|
|
|
n.d. |
|
|
|
n.d. |
|
|
|
n.d. |
|
|
- | - |
|
|
- | n.d. | - |
|
|
|
|
In our dataset, the
In contrast, trnH–psbA provided better discrimination than
The BLUSTClust analysis yielded a 66.7% species discrimination, which is a bit lower but still in line with the general limit acknowledged for land plants when markers from a single genetic linkage group are used (ca. 70%;
The highest identification success was achieved with the analysis based on the uniqueness of sequence character states, where some parts in the haplotypes (especially some trnH-psbA indels) appeared diagnostics for certain species. However, more data are required to confirm these diagnostic sequence features. Yet, if confirmed, these features may be important in view of the generally low interspecific divergences we observed. Conversely, the analysis with the barcoding gaps suggests that such a discrimination approach may yield a lower efficiency, at least with trnH-psbA, since the uncorrected p-distance analysis removed all indels. A further complication we encountered was constituted by the high intraspecific divergences (e.g. in
DNA barcoding is a substantial improvement of our capacity to document the existing biodiversity. It is also a powerful research complement for human socio-economics, safety, trade control, frauds discovery and detection of forgeries in plant commercial products (
The Mediterranean woody flora comprises numerous valuable species used as ornamentals or for secondary products processing and marketing (edibles, essential oils, medicinal compounds). Field identification, authentication and certification of germplasm and raw materials are a major concern. As such, our results on
On the other hand, we confirm the difficulties previously encountered in barcoding
Recently, an outstanding research interest towards DNA barcoding of regional floras with biological and/or economical relevance has spread. In the present work, we lay the foundations towards DNA barcoding applications of important woody plant genera in the Mediterranean basin, such as