Corresponding author: Łukasz Kaczmarek (
Academic editor: S. McInnes
The knowledge of the diversity and distribution of tardigrades on Madagascar is rather poor. To date, only 13 tardigrade taxa have been reported from this region (including one
Kaczmarek Ł, Grobys D, Kulpa A, Bartylak T, Kmita H, Kepel M, Kepel A, Roszkowska M (2019) Two new species of the genus
Madagascar stretches from ~12° to ~26°S latitude on the Indian Ocean, more than 400 km east of Africa. With an area of ca. 590,000 km2, Madagascar is the world’s fourth largest island; however, it is sometimes considered a microcontinent due to its geological and biological history. First, it separated from Gondwana as part of East Gondwana, comprising the Antarctic, Madagascar, Indian, and Australian plates. After several subsequent breakups, it finally separated from the Seychelles and India ca. 66–90 My ago (
The area studied is located in south-central Madagascar (approximately
The phylum
Species of the genus
Two moss and lichen samples from tree and rocks were collected in the Ivohibory forest on June 4, 2017 (permits No 122/17/MEEF/SG/DGF/DSAP/SCB.Re and 150N-EV06/MG17). The samples were packed in paper envelopes, dried at a temperature of ca. 30 °C and delivered to the laboratory at the Faculty of Biology, Adam Mickiewicz University, Poznań, Poland. Tardigrades were extracted from the samples and studied following the protocol of
Specimens for light microscopy were mounted on microscope slides in a small drop of Hoyer’s medium, prepared according to
All figures were assembled in Corel Photo-Paint 2017. For deep structures that could not be fully focused in a single photograph, a series of 2–10 images were taken every ca. 0.5 μm and then manually assembled into a single deep-focus image in Corel Photo-Paint 2017.
All measurements are given in micrometres [μm]. Structures were measured only if their orientation was suitable. Body length was measured from the anterior extremity to the end of the body, excluding the hind legs. All measurements (except buccal tube width) followed protocols in
Morphometric data were handled using the “Apochela” ver. 1.1 template available from the Tardigrada Register (
Species were identified using the key in
All specimens were preliminarily identified using light microscopy (
Primers used for amplification and sequencing of DNA fragments.
DNA fragment | Direction | Code | Sequence (5’-3’) | Reference |
---|---|---|---|---|
|
Forvard | bcdF01 | CATTTTCHACTAAYCATAARGATATTGG |
|
Reverse | bcdR04 | TATAAACYTCDGGATGNCCAAAAAA |
|
|
ITS-2 | Forvard | ITS2_Eutar_Ff | CGTAACGTGAATTGCAGGAC |
|
Reverse | ITS2_Eutar_Rr | TGATATGCTTAAGTTCAGCGG | ||
28S rRNA | Forvard | 28SF0001 | ACCCVCYNAATTTAAGCATAT |
|
Reverse | 28SR0990 | CCTTGGTCCGTGTTTCAAGAC |
Component | Concentration | Additional note |
---|---|---|
H2O | – | sterile MQ |
buffer | 1× | 5X Phusion HF Buffer; Thermo Scientific |
dNTPs | 200 µM | dNTP Mix; Thermo Scientific |
forward primer | 0.5 µM | – |
reverse primer | 0.5 µM | – |
polymerase | 0.02 U/µl | Phusion High-Fidelity DNA Polymerase; Thermo Scientific |
DNA | – | – |
Step |
|
ITS-2 and 28S rRNA | ||||
---|---|---|---|---|---|---|
Cycles | Time [min.:sec.] | Temp. [°C] | Cycles | Time [min:sec] | Temp. [°C] | |
initial denaturation | – | 05:00 | 98 | – | 05:00 | 98 |
denaturation | 5 | 00:30 | 98 | – | – | – |
annealing | 00:30 | 45 | – | – | – | |
extension | 01:00 | 72 | – | – | – | |
denaturation | 30 | 00:30 | 98 | 35 | 00:30 | 98 |
annealing | 00:30 | 50 | 00:30 | 50 | ||
extension | 01:00 | 72 | 01:00 | 72 | ||
final extension | – | 07:00 | 72 | – | 07:00 | 72 |
In the first step, the sequences of
Holotype and 18 paratypes, all from sample No 139: Ivohibory forest, Madagascar, lichen sample from quartz rocks, coll. Marta Kepel and Andrzej Kepel.
The buccal apparatus of the
Measurements and
Character | N | Range | Mean |
|
Holotype | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
µm |
|
µm |
|
µm |
|
µm |
|
||||||
Body length | 6 | 630 | – | 766 | – | – | – | 691 | – | 45 | – | 766 | – |
Peribuccal papillae length | 5 | 10.0 | – | 12.0 |
|
– |
|
11.0 |
|
0.8 |
|
11.8 |
|
Lateral papillae length | 7 | 9.4 | – | 10.7 |
|
– |
|
10.0 |
|
0.4 |
|
10.3 |
|
Buccal tube | |||||||||||||
Length | 9 | 51.3 | – | 62.5 | – | – | – | 56.6 | – | 3.8 | – | 62.5 | – |
Stylet support insertion point | 9 | 34.5 | – | 42.3 |
|
– |
|
38.4 |
|
2.4 |
|
41.5 |
|
Anterior width | 9 | 25.2 | – | 35.9 |
|
– |
|
28.9 |
|
3.2 |
|
31.4 |
|
Standard width | 9 | 23.1 | – | 31.1 |
|
– |
|
26.3 |
|
2.7 |
|
29.4 |
|
Posterior width | 9 | 23.0 | – | 30.2 |
|
– |
|
25.7 |
|
2.6 |
|
28.9 |
|
Standard width/length ratio | 9 | 42% | – | 51% | – | – | – | 46% | – | 3% | – | 47% | – |
Posterior/anterior width ratio | 9 | 84% | – | 94% | – | – | – | 89% | – | 4% | – | 92% | – |
Claw 1 lengths | |||||||||||||
External primary branch | 9 | 17.2 | – | 21.8 |
|
– |
|
18.9 |
|
1.5 |
|
21.8 |
|
External base + secondary branch | 9 | 13.3 | – | 16.7 |
|
– |
|
15.0 |
|
1.2 |
|
16.6 |
|
External spur | 7 | 3.5 | – | 5.3 |
|
– |
|
4.4 |
|
0.7 |
|
? | ? |
External branches length ratio | 9 | 76% | – | 82% | – | – | – | 80% | – | 2% | – | 76% | – |
Internal primary branch | 9 | 16.0 | – | 21.1 |
|
– |
|
18.3 |
|
1.6 |
|
21.1 |
|
Internal base + secondary branch | 9 | 13.3 | – | 16.6 |
|
– |
|
14.8 |
|
1.1 |
|
16.3 |
|
Internal spur | 9 | 3.3 | – | 5.5 |
|
– |
|
4.4 |
|
0.8 |
|
5.5 |
|
Internal branches length ratio | 9 | 77% | – | 88% | – | – | – | 81% | – | 4% | – | 77% | – |
Claw 2 lengths | |||||||||||||
External primary branch | 8 | 17.4 | – | 21.2 |
|
– |
|
19.5 |
|
1.4 |
|
21.2 |
|
External base + secondary branch | 7 | 13.7 | – | 17.0 |
|
– |
|
15.0 |
|
1.1 |
|
17.0 |
|
External spur | 3 | 3.9 | – | 4.9 |
|
– |
|
4.4 |
|
0.5 |
|
4.9 |
|
External branches length ratio | 7 | 72% | – | 81% | – | – | – | 77% | – | 3% | – | 80% | – |
Internal primary branch | 8 | 16.8 | – | 20.5 |
|
– |
|
18.7 |
|
1.3 |
|
20.2 |
|
Internal base + secondary branch | 9 | 13.0 | – | 16.3 |
|
– |
|
14.7 |
|
1.1 |
|
16.3 |
|
Internal spur | 9 | 3.4 | – | 5.8 |
|
– |
|
4.4 |
|
0.8 |
|
4.7 |
|
Internal branches length ratio | 8 | 74% | – | 81% | – | – | – | 78% | – | 3% | – | 81% | – |
Claw 3 lengths | |||||||||||||
External primary branch | 5 | 19.7 | – | 21.0 |
|
– |
|
20.5 |
|
0.6 |
|
? | ? |
External base + secondary branch | 6 | 14.2 | – | 16.3 |
|
– |
|
15.4 |
|
0.7 |
|
? | ? |
External spur | 5 | 3.5 | – | 5.2 |
|
– |
|
4.4 |
|
0.7 |
|
? | ? |
External branches length ratio | 5 | 72% | – | 82% | – | – | – | 75% | – | 4% | – | ? | – |
Internal primary branch | 5 | 18.9 | – | 20.4 |
|
– |
|
19.7 |
|
0.6 |
|
? | ? |
Internal base + secondary branch | 6 | 13.7 | – | 16.0 |
|
– |
|
14.9 |
|
0.8 |
|
? | ? |
Internal spur | 5 | 3.8 | – | 5.6 |
|
– |
|
4.8 |
|
0.7 |
|
? | ? |
Internal branches length ratio | 5 | 70% | – | 79% | – | – | – | 75% | – | 4% | – | ? | – |
Claw 4 lengths | |||||||||||||
Anterior primary branch | 7 | 19.6 | – | 23.0 |
|
– |
|
20.9 |
|
1.3 |
|
23.0 |
|
Anterior base + secondary branch | 7 | 14.6 | – | 17.2 |
|
– |
|
15.8 |
|
0.9 |
|
17.2 |
|
Anterior spur | 6 | 4.1 | – | 6.3 |
|
– |
|
5.4 |
|
0.9 |
|
6.0 |
|
Anterior branches length ratio | 7 | 71% | – | 80% | – | – | – | 76% | – | 4% | – | 75% | – |
Posterior primary branch | 7 | 20.5 | – | 24.0 |
|
– |
|
21.8 |
|
1.1 |
|
24.0 |
|
Posterior base + secondary branch | 7 | 15.2 | – | 17.7 |
|
– |
|
16.1 |
|
0.8 |
|
17.7 |
|
Posterior spur | 7 | 4.4 | – | 5.8 |
|
– |
|
5.2 |
|
0.6 |
|
5.5 |
|
Posterior branches length ratio | 7 | 70% | – | 76% | – | – | – | 74% | – | 2% | – | 74% | – |
Claws of the
Measurements and
Character | N | Range | Mean |
|
|||||||
---|---|---|---|---|---|---|---|---|---|---|---|
µm |
|
µm |
|
µm |
|
||||||
Body length | 2 | 409 | – | 428 | – | – | – | 419 | – | 13 | – |
Peribuccal papillae length | 3 | 3.0 | – | 3.9 |
|
– |
|
3.5 |
|
0.5 |
|
Lateral papillae length | 3 | 5.6 | – | 6.0 |
|
– |
|
5.9 |
|
0.2 |
|
Buccal tube | |||||||||||
Length | 3 | 33.8 | – | 34.5 | – | – | – | 34.2 | – | 0.4 | – |
Stylet support insertion point | 2 | 21.2 | – | 22.3 |
|
– |
|
21.8 |
|
0.8 |
|
Anterior width | 3 | 9.4 | – | 11.2 |
|
– |
|
10.5 |
|
1.0 |
|
Standard width | 3 | 9.1 | – | 9.8 |
|
– |
|
9.5 |
|
0.4 |
|
Posterior width | 3 | 9.4 | – | 10.2 |
|
– |
|
9.8 |
|
0.4 |
|
Standard width/length ratio | 3 | 27% | – | 28% | – | – | – | 28% | – | 1% | – |
Posterior/anterior width ratio | 3 | 88% | – | 100% | – | – | – | 94% | – | 6% | – |
Claw 1 lengths | |||||||||||
External primary branch | 2 | 15.8 | – | 16.3 |
|
– |
|
16.1 |
|
0.4 |
|
External base + secondary branch | 3 | 14.1 | – | 15.0 |
|
– |
|
14.6 |
|
0.5 |
|
External spur | 2 | 3.2 | – | 3.4 |
|
– |
|
3.3 |
|
0.1 |
|
External branches length ratio | 2 | 87% | – | 94% | – | – | – | 90% | – | 5% | – |
Internal primary branch | 3 | 14.9 | – | 15.7 |
|
– |
|
15.4 |
|
0.5 |
|
Internal base + secondary branch | 3 | 14.0 | – | 14.5 |
|
– |
|
14.2 |
|
0.3 |
|
Internal spur | 3 | 3.0 | – | 3.7 |
|
– |
|
3.4 |
|
0.4 |
|
Internal branches length ratio | 3 | 89% | – | 94% | – | – | – | 92% | – | 2% | – |
Claw 2 lengths | |||||||||||
External primary branch | 2 | 16.9 | – | 17.9 |
|
– |
|
17.4 |
|
0.7 |
|
External base + secondary branch | 1 | 13.2 | – | 13.2 |
|
– |
|
13.2 |
|
? | ? |
External spur | 1 | 3.5 | – | 3.5 |
|
– |
|
3.5 |
|
? | ? |
External branches length ratio | 1 | 74% | – | 74% | – | – | – | 74% | – | ? | – |
Internal primary branch | 3 | 16.4 | – | 16.9 |
|
– |
|
16.7 |
|
0.3 |
|
Internal base + secondary branch | 2 | 12.7 | – | 12.8 |
|
– |
|
12.8 |
|
0.1 |
|
Internal spur | 2 | 3.5 | – | 5.0 |
|
– |
|
4.3 |
|
1.1 |
|
Internal branches length ratio | 2 | 75% | – | 76% | – | – | – | 76% | – | 1% | – |
Claw 3 lengths | |||||||||||
External primary branch | 3 | 16.2 | – | 17.4 |
|
– |
|
16.8 |
|
0.6 |
|
External base + secondary branch | 2 | 12.1 | – | 12.8 |
|
– |
|
12.5 |
|
0.5 |
|
External spur | 1 | 3.9 | – | 3.9 |
|
– |
|
3.9 |
|
? | ? |
External branches length ratio | 2 | 74% | – | 75% | – | – | – | 74% | – | 1% | – |
Internal primary branch | 3 | 14.8 | – | 17.0 |
|
– |
|
16.0 |
|
1.1 |
|
Internal base + secondary branch | 2 | 12.7 | – | 13.0 |
|
– |
|
12.9 |
|
0.2 |
|
Internal spur | 2 | 2.9 | – | 4.0 |
|
– |
|
3.5 |
|
0.8 |
|
Internal branches length ratio | 2 | 75% | – | 88% | – | – | – | 81% | – | 9% | – |
Claw 4 lengths | |||||||||||
Anterior primary branch | 3 | 16.3 | – | 17.0 |
|
– |
|
16.6 |
|
0.4 |
|
Anterior base + secondary branch | 2 | 12.4 | – | 12.9 |
|
– |
|
12.7 |
|
0.4 |
|
Anterior spur | 1 | 3.8 | – | 3.8 |
|
– |
|
3.8 |
|
? | ? |
Anterior branches length ratio | 2 | 75% | – | 79% | – | – | – | 77% | – | 3% | – |
Posterior primary branch | 3 | 17.7 | – | 18.8 |
|
– |
|
18.3 |
|
0.6 |
|
Posterior base + secondary branch | 3 | 12.7 | – | 13.7 |
|
– |
|
13.1 |
|
0.6 |
|
Posterior spur | 2 | 3.0 | – | 4.1 |
|
– |
|
3.6 |
|
0.8 |
|
Posterior branches length ratio | 3 | 69% | – | 73% | – | – | – | 72% | – | 2% | – |
We obtained good quality sequences for the applied molecular markers: 28S rRNA sequence (GenBank:
Madagascar,
The second author with great pleasure dedicates this species to her fiance – Mateusz Wojciechowski.
The holotype and 13 paratypes (slides: MAD139/14, MAD139/16, MAD139/18, MAD139/19, MAD139/34, MAD139/35, MAD139/42, MAD139/56, MAD139/72) are deposited at the Department of Animal Taxonomy and Ecology, Adam Mickiewicz University in Poznań, Uniwersytetu Poznańskiego 6, Poznań, Poland; five paratypes (slides: MAD139/12, MAD139/13, MAD139/15) are deposited at the Natural History Museum, University of Copenhagen, Universitetsparken 15, DK-2100 Copenhagen, Denmark.
The new species with three points on the secondary branches of all claws (claw configuration [3-3]–[3-3]) and a rather wide buccal tube, in relation to its length, is most similar to:
1.
2.
3.
4.
5.
The ranges of uncorrected genetic p-distances between
Sequences of 28S rRNA,
DNA marker | Taxon | Accession number | Source |
---|---|---|---|
28S rRNA |
|
Adams et. al. unpublished | |
|
Adams et. al. unpublished | ||
|
Adams et. al. unpublished | ||
|
|
Adams et. al. unpublished | |
|
Adams et. al. unpublished | ||
|
Zawierucha unpublished | ||
|
Zawierucha unpublished | ||
|
|
||
|
|
|
|
|
|
||
|
|
|
|
|
|
|
|
|
|
Fox et al. unpublished | |
|
|
Schill unpublished | |
|
Schill unpublished | ||
|
|
||
|
|
|
|
|
|
|
|
|
|
||
|
|
||
|
|
||
|
|
||
|
|
|
|
|
|
|
|
|
|
|
|
|
Sands et. al unpublished | ||
|
|
|
|
|
|
|
|
|
|
|
|
|
|
||
|
|
||
|
|
||
|
|
||
|
|
||
|
|
||
|
|
||
|
|
|
|
ITS-2 |
|
|
Morek et al. unpublished |
|
Morek et al. unpublished | ||
|
Morek et al. unpublished | ||
|
|
|
|
|
|
||
|
|
||
|
|
|
|
|
|
|
|
|
|
||
|
|
|
|
|
|
|
|
|
|
||
|
|
||
|
|
||
|
|
||
|
|
||
|
|
||
|
|
||
|
|
||
|
|
||
|
|
||
|
|
1. 28S rRNA: 4.5–6.7% (5.4% on average), with the most similar being
2.
3. ITS-2: 17.8–31.1% (23.7% on average), with the most similar being
Holotype and 28 paratypes, all from sample No 109: Ivohibory forest, Madagascar, moss sample from tree, coll. Marta Kepel and Andrzej Kepel.
The buccal apparatus of the
Measurements and
Character | N | Range | Mean |
|
Holotype | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
µm |
|
µm |
|
µm |
|
µm |
|
||||||
Body length | 17 | 329 | – | 553 | – | – | – | 448 | – | 60 | – | 515 | – |
Peribuccal papillae length | 12 | 6.8 | – | 10.4 |
|
– |
|
9.0 |
|
1.1 |
|
9.3 |
|
Lateral papillae length | 8 | 5.1 | – | 8.4 |
|
– |
|
6.7 |
|
1.0 |
|
6.1 |
|
Buccal tube | |||||||||||||
Length | 17 | 44.8 | – | 65.6 | – | – | – | 58.4 | – | 6.5 | – | 60.9 | – |
Stylet support insertion point | 15 | 31.2 | – | 45.8 |
|
– |
|
40.8 |
|
4.7 |
|
43.9 |
|
Anterior width | 16 | 14.0 | – | 23.0 |
|
– |
|
19.0 |
|
2.5 |
|
20.1 |
|
Standard width | 14 | 13.0 | – | 20.7 |
|
– |
|
17.7 |
|
2.3 |
|
19.8 |
|
Posterior width | 14 | 12.7 | – | 20.1 |
|
– |
|
16.9 |
|
2.2 |
|
18.9 |
|
Standard width/length ratio | 14 | 28% | – | 36% | – | – | – | 31% | – | 3% | – | 33% | – |
Posterior/anterior width ratio | 14 | 88% | – | 97% | – | – | – | 91% | – | 3% | – | 94% | – |
Claw 1 lengths | |||||||||||||
External primary branch | 16 | 11.0 | – | 15.2 |
|
– |
|
13.0 |
|
1.2 |
|
13.8 |
|
External base + secondary branch | 15 | 9.6 | – | 14.9 |
|
– |
|
12.6 |
|
1.4 |
|
13.8 |
|
External spur | 7 | 2.8 | – | 3.7 |
|
– |
|
3.2 |
|
0.3 |
|
? | ? |
External branches length ratio | 14 | 87% | – | 103% | – | – | – | 97% | – | 5% | – | 100% | – |
Internal primary branch | 16 | 10.9 | – | 14.0 |
|
– |
|
12.4 |
|
0.9 |
|
12.7 |
|
Internal base + secondary branch | 16 | 9.0 | – | 14.0 |
|
– |
|
12.1 |
|
1.4 |
|
12.8 |
|
Internal spur | 13 | 2.8 | – | 3.6 |
|
– |
|
3.1 |
|
0.3 |
|
3.2 |
|
Internal branches length ratio | 15 | 83% | – | 103% | – | – | – | 98% | – | 7% | – | 101% | – |
Claw 2 lengths | |||||||||||||
External primary branch | 15 | 10.6 | – | 15.3 |
|
– |
|
13.3 |
|
1.2 |
|
14.6 |
|
External base + secondary branch | 14 | 9.3 | – | 13.7 |
|
– |
|
12.2 |
|
1.4 |
|
12.5 |
|
External spur | 8 | 3.1 | – | 4.1 |
|
– |
|
3.4 |
|
0.3 |
|
4.1 |
|
External branches length ratio | 13 | 78% | – | 103% | – | – | – | 92% | – | 7% | – | 86% | – |
Internal primary branch | 14 | 10.9 | – | 15.0 |
|
– |
|
12.5 |
|
1.1 |
|
13.5 |
|
Internal base + secondary branch | 15 | 9.0 | – | 14.2 |
|
– |
|
12.1 |
|
1.5 |
|
12.9 |
|
Internal spur | 12 | 2.6 | – | 4.6 |
|
– |
|
3.4 |
|
0.6 |
|
3.7 |
|
Internal branches length ratio | 13 | 82% | – | 103% | – | – | – | 95% | – | 8% | – | 96% | – |
Claw 3 lengths | |||||||||||||
External primary branch | 17 | 10.8 | – | 15.2 |
|
– |
|
13.2 |
|
1.4 |
|
? | ? |
External base + secondary branch | 16 | 9.5 | – | 15.7 |
|
– |
|
12.0 |
|
1.6 |
|
? | ? |
External spur | 7 | 3.0 | – | 4.0 |
|
– |
|
3.3 |
|
0.4 |
|
? | ? |
External branches length ratio | 16 | 79% | – | 103% | – | – | – | 92% | – | 6% | – | ? | – |
Internal primary branch | 17 | 10.7 | – | 14.1 |
|
– |
|
12.4 |
|
1.1 |
|
? | ? |
Internal base + secondary branch | 16 | 9.0 | – | 14.1 |
|
– |
|
11.5 |
|
1.5 |
|
? | ? |
Internal spur | 10 | 2.4 | – | 4.0 |
|
– |
|
3.3 |
|
0.5 |
|
? | ? |
Internal branches length ratio | 16 | 80% | – | 102% | – | – | – | 93% | – | 7% | – | ? | – |
Claw 4 lengths | |||||||||||||
Anterior primary branch | 12 | 12.6 | – | 18.4 |
|
– |
|
15.2 |
|
1.6 |
|
15.8 |
|
Anterior base + secondary branch | 12 | 11.2 | – | 17.4 |
|
– |
|
14.7 |
|
1.8 |
|
16.5 |
|
Anterior spur | 7 | 2.7 | – | 5.2 |
|
– |
|
3.7 |
|
0.8 |
|
4.2 |
|
Anterior branches length ratio | 11 | 85% | – | 104% | – | – | – | 97% | – | 6% | – | 104% | – |
Posterior primary branch | 12 | 11.7 | – | 20.0 |
|
– |
|
16.0 |
|
2.2 |
|
17.5 |
|
Posterior base + secondary branch | 11 | 12.1 | – | 18.5 |
|
– |
|
15.6 |
|
2.2 |
|
17.5 |
|
Posterior spur | 7 | 2.9 | – | 5.2 |
|
– |
|
3.8 |
|
0.9 |
|
4.4 |
|
Posterior branches length ratio | 10 | 92% | – | 103% | – | – | – | 98% | – | 4% | – | 100% | – |
Claws of the
We obtained good quality sequences for the applied molecular markers: 28S rRNA sequence (GenBank:
The fourth points on secondary branches of posterior claws can be barely visible or not visible at all in some positions of the specimens.
Madagascar,
This species is named after Patricia Chapple Wright, an American primatologist and conservationist, best known for her studies on lemurs. She contributed to the establishment of the Ranomafana National Park in Madagascar. She also organized and led the expedition to the Ivohibory forest, during which several new species of tardigrades were found, including this species.
The holotype and 23 paratypes (slides: MAD109/1, MAD109/3, MAD109/4, MAD109/5, MAD109/7) are deposited at the Department of Animal Taxonomy and Ecology, Adam Mickiewicz University in Poznań, Uniwersytetu Poznańskiego 6, Poznań, Poland, five paratypes (slides: MAD109/2) are deposited at the Institute of Zoology and Biomedical Research, Jagiellonian University, Gronostajowa 9,30-387, Kraków, Poland.
The new species, by the presence of four points on secondary branches of claws IV, is most similar to
The ranges of uncorrected genetic p-distances between the
1. 28S rRNA: 5.7–8.0% (6.7% on average), with the most similar being
2.
3. ITS-2: 25.6–36.3% (31.5% on average), with the most similar being
Field study was the result of the collaboration and support of many people and institutions, especially ICTE/MICET in Antatananarivo and Centre ValBio in Ranomafana (Madagascar). The main funding for the expedition was obtained from the National Geographic Society’s Committee (USA) for Research and Exploration and Rainforest Trust exploratory grants.
The study was conducted on the basis of the authorization No. 122/17/MEEF/SG/DGF/DSAP/SCB.Re of Le Ministère de l’Environnement, de l’Ecologie et des Forêts (MEEF) of the Republic of Madagascar. Export of samples from Madagascar was authorized with the MEEF permit No 150N-EV06/MG17.
Studies (excluding field research) have been conducted in the framework of activities of BARg (Biodiversity and Astrobiology Research group at Adam Mickiewicz University, Poznań, Poland).
Milena Roszkowska is a scholarship holder of the AMU Foundation for the academic year 2018/2019.