Corresponding author: Santiago R. Ron (
Academic editor: A. Crottini
The genus
Rivadeneira CD, Venegas PJ, Ron SR (2018) Species limits within the widespread Amazonian treefrog
The upper Amazon Basin harbors the highest diversity of amphibian species in the world (
Within
Frogs were fixed in 10% formalin and preserved in 70% ethanol. Examined specimens, listed in Appendix
The following measurements were made with digital calipers (nearest 0.01 mm) for adult specimens, following
A total of 159 specimens from Ecuador and Peru was measured. Webbing formulae are described following
Principal Components Analysis (
Recordings were made with two digital recorders Olympus LS-10 and Marantz professional PMD620MKII Handheld Solid State Recorder attached to a directional microphone Sennheiser K6–ME67. We also included published recordings from Peru, Tambopata (
Calls were analyzed using software Raven 1.3 (
Terminology for call parameters follows
The calls of members of the
A Principal Components Analysis (
Total DNA was extracted from muscle and liver preserved in 95% ethanol or tissue storage buffer using guanidine–thiocyanate extraction protocol of M. Fujita (unpublished). Polymerase chain reaction (
Primers used in this study.
Gene | Primer | Primer sequence (5’–3’) | Source |
---|---|---|---|
|
tPhe-frog | ATAGCRCTGAARAYGCTRAGATG |
|
tVal-frog | TGTAAGCGARAGGCTTTKGTTAAGCT |
|
|
|
16S-frog | TTACCCTRGGGATAACAGCGCAA |
|
WL384 | GAGATWGTTTGWGCAACTGCTCG |
|
|
WL379b | GCACTAGCAATAATTATYTGAACBCC | This study | |
tMet-frog | TTGGGGTATGGGCCCAAAAGCT |
|
|
|
COI-BirdF1 | TTCTCCAACCACAAAGACATTGGCAC |
|
COI-BirdR2 | ACGTGGGAGATAATTCCAAATCCTGG |
|
|
LCO1490 | GGTCAACAAATCATAAAGATATTGG |
|
|
dgHCO2198 | TAAACTTCAGGGTGACCAAARAAYCA |
|
New sequences were obtained from 61 specimens from the upper Amazon Basin of Ecuador and Peru. A sequence of
Sequences were assembled and aligned in Geneiuos Pro v5.4.6 (
Phylogenetic relationships were inferred using Maximum likelihood (ML) with software GARLI v2.0 (
Maximum likelihood analyses were performed with ten replicates starting from stepwise addition trees (streefname = stepwise). Other GARLI settings were set to default values (
The total alignment of concatenated DNA sequences had 3040 base pairs from mitochondrial markers
Partition strategy and the best-fit model of substitution for each partition block used in phylogenetic analyses.
|
|
|
1 | GTR + G | |
2 | K80 + I + G | 16S |
3 | HKY + I | |
4 | GTR + I | |
5 | K80 + I | |
6 | F81 |
The phylogenetic relationships strongly support
Bayesian consensus phylogeny of
Mean
Morphometric variables from adults are summarized in Table
Boxplots for snout-vent length of adults of
Descriptive statistics for morphometric measurements of adult
|
||||||
---|---|---|---|---|---|---|
Males |
Females |
Males |
Females |
Males |
Females |
|
|
16.4 ± 0.84 (14.3−18.7) | 22.5 ± 1.17 (20.3−24.4) | 19.9 ± 1.33 (17.6−22.7) | 26.1 ± 1.67 (24.0−28.1) | 19.4 ± 0.48 (18.3−20.1) | 26.0 ± 2.33 (22.0−28.4) |
|
5.2 ± 0.30 (4.6−5.9) | 6.8 ± 0.32 (6.2−7.4) | 6.3 ± 0.40 (5.5−7.0) | 8.2 ± 0.50 (7.3−8.8) | 6.4 ± 0.24 (6.0−6.7) | 8.2 ± 0.85 (6.8−9.3) |
|
4.9 ± 0.36 (4.2−5.8) | 6.1 ± 0.54 (5.3−7.5) | 6.2 ± 0.34 (5.4−6.8) | 7.7 ± 0.41 (6.9−8.1) | 6.3 ± 0.29 (5.9−7.0) | 7.5 ± 0.40 (7.0−8.2) |
|
1.7 ± 0.14 (1.4−2.2) | 2.1 ± 0.17 (1.9−2.4) | 2.0 ± 0.16 (1.7−2.3) | 2.4 ± 0.17 (2.4−2.6) | 2.1 ± 0.26 (1.8−2.7) | 2.7 ± 0.33 (2.3−3.3) |
|
1.6 ± 0.14 (1.3−2.0) | 2.0 ± 0.18 (1.7−2.4) | 1.8 ± 0.16 (1.5−2.2) | 2.2 ± 0.12 (2.0−2.4) | 1.8 ± 0.11 (1.5−2.0) | 2.3 ± 0.22 (2.0−2.7) |
|
7.8 ± 0.48 (6.6−8.9) | 11.2 ± 0.67 (9.9−12.6) | 9.8 ± 0.67 (8.5−11.3) | 13.1 ± 0.74 (12.1−14.0) | 9.7 ± 0.52 (8.9−10.7) | 12.7 ± 0.69 (11.9−13.6) |
|
8.6 ± 0.49 (7.2−9.8) | 12.2 ± 0.65 (10.7−13.5) | 10.6 ± 0.74 (9.0−11.8) | 14.1 ± 0.56 (13.3−15.0) | 10.4 ± 0.41 (9.8−11.1) | 13.8 ± 1.08 (12.3−15.5) |
|
6.5 ± 0.49 (5.4−7.7) | 9.1 ± 0.88 (7.3−10.6) | 8.3 ± 0.65 (7.0−9.4) | 11.3 ± 0.81 (10.3−12.6) | 7.9 ± 0.38 (7.3−8.8) | 10.4 ± 0.55 (9.6−11.5) |
Principal components from analysis of seven size-corrected morphological variables of adults of
Two components with eigenvalues > 1.0 were extracted from the
Character loadings and eigenvalues for Principal Components (
Variables | ||||
---|---|---|---|---|
PCI | PCII | PCI | PCII | |
Head width |
|
-0.08 | 0.37 |
|
Head length | 0.33 | - |
0.35 | 0.08 |
Eye to nostril distance | 0.24 |
|
0.34 | 0.14 |
Internarial distance | 0.35 | -0.12 | 0.13 |
|
Femur length |
|
0.22 |
|
-0.16 |
Tibia length |
|
0.32 |
|
-0.33 |
Foot length | 0.39 | - |
0.36 | -0.26 |
Eingevalue | 2.84 | 1.22 | 2.50 | 1.15 |
% of variation | 40.6 | 17.4 | 35.7 | 16.4 |
Two PCs with eigenvalues > 1.0 explain the 58% of total variation among females (Table
The call of the
Advertisement calls of the
The dominant frequency of the advertisement call of the Northern Clade is higher (range 5081.8−6869.1 Hz) than that of the Southern Clade (range 3164.1−4306.6 Hz) and Central Clade (range 3542.2−4394.5 Hz). There are significant differences in dominant frequency for advertisement calls between the Northern Clade and the Southern Clade (Student’s t test,
The
Principal components from analysis of seven acoustic variables of advertisement calls of
The integrative analyses presented in this work show congruent differences in genetic, morphological, and bioacoustic characters that demonstrate the existence of three confirmed candidate species within “
Throughout the species account, coloration refers to preserved specimens unless otherwise noted.
Morphometric variation is shown in Table
The chest is white to cream (Fig.
Based on digital photographs (Fig.
Dorsolateral and ventral views of
Dorsal and ventral views of the holotypes of the
Adults of
(Fig.
Acoustic parameters of
|
|||||
---|---|---|---|---|---|
Sarayaku ( |
Canelos ( |
Río Verde ( |
Yasuní ( |
Combined ( |
|
Advertisement call duration | 0.14 ± 0.03 (0.06−0.18) | 0.13 ± 0.02 (0.10−0.17) | 0.19 ± 0.04 (0.11−0.24) | 0.11 ± 0.03 (0.06−0.18) | 0.14 ± 0.04 (0.06−0.24) |
Advertisement call dominant frequency | 6523.1 ± 184.18 (6115.4−6836.8) | 6454.1 ± 146.63 (6169.3−6686.1) | 5364.7 ± 167 (5081.8−5824.7) | 6490.4 ± 300.7 (5953.9−6869.1) | 6278.8 ± 503.75 (5081.8−6869.1) |
Advertisement call initial frequency | 5997.4 ± 223.5 (5674−6546.1) | 6020.5 ± 253.51 (5630.9−6352.3) | 5074.7 ± 260.71 (4758.8−5835.5) | 6130.3 ± 227.74 (5717.1−6729.1) | 5870.1 ± 459.02 (4758.8−6729.1) |
Advertisement call final frequency | 6602.4 ± 202.04 (6126.2−6836.8) | 6565.7 ± 186.92 (6147.7−6750.7) | 5419.8 ± 178.33 (5103.4−5835.5) | 6567.64 ± 261.07 (6007.8−6966) | 6356.5 ± 510 (5103.4−6966) |
Advertisement call rise time | 0.07 ± 0.01 (0.03−0.09) | 0.07 ± 0.01 (0.05−0.01) | 0.10 ± 0.02 (0.05−0.12) | 0.06 ± 0.01 (0.04−0.09) | 0.07 ± 0.02 (0.03−0.12) |
Number of pulses of advertisement call | 17.53 ± 3.22 (8−22) | 17 ± 1.10 (16−19) | 16.61 ± 3.53 (8−20) | 14.2 ± 4.45 (9−25) | 16.1 ± 3.87 (8−25) |
Advertisement call pulse rate | 126.76 ± 10.6 (97.83−146.34) | 133.43 ± 13.60 (111.76−152.38) | 86.1 ± 11.79 (65.57−125.9) | 126.57 ± 19.35 (77.92−171.88) | 119.61 ± 22.2 (65.57−171.88) |
Call duration | 0.45 ± 0.21 (0.27−0.90) | 0.44 ± 0.20 (0.26−0.77) | 0.61 ± 0.30 (0.37−1.22) | 0.72 ± 0.4 (0.26−2.12) | 0.6 ± 0.3 (0.26−2.12) |
Inter note interval | 0.08 ± 0.021 (0.03−0.10) | 0.07 ± 0.02 (0.05−0.11) | 0.12 ± 0.017 (0.10−0.15) | 0.08 ± 0.012 (0.06−0.12) | 0.09 ± 0.02 (0.03−0.15) |
Click note duration | 0.05 ± 0.014 (0.03−0.076) | 0.052 ± 0.015 (0.028−0.075) | 0.051 ± 0.015 (0.03−0.082) | 0.042 ± 0.011 (0.028−0.078) | 0.05 ± 0.013 (0.028−0.082) |
Click note dominant frequency | 6334.2 ± 151.8 (5964.7−6567.6) | 6471.9 ± 194.80 (6190.8−6761.4) | 5284.8 ± 109.5 (4866.5−5415.6) | 6544.9 ± 207.7 (5997−6922.9) | 6334.6 ± 460.3 (4866.5−6922.9) |
Number of pulses of click note | 2.2 ± 1.3 (1−5) | 3.3 ± 1.7 (1−6) | 1.65 ± 0.92 (1−5) | 2.1 ± 0.84 (1−4) | 2.1 ± 1.08 (1−6) |
Click note rise time | 0.024 ± 0.007 (0.015−0.038) | 0.024 ± 0.008 (0.014−0.038) | 0.025 ± 0.008 (0.015−0.042) | 0.021 ± 0.006 (0.013−0.039) | 0.023 ± 0.007 (0.013−0.042) |
Click note pulse rate | 47.96 ± 31.29 (14.08−138.89) | 59.10 ± 22.22 (20.83−100) | 31.37 ± 9.95 (18.52−60.98) | 48.54 ± 15.3 (20−103.45) | 46.89 ± 20.06 (14.08−138.89) |
Inter click notes interval | 0.064 ±0.016 (0.031−0.088) | 0.066 ± 0.019 (0.017−0.088) | 0.12 ± 0.03 (0.08−0.18) | 0.075 ± 0.012 (0.038−0.098) | 0.08 ± 0.023 (0.017−0.18) |
The advertisement call is a pulsed note (Fig.
Distribution of
Its extent of occurrence is 256,944 km2. There is habitat degradation and fragmentation within its distribution as result of human activities, especially cattle rising, agriculture, and oil exploitation. Its presence in artificial open areas suggests that is tolerant of at least some level of habitat modification (
The advertisement call from Río Verde differs from other population calls (Fig.
The holotype has
Two adults from Bolivia, Cochabamba Department, Ayopaya Province: confluence of the Altamachi and Ipiri rivers (
The specific name
Throughout the species description, coloration refers to preserved specimens unless otherwise noted. The new species is assigned to the genus
Dorsolateral and ventral views of
Adults of
Frontal and lateral views of the head of adults of
Adult male (Fig.
Figure
Morphometric variation in the paratype series is given in Table
The venter of preserved specimens (Fig.
Based on digital photographs (Fig.
(Fig.
Acoustic parameters of
|
||||||
|
|
|
|
|
|
|
Advertisement call duration | 0.14 ± 0.03 (0.09−0.20) | 0.12 ± 0.01 (0.10−0.14) | 0.12 ± 0.01 (0.11−0.14) | 0.15 ± 0.005 (0.14−0.16) | 0.13 ± 0.02 (0.1−0.17) | 0.14 ± 0.02 (0.09−0.2) |
Advertisement call dominant frequency | 3669.6 ± 277.16 (3164.1−4112.8) | 3639.1 ± 79.5 (3542.2−3703.7) | 4208.19 ± 66.5 (4091.3−4306.6) | 3948.1 ± 184.8 (3779.1−4263.6) | 3983.6 ± 64.1 (3811.4−4059) | 3782.3 ± 286.92 (3164.1−4306.6) |
Advertisement call initial frequency | 3442.5 ± 246.8 (2964.8−3854.4) | 3397.9 ± 59.27 (3316.1−3456.1) | 4011.3 ± 153.4 (3886.7−4274.3) | 3800.6 ± 51.8 (3671.4−3876) | 3746.8 ± 73.5 (3639.1−3854.4) | 3562.2 ± 274.4 (2964.8−4274.3) |
Advertisement call final frequency | 3685.8 ± 277.9 (3175.8−4123.6) | 3636.9 ± 69.53 (3542.2−3703.7) | 4205.1 ± 69.2 (4080.5−4306.6) | 3982.6 ± 175.2 (3779.1−4252.8) | 4000.3 ± 45.11 (3929.8−4059) | 3798.2 ± 285.91 (3175.8−4306.6) |
Advertisement call rise time | 0.07 ± 0.01 (0.04−0.1) | 0.06 ± 0.01 (0.05−0.07) | 0.06 ± 0.004 (0.05−0.07) | 0.08 ± 0.002 (0.072−0.079) | 0.06 ± 0.01 (0.05−0.08) | 0.07 ± 0.01 (0.04−0.1) |
Number of pulses of advertisement call | 22.8 ± 4.14 (14−32) | 16.6 ± 1.52 (15−19) | 14.1 ± 1.07 (12−15) | 23 ± 1.4 (20−24) | 17 ± 2.88 (13−21) | 21 ± 4.62 (12−32) |
Advertisement call pulse rate | 161.91 ± 9.66 (107.69−178.95) | 140 ± 5.47 (131.15−145.63) | 114.94 ± 7.11 (103.44−125) | 151.4 ± 6.4 (140.8−155.8) | 132.32 ± 5.23 (123.9−143.9) | 151.84 ± 17.18 (103.45−178.94) |
Call duration | 0.31 ± 0.048 (0.26−0.41) | 0.46 ± 0.062 (0.40−0.55) | 0.69 ± 0.093 (0.54−0.80) | NA | 0.53 ± 0.13 (0.45−0.81) | 0.46 ± 0.17 (0.26−0.81) |
Inter note interval | 0.10 ± 0.011 (0.09−0.13) | 0.09 ± 0.014 (0.08−0.11) | 0.08 ± 0.009 (0.07−0.09) | NA | 0.09 ± 0.006 (0.08−0.01) | 0.09 ± 0.01 (0.07−0.13) |
Click note duration | 0.051 ± 0.009 (0.03−0.067) | 0.052 ± 0.017 (0.03−0.082) | 0.063 ± 0.02 (0.035−0.10) | NA | 0.07 ± 0.008 (0.05−0.08) | 0.06 ± 0.01 (0.03−0.10) |
Click note dominant frequency | 3610.3 ± 267.3 (3164.1−4048.2) | 3563.7 ± 62.11 (3445.3−3649.9) | 4351.9 ± 75.3 (4242−4532.7) | NA | 4024.9 ± 41.86 (3962.1−4102.1) | 3981.2 ± 341.9 (3164.1−4532.7) |
Number of pulses of click note | 6.3 ± 2.2 (1−9) | 3.75 ± 2.7 (1−8) | 4.5 ± 2.3 (1−10) | NA | 7.83 ± 0.91 (6−10) | 5.87 ± 2.53 (1−10) |
Click note rise time | 0.025 ± 0.005 (0.015−0.034) | 0.026 ± 0.008 (0.014−0.04) | 0.032 ± 0.010 (0.017−0.05) | NA | 0.03 ± 0.004 (0.02−0.04) | 0.03 ± 0.007 (0.01−0.05) |
Click note pulse rate | 124.01 ± 34.53 (23.81−151.52) | 64.11 ± 33.80 (25.64−112.9) | 67.82 ± 19.72 (18.52−111.11) | NA | 117 ± 8.11 (91−140.35) | 95.6 ± 35.28 (18.52−151.52) |
Inter click notes interval | 0.08 ± 0.007 (0.07−0.084) | 0.085 ± 0.015 (0.069−0.11) | 0.068 ± 0.008 (0.054−0.084) | NA | 0.07 ± 0.005 (0.06−0.08) | 0.07 ± 0.01 (0.05−0.1) |
The advertisement call is a pulsed note (Fig.
One recording from Cobija, Bolivia (Pando Department, Nicolás Suárez Province) by
Bolivian records are partly based on
The call from Cobija (Pando Department) falls within the range of advertisement call of
Extent of occurrence (B1) is 637,800 km2.
The specimens from Cochabamba Department (Appendix
Nine adult males and an adult female from Peru, Loreto Department, Requena Province, Campamento Wishuincho-Río Tapiche (
An adult male and three adult females from Peru, San Martin Department, Picota Province, Área de Conservación Municipal Chambira (
The specific name
Throughout the species description, coloration refers to preserved specimens unless otherwise noted. The new species is assigned to the genus
Dorsolateral and ventral views of
Adults of
Adult male (Fig.
(Fig.
Morphometric variation of the paratype series is summarized in Table
The venter of preserved specimens (Fig.
Based on digital photographs (Fig.
(Fig.
Acoustic parameters of
|
|||
|
|
|
|
Advertisement call duration | 0.13 ± 0.02 (0.1−0.16) | 0.23 ± 0.04 (0.13−0.3) | 0.19 ± 0.06 (0.1−0.3) |
Advertisement call dominant frequency | 4062.6 ± 248.78 (3691.4−4394.5) | 3998.9 ± 137.88 (3542.2−4242) | 4024.7 ± 191.88 (3542.2−4394.5) |
Advertisement call initial frequency | 3722 ± 261.11 (3222.7−4066.4) | 3664.9 ± 182 (3380.7−4015.9) | 3688.1 ± 217.86 (3222.7−4066.4) |
Advertisement call final frequency | 4066.7 ± 250.85 (3691.4−4394.5) | 4026.7 ± 105.17 (3703.7−4242) | 4042.9 ± 178.72 (3691.4−4394.5) |
Advertisement call rise time | 0.06 ± 0.008 (0.05−0.08) | 0.12 ± 0.02 (0.06−0.15) | 0.09 ± 0.03 (0.05−0.15) |
Number of pulses of advertisement call | 17.76 ± 2.47 (14−22) | 27 ± 6.16 (14−27) | 23.26 ± 6.24 (14−34) |
Advertisement call pulse rate | 140.76 ± 5.27 (133.33−158.27) | 129.05 ± 34.18 (110.6−228.57) | 133.79 ± 27.1 (110.6−228.57) |
Call duration | 0.42 ± 0.11 (0.23−0.63) | 0.54 ± 0.06 (0.45−0.59) | 0.44 ± 0.12 (0.23−0.63) |
Inter note interval | 0.076 ± 0.013 (0.05−0.10) | 0.08 ± 0.006 (0.075−0.088) | 0.08 ± 0.011 (0.05−0.10) |
Click note duration | 0.051 ± 0.011 (0.03−0.07) | 0.073 ± 0.009 (0.051−0.09) | 0.06 ± 0.014 (0.03−0.09) |
Click note dominant frequency | 4069.2 ± 269.6 (3703.1−4500) | 4023.3 ± 32.82 (3962.1−4080.5) | 4057.4 ± 233.03 (3703.1−4500) |
Number of pulses of click note | 4.5 ± 1.71 (1−7) | 6.4 ± 1.3 (2−7) | 5 ± 1.8 (1−7) |
Click note rise time | 0.026 ± 0.005 (0.014−0.03) | 0.04 ± 0.005 (0.026−0.04) | 0.028 ± 0.007 (0.014−0.04) |
Click note pulse rate | 85.84 ± 21.27 (27.03−117.6) | 87.66 ± 15.0 (39.22−111.11) | 86.3 ± 19.7 (27.03−117.6) |
Inter click notes interval | 0.083 ± 0.012 (0.058−0.10) | 0.080 ± 0.0092 (0.066−0.095) | 0.082 ± 0.011 (0.06−0.10) |
Character loadings and eigenvalues for Principal Components (
|
|
|
|
|
|
Note duration | -0.24 |
|
Dominant frequency |
|
0.17 |
Initial frequency |
|
0.16 |
Final frequency |
|
0.17 |
Rise time | -0.21 |
|
Number of pulses | - |
0.20 |
Pulse rate | -0.23 | - |
Eingevalue | 3.80 | 2.34 |
% of variation | 54.2 | 33.5 |
The advertisement call is a pulsed note (Fig.
Extent of occurrence (B1) is 53,548 km2.
Specimens from Chambira (Picota Province) are closely related to Río Tapiche and Jenaro Herrera specimens (both localities from Requena Province) (Fig.
Our genetic, morphologic, and bioacoustic data demonstrated that
The pattern of variation in bioacoustic, and quantitative and qualitative morphological characters found in the
Several authors have discussed the role of niche evolution in the speciation of vertebrates in tropical mountains (e.g.,
The lack of importance of elevation in promoting genetic differentiation is also suggested by interpopulation genetic differentiation in
This research was funded by grants from Secretaría de Educación Superior, Ciencia, Tecnología e Innovación del Ecuador (SENESCYT, Arca de Noé Initiative; O. Torres-Carvajal and S. R. Ron Principal Investigators), and Pontificia Universidad Católica del Ecuador. We thank for assistance in the fieldwork and laboratory Fernando Ayala, Teresa Camacho, Diana Flores, Andrea Manzano, María Eugenia Ordóñez, Daniela Pareja, Diego Paucar, Diana Pazmiño, Ítalo Tapia, and Eduardo Toral. Special thanks to Teresa Camacho-Badani and Arturo Muñoz from Museo de Historia Natural Alcide d’Orbigny, Cochabamba, Bolivia, for their help to document Bolivian records. We thank Albertina P. Lima for providing records of Brazilian localities from Rio Madeira and Ramal do Purupuru of
ECUADOR: PROVINCIA SUCUMBIOS: Puerto Bolívar (
PERU: DEPARTAMENTO MADRE DE DIOS: PROVINCIA TAMBOPATA: Inotawa (
PERU: DEPARTAMENTO LORETO: PROVINCIA REQUENA: Sierra del Divisor (
GenBank accession numbers for DNA sequences used in the phylogenetic analyses. Abbreviations: BRA = Brazil, CO = Colombia, EC = Ecuador, PE = Peru.
Museum number | Species | Locality | Alt. (m) | Latitude | Longitude | Genbank Accession numbers | ||
---|---|---|---|---|---|---|---|---|
|
16S- |
|
||||||
|
Sucumbíos, Puerto Bolívar. EC | 240 |
|
|
|
|
||
|
Sucumbíos, Rey de los Andes. EC | 270 |
|
|
|
|
||
|
Sucumbíos, Rey de los Andes. EC | 270 |
|
|
|
|
||
|
Sucumbíos, Cuyabeno. EC | 230 |
|
|
|
|
||
|
Sucumbíos, Cuyabeno. EC | 230 |
|
|
|
|
||
|
Sucumbíos, Zábalo. EC | 220 |
|
|
|
|
||
|
Sucumbíos, Puerto Bolívar. EC | 240 |
|
|
|
|
||
|
Sucumbíos, Limoncocha. EC | 261 |
|
|
|
|
||
|
Sucumbíos, La Selva. EC | 229 |
|
|
|
|
||
|
Orellana, PNY, Pozo SPF, 8 km. EC | 250 |
|
|
|
|
||
|
Orellana, PNY, Pompeya-Iro road, 80−75 km. EC | 250 |
|
|
|
|
||
|
Orellana, PNY, Pompeya-Iro road, 80−75 km. EC | 250 |
|
|
|
|
||
|
Orellana, Coca, northern Río Napo. EC | 267 |
|
|
|
|
||
|
Orellana, Primavera. EC | 244 |
|
|
|
|
||
|
Orellana, Áñangu. EC | 255 |
|
|
|
|
||
|
Orellana, Santa Teresita. EC | 186 |
|
|
|
|
||
|
Orellana, Coca, southern Río Napo. EC | 264 |
|
|
|
|
||
|
Orellana, PNY, Estación Científica Yasuní, PUCE. EC | 250 |
|
|
|
|
||
|
Orellana, Chiroisla, southern Río Napo. EC | 207 |
|
|
|
|
||
|
Orellana, San Vicente. EC | 196 |
|
|
|
|
||
|
Orellana, Huiririma. EC | 194 |
|
|
|
|
||
|
Orellana, Santa Teresita. EC | 186 |
|
|
|
|
||
|
Orellana, Edén. EC | 216 |
|
|
|
|
||
|
Orellana, Edén. EC | 216 |
|
|
|
|
||
|
Orellana, Chiroisla, northern Río Napo. EC | 203 |
|
|
|
|
||
|
Orellana, PNY, Estación Científica Yasuní, PUCE. EC | 250 |
|
|
|
|
||
|
Orellana, PNY, Pompeya-Iro, 96 km. EC | 233 |
|
|
|
|
||
|
Orellana, Nuevo Rocafuerte. EC | 187 |
|
|
|
|
||
|
Napo, Estación Biológica Jatun Sacha. EC | 397 |
|
|
NA | NA | ||
|
Napo, Sumaco. EC | 1430 |
|
|
|
|
||
|
Napo, Estación Biológica Jatun Sacha. EC | 397 |
|
|
|
|
||
|
Napo, Río Hollín. EC | 1068 |
|
|
|
|
||
|
Napo, Río Hollín. EC | 1068 |
|
|
|
|
||
|
Napo, Sumaco. EC | 1430 |
|
|
|
|
||
|
Pastaza, Zanjarajuno. EC | 977 |
|
|
|
|
||
|
Tungurahua, Río Negro. EC | 1244 |
|
|
NA |
|
||
|
Tungurahua, Río Negro. EC | 1244 |
|
|
|
|
||
|
Tungurahua, Río Verde. EC | 1600 |
|
|
|
|
||
|
Tungurahua, Río Verde. EC | 1600 |
|
|
|
|
||
|
Pastaza, Sarayaku, Río Palandayaku. EC | 325 |
|
|
NA |
|
||
|
Pastaza, Tuculí. EC | 620 |
|
|
|
|
||
|
Pastaza, Tuculí. EC | 620 |
|
|
|
|
||
|
Pastaza, Sarayaku, Río Palandayaku. EC | 325 |
|
|
|
|
||
|
Pastaza, Fátima. EC | 1023 | -1.4114 | -78 |
|
|
|
|
|
Pastaza, Canelos-Puyo road. EC | 465 |
|
|
|
|
||
|
Pastaza, Canelos. EC | 465 |
|
|
|
|
||
|
Pastaza, Sarayaku, Río Palandayaku. EC | 325 |
|
|
|
|
||
|
Pastaza, Sarayaku, Río Palandayaku. EC | 325 |
|
|
|
|
||
|
Pastaza, Montalvo. EC | 392 |
|
|
|
|
||
|
Pastaza, Killu Allpa. EC | 335 |
|
|
|
|
||
|
Pastaza, Bobonaza. EC | 660 |
|
|
|
|
||
|
Pastaza, Montalvo. EC | 392 |
|
|
|
|
||
|
Pastaza, Montalvo. EC | 392 |
|
|
|
|
||
|
Pastaza, Arajuno. EC | 580 |
|
|
|
|
||
|
Pastaza, Cononaco. EC | 220 |
|
|
|
|
||
|
La Convencion, Poyentimari. PE | 725 |
|
|
NA |
|
||
|
La Convencion. Pongo de Mainique. PE | 670 |
|
|
|
|
||
|
Tambopata, Inotawa. PE | 192 |
|
|
|
|
||
AMNHA 139315 |
|
Acre, Rio Branco-Porto Velho. BRA | 160 | -9.9556 | -67.8648 |
|
NA | NA |
|
Picota, Chambira. PE | 679 |
|
|
|
|
||
|
Requena, Jenaro Herrera. PE | 500 |
|
|
|
|
||
|
Requena, Río Tapiche. PE | 120 |
|
NA |
|
NA | ||
|
Orellana, Primavera. EC | 244 |
|
|
NA | NA | ||
|
Sucumbíos, Cuyabeno. EC | 230 |
|
|
NA | NA | ||
|
Orellana, Yasuní. EC | 245 |
|
|
NA | NA | ||
ANDES A1025 |
|
Amazonas, Leticia-Tarapacá km 11. CO | 103 |
|
|
NA | NA | |
|
Tambopata, Tambopata. PE | 233 |
|
|
|
|
||
|
Tambopata, Inotawa. PE | 192 |
|
|
|
|
||
|
Orellana, Yasuní. EC | 250 |
|
|
|
|
||
CFBH 7600 |
|
Rio de Janeiro, Restinga de Maricá. BRA | 9 |
|
|
NA | NA |