Corresponding author: Luis Cunha (
Academic editor: F. Govedich
Conrado AC, Arruda H, Stanton DWG, James SW, Kille P, Brown G, Silva E, Dupont L, Taheri S, Morgan AJ, Simões N, Rodrigues A, Montiel R, Cunha L (2017) The complete mitochondrial DNA sequence of the pantropical earthworm
Excluding a few aquatic taxa, earthworms (
Molecular data have become increasingly important in recent years. In animals, the mitochondrial DNA (
In this study, we sequenced the complete
A group of clitellate (adult)
The complete
Details of the primers used to amplify the mitochondrial DNA of
Primer code | Orientation | Annealing position (bp) | Nucleotide sequence (5’-3’) | Melting Temperature (°C) |
---|---|---|---|---|
FP_1 | Forward | 2154..2175 | CTCTACTATGTACCCAGGAGTG | 57.46 |
RP_1 | Reverse | 2758..2775 | GCGGCCAAGATAAAGCAC | 57.67 |
RP_2 | Reverse | 3740..3762 | TAGAGGCGGTAAGGAGAAAGTAT | 58.61 |
RP_3 | Reverse | 5691..5708 | CAGAGGCGAGGTAAATTC | 53.85 |
RP_4 | Reverse | 6356..6373 | TGTTCAGGGCTAGGATTG | 54.99 |
FP_5 | Forward | 7983..8004 | ACTAGTGTCACTTACAACAACC | 57.16 |
RP_5 | Reverse | 8649..8670 | TGATAAGGGGGAAAGTCTGATC | 56.84 |
FP_6 | Forward | 8766..8787 | AGTAGCCGCTATAATAGTCCTT | 57.91 |
RP_6 | Reverse | 10328..10349 | TGATTTGGGGTCAGAGCCGTAG | 61.59 |
FP_7 | Forward | 10459..10478 | AAAGCTTGGCGGTGCTTCAC | 63.23 |
RP_7 | Reverse | 11242..11263 | CCTAGTGTGTGTCAGGACGCTT | 64.75 |
Long PCR targets were amplified using different combinations of the primer sets, and initially sequenced with the same forward or reverse primers. Subsequent primer walking method was used to close the sequencing gaps. To ensure the accuracy of the sequence, every two contiguous segments overlapped by at least 80 bp. PCRs were performed using ~40 ng of DNA and 0.4 μM forward and reverse primers, 0.2 mM dNTP mix and 1.25 U Platinum HiFi DNA polymerase buffered with 1X Mg-free buffer (Thermofisher Scientific, UK). PCR amplification buffer was supplemented with MgCl2 to achieve a final concentration of 1.75 mM in a total volume of 25 μl reaction mixture. The reaction was denatured at 95°C for 3 min, cycled 35 times at 95°C for 30 s, 30 s at the required primer annealing temperature and 72°C for 1 min per 1000 bp depending on target fragment length. Negative controls were included in all PCR amplifications to confirm the absence of contaminants. Before sequencing, PCR cleanups were performed using Exo-SAP-IT (Amersham Pharmacia, UK) reagents. Exonuclease 1 (0.25 μl) and Shrimp Alkaline Phosphatase (0.5 μl) were mixed with the PCR product (10 μl) and incubated at 37°C for 45 min followed by 80°C for 15 min. DNA was sequenced using ABI PRISM® BigDye v3.1 Terminator Sequencing technology (Applied Biosystems, USA) on an ABI PRISM® 3100 DNA automated Sequencer.
Sequence trace files were corrected and aligned with the MEGA v.7 (
To clarify the phylogenetic position of
Representative
|
|
|
|
|
|
14,835 |
|
|
|
15,170 |
|
|
|
15,161 |
|
|
|
15,156 |
|
|
|
15,174 |
|
|
|
15,083 |
|
|
|
14,998 |
|
|
|
14,648 |
|
|
|
14,414 |
|
Two different methods, Bayesian inference (
Maximum likelihood analysis (
The mitochondrial genome of
The mitochondrial genome of
The mitochondrial genome structure is detailed in Table
Organisation and structure of the
Gene | Direction | From | To | Size (bp) | Start | Stop | Anti-codon | Intergenic bases (bp) |
---|---|---|---|---|---|---|---|---|
COX1 | + | 1 | 1540 | 1540 | ATG | T-- | 0 | |
tRNA-Asn | + | 1541 | 1602 | 62 | GTT | 0 | ||
COX2 | + | 1603 | 2289 | 687 | ATG | TAG | -1 | |
tRNA-Asp | + | 2289 | 2351 | 63 | GTC | 2 | ||
ATP8 | + | 2354 | 2513 | 160 | ATG | T-- | 0 | |
tRNA-Tyr | + | 2514 | 2576 | 63 | GTA | -1 | ||
tRNA-Gly | + | 2576 | 2638 | 63 | TCC | 3 | ||
COX3 | + | 2642 | 3419 | 778 | ATG | T-- | 0 | |
tRNA-Gln | + | 3420 | 3488 | 69 | TTG | 0 | ||
ND6 | + | 3489 | 3954 | 466 | ATG | T-- | 0 | |
Cytb | + | 3955 | 5094 | 1140 | ATG | TAA | -2 | |
tRNA-Trp | + | 5092 | 5154 | 63 | TCA | 1 | ||
ATP6 | + | 5156 | 5851 | 696 | ATG | TAA | -2 | |
tRNA-Arg | + | 5850 | 5910 | 61 | TCG | 0 | ||
Putative Control Region | + | 5911 | 6228 | 318 | ||||
tRNA-His | + | 6229 | 6288 | 60 | GTG | 0 | ||
ND5 | + | 6289 | 8010 | 1722 | ATG | TAA | 3 | |
tRNA-Phe | + | 8014 | 8073 | 60 | GAA | 4 | ||
tRNA-Glu | + | 8078 | 8141 | 64 | TTC | 0 | ||
tRNA-Pro | + | 8142 | 8204 | 63 | TGG | 4 | ||
tRNA-Thr | + | 8209 | 8272 | 64 | TGT | 0 | ||
ND4L | + | 8273 | 8569 | 297 | ATG | TAA | -7 | |
ND4 | + | 8563 | 9921 | 1359 | ATG | TAA | -2 | |
tRNA-Cys | + | 9920 | 9986 | 67 | GCA | 1 | ||
tRNA-Met | + | 9988 | 10050 | 63 | CAT | -1 | ||
s- |
+ | 10050 | 10838 | 789 | -7 | |||
tRNA-Val | + | 10832 | 10894 | 63 | TAC | -2 | ||
l- |
+ | 10893 | 12104 | 1212 | 0 | |||
tRNA-Leu 1 | + | 12105 | 12166 | 62 | TAG | 2 | ||
tRNA-Ala | + | 12169 | 12230 | 62 | TGC | 1 | ||
tRNA-Ser 2 | + | 12232 | 12293 | 62 | TGA | 1 | ||
tRNA-Leu 2 | + | 12295 | 12360 | 66 | TAA | 0 | ||
ND1 | + | 12361 | 13290 | 930 | ATG | TAG | -1 | |
tRNA-lle | + | 13290 | 13354 | 65 | GAT | 0 | ||
tRNA-Lys | + | 13355 | 13417 | 63 | TTT | 0 | ||
ND3 | + | 13418 | 13770 | 353 | GTG | TA- | -1 | |
tRNA-Ser 1 | + | 13770 | 13832 | 63 | TCT | 0 | ||
ND2 | + | 13833 | 14835 | 1003 | ATG | T-- | 0 |
The nucleotide composition is asymmetric (31.9% A, 27.9% T, 14.9% G, and 25.3% for C) with an overall A+T content of 59.9%. One remarkable trait of metazoan mitogenomes is the strand-specific bias in nucleotide composition (
The
Nucleotide composition and codon usage frequencies were calculated from a concatenated sequence of all protein-coding genes on the H-strand. The base composition of protein-coding genes revealed a negative bias for A (14.4%), especially at second codon positions (12.9%, Table
Base composition for protein-coding, tRNA, and
Gene/Region | Base composition (%) | A+T (%) | Size (bp) | |||
---|---|---|---|---|---|---|
T | C | A | G | |||
COX1 | 27.4 | 26.7 | 27.9 | 18.1 | 55.3 | 1,540 |
COX2 | 25.8 | 24.3 | 34.9 | 15.0 | 60.7 | 687 |
ATP8 | 24.4 | 26.9 | 36.9 | 11.9 | 61.3 | 160 |
COX3 | 27.3 | 27.5 | 25.7 | 19.5 | 53.0 | 778 |
ND6 | 28.3 | 26.0 | 30.3 | 15.5 | 58.6 | 466 |
Cytb | 28.0 | 27.1 | 29.7 | 15.3 | 57.6 | 1,140 |
ATP6 | 29.6 | 29.2 | 30.6 | 10.6 | 60.2 | 696 |
ND5 | 27.7 | 26.7 | 31.7 | 13.9 | 59.4 | 1,722 |
ND4L | 25.9 | 28.3 | 33.0 | 12.8 | 58.9 | 297 |
ND4 | 27.5 | 27.5 | 32.3 | 12.7 | 59.8 | 1,359 |
ND1 | 28.4 | 25.8 | 29.8 | 16.0 | 58.2 | 930 |
ND3 | 32.6 | 26.1 | 27.2 | 14.2 | 59.8 | 353 |
ND2 | 30.0 | 28.2 | 30.7 | 11.1 | 60.7 | 1,003 |
Protein Coding | ||||||
1st | 30.2 | 25.4 | 17.4 | 27.0 | 47.6 | 3,710 |
2st | 24.9 | 27.6 | 12.9 | 34.6 | 37.8 | 3,710 |
3st | 36.1 | 27.9 | 13.8 | 22.3 | 49.8 | 3,710 |
Total | 30.4 | 27.0 | 14.7 | 28.0 | 45.1 | 11,131 |
tRNA | 30.5 | 17.6 | 34.9 | 17.0 | 65.5 | 1,391 |
|
24.1 | 22.0 | 37.6 | 16.3 | 61.7 | 2,001 |
Putative Control Region | 31.5 | 18.9 | 36.2 | 13.5 | 67.6 | 318 |
Overall | 28.1 | 25.6 | 31.8 | 14.6 | 59.9 | 14,835 |
Like other mitochondrial genomes (
As shown in Table
As in most
The phylogenetic trees (the 50% majority-rule consensus tree is shown in Figure
Phylogenetic relationships among phylum
For the first time, the sequencing, annotation and analysis of the mitochondrial genome of a member of
The authors report no conflicts of interest and are responsible for the content and writing of the paper.
We thank Jose Talavera for the taxonomic identification of the studied specimen. This study was financially supported by the Portuguese Government (FCT project PTDC/AAC-AMB/ 115713/2009). Luis Cunha was supported by an EU Marie Curie fellowship - MSCA-IF-2014-GF-660378. George Brown, Elodie da Silva acknowledge fellowship support by CNPq. Ana Caroline Conrado was supported by a scholarship funded by CAPES. Sam James was supported by USA NSF award DEB-1136604. Dave Stanton was supported by a NERC grant (NE/M017656/1).
Inferred secondary structure of 22 tRNA genes in the mitochondrial DNA of the pantropical earthworm
molecular data