Corresponding author: Karen Ober (
Academic editor: T. Erwin
Populations of the ground beetle
The Sky Islands (
The goal of this study was to infer the biogeographic history of
We collected DNA sequence data from 45 specimens of four of the six subspecies of
Specimens, collection localities, and GenBank numbers included in this study.
|
|
|
|
|
---|---|---|---|---|
|
MA: Worcester Co. Wachusett Reservior / |
001 | JN639333 | JN641890 |
|
CA: Kern Co., Silvia Rd. / |
002 | JN639334 | JN641891 |
CA: Kern Co. Hwy 49A / |
030 | JN639335 | JN641892 | |
|
AZ:Graham Co., Pinaleño Mts., Columbine Corral Camp/Ash Creek / |
040 | JN639336 | JN641893 |
|
AZ:Graham Co., Pinaleño Mts., Ladybug Trail / |
041 | JN639337 | JN641894 |
|
AZ:Graham Co., Pinaleño Mts., Columbine Corral Camp/Ash Creek / |
075 | JN639369 | JN641926 |
|
AZ:Graham Co., Pinaleño Mts., Columbine Corral Camp/Ash Creek / |
076 | JN639370 | JN641927 |
|
AZ:Graham Co., Pinaleño Mts., Columbine Corral Camp/Ash Creek / |
077 | JN639371 | JN641928 |
|
AZ:Graham Co., Pinaleño Mts., Columbine Corral Camp/Ash Creek / |
078 | JN639372 | JN641929 |
|
AZ:Graham Co., Pinaleño Mts., Columbine Corral Camp/Ash Creek / |
079 | JN639373 | JN641930 |
|
AZ: Cochise Co., Huachuca Mts., Carr Canyon Trail / |
044 | JN639340 | JN641897 |
|
AZ: Cochise Co., Huachuca Mts., Carr Canyon Trail / |
045 | JN639341 | JN641898 |
|
AZ: Cochise Co., Huachuca Mts., Carr Canyon Trail / |
046 | JN639342 | JN641899 |
|
AZ: Cochise Co., Huachuca Mts., Carr Canyon Trail / |
047 | JN639343 | JN641900 |
|
AZ: Cochise Co., Huachuca Mts., Carr Canyon Trail / |
048 | JN639344 | JN641901 |
|
AZ: Cochise Co., Huachuca Mts., Carr Canyon Trail / |
049 | JN639345 | JN641902 |
|
AZ: Cochise Co., Huachuca Mts., Carr Canyon Trail / |
050 | JN639346 | JN641903 |
|
AZ: Cochise Co., Huachuca Mts., Carr Canyon Trail / |
051 | JN639347 | JN641904 |
|
AZ: Cochise Co., Huachuca Mts., Carr Canyon Trail / |
052 | JN639348 | JN641947 |
|
AZ: Cochise Co., Huachuca Mts., Carr Canyon Trail / |
073 | JN639367 | JN641924 |
|
AZ: Cochise Co., Huachuca Mts., Carr Canyon Trail / |
074 | JN639368 | JN641925 |
|
AZ: Pima Co., Santa Catalina Mts., Marshall Gulch / |
042 | JN639338 | JN641895 |
|
AZ: Pima Co., Santa Catalina Mts., Marshall Gulch / |
043 | JN639339 | JN641896 |
|
AZ: Pima Co., Santa Catalina Mts., Ski Valley / |
053 | JN639348 | JN641905 |
|
AZ: Pima Co., Santa Catalina Mts., Ski Valley / |
054 | JN639349 | JN641906 |
|
AZ: Pima Co., Santa Catalina Mts., Ski Valley / |
055 | JN639350 | JN641907 |
|
AZ: Pima Co., Santa Catalina Mts., Ski Valley / |
056 | JN639351 | JN641908 |
|
AZ: Pima Co., Santa Catalina Mts., Ski Valley / |
058 | JN639352 | JN641909 |
|
AZ: Pima Co., Santa Catalina Mts., Ski Valley / |
059 | JN639353 | JN641910 |
|
AZ: Pima Co., Santa Catalina Mts., Ski Valley / |
060 | JN639354 | JN641911 |
|
AZ: Pima Co., Santa Catalina Mts., Ski Valley / |
061 | JN639355 | JN641912 |
|
AZ: Pima Co., Santa Catalina Mts., Ski Valley / |
062 | JN639356 | JN641913 |
|
AZ: Pima Co., Santa Catalina Mts., Ski Valley / |
063 | JN639357 | JN641914 |
|
AZ: Pima Co., Santa Catalina Mts., Ski Valley / |
064 | JN639358 | JN641915 |
|
AZ: Pima Co., Santa Catalina Mts., Ski Valley / |
065 | JN639359 | JN641916 |
|
AZ: Pima Co., Santa Catalina Mts., Ski Valley / |
066 | JN639360 | JN641917 |
|
AZ: Pima Co., Santa Catalina Mts., Ski Valley / |
067 | JN639361 | JN641918 |
|
AZ: Pima Co., Santa Catalina Mts., Ski Valley / |
068 | JN639362 | JN641919 |
|
AZ: Pima Co., Santa Catalina Mts., Ski Valley / |
069 | JN639363 | JN641920 |
|
AZ: Pima Co., Santa Catalina Mts., Ski Valley / |
070 | JN639364 | JN641921 |
|
AZ: Pima Co., Santa Catalina Mts., Ski Valley / |
071 | JN639365 | JN641922 |
|
AZ: Pima Co., Santa Catalina Mts., Ski Valley / |
072 / | JN639366 | JN641923 |
|
AZ: Gila Co., Pinal Mts., Icehouse Canyon FTrail 198 / |
081 | JN639375 | JN641932 |
|
AZ: Gila Co., Pinal Mts., Icehouse Canyon FTrail 198 / |
082 | JN639376 | JN641933 |
|
AZ: Gila Co., Pinal Mts., Icehouse Canyon FTrail 198 / |
083 | JN639377 | JN641934 |
|
AZ: Gila Co., Pinal Mts., Icehouse Canyon FTrail 198 / |
084 | JN639378 | JN641935 |
|
AZ: Gila Co., Pinal Mts., Icehouse Canyon FTrail 198 / |
085 | JN639379 | JN641936 |
|
AZ: Gila Co., Pinal Mts., Icehouse Canyon FTrail 198 / |
086 | JN639333 | JN641890 |
Study location
Phylogeographic patterns were examined by inferring phylogenetic relationships from mitochondrial sequence data from all specimens collected. The combined COI and ND1 data set (2678 characters) was partitioned in five unlinked subsets (COI pos 1 and 2, COI pos 3, ND1 pos 1 and 2, ND1 pos 3, mtRNA). Maximum likelihood models were selected using MODELTEST 3.7 (
Bayesian analyses were completed in MRBAYES 3.12 (
We inferred divergence dates of
Both maximum likelihood and Bayesian analyses of mtDNA found similar topologies. The best maximum likelihood tree (
Primers used for DNA amplification (PCR) and sequencing for the ND1 and COI mitochodrial genes.
|
|
|
|
---|---|---|---|
Cytochrome Oxidase I (COI) | SK (modification of TY-J-1460 (Simon et al. 1994)) | Forward | CGCTCTAGAACTAGTGGATCAANAAYCAYAARGAYATYG |
Pat (L2-N-3014 (Simon et al. 1994)) | Reverse | TCCAATGCACTAATCTGCCATATTA | |
Ron (C1-J-1751 (Simon et al. 1994)) | Forward | GGATCACCTGATATAGCATTCCC | |
Nancy (C1-N-2191 (Simon et al. 1994)) | Reverse | CCCGGTAAAATTAAAATATAAACTTC | |
NADH1 dehydrogenase (ND1) | ND1F | Forward | ACATGAATTGGAGCTCGACCAGT |
16sR (LR-N-12866 (Simon et al. 1994)) | Reverse | ACATGATCTGAGTTCAAACCGG |
Maximum likelihood tree of
Phylogeny of
Divergence time estimates for mtDNA lineages from BEAST reveal a deep and complex history of diversification (
Ages of selected nodes estimated from molecular data in
|
|
|
|
---|---|---|---|
A | Pinaleño vs western populations | 95,200 | 8,000–225,000 |
B | Huachuca vs Catalina 1 | 7,400 | 1,200–18,500 |
C | Huachuca vs Catalina 2 | 8,900 | 1,500–21,300 |
D | Catalina vs Pinal | 11,200 | 1,800–28,200 |
Our phylogenetic analyses indicated geographic and genetic structure within the
In this study we sampled only four of the six subspecies of
The distribution of genetic diversity in
The divergence time estimates suggested the Pinaleño population (
Several studies have focused on the biogeography of species on the Arizona Sky Island region including plants, arthropods, birds, lizards, and mammals (
Both recent and more ancient global climate changes could be the causal mechanisms underlying the history of habitat fragmentation in
The authors are deeply indebted to the work Ross and Joyce Bell have done on adephagan, rhysodine, and carabid systematics and natural history. It has formed the foundation of much of the work KAO has done on carabids, and it has truly inspired and facilitated her work in adephagan and carabid systematics. This paper is dedicated to the life and work of Ross and Joyce Bell. Some outgroup specimens were collected by Elizabeth Jockusch. The authors also thank the College of the Holy Cross, the Robert L. Ardizzone Faculty Excellence Fellowship, the Charles and Rosanna Batchelor Foundation Grant and the Richard B. Fisher Summer Research Fellowship for funding for this project. We thank Sean Devine and two anonymous reviewers for improvements to the manuscript.