Corresponding author: David R. Maddison (
Academic editor: Terry Erwin
The phylogeny of ground beetles of supertribe
Within trechites, evidence is presented that
The supertribe
The basic structure of the phylogeny of trechites is not well known. The only explicit, modern analyses have been based upon limited characters of adult and larval structure (
Phylogenies of
We present here the first detailed examination of relationships within
This paper has been over a decade in gestation, and some results have already been reported in other publications. For example, the discovery from the DNA sequence data reported herein of
Outgroup taxon sampling. Four-digit numbers in entries are D.R. Maddison voucher numbers; further information on the specimens is given in the Appendix; where two numbers are listed, the sequence was formed by combining data from both specimens. Other entries are GenBank numbers of previously published sequences from
|
|
|
|
---|---|---|---|
|
|||
AF002779 | AF398707 | AF398623 | |
|
|||
AF012484 | AF398683 | AF398566 | |
AF012482 | AF398648 | AF398601 | |
AF012481 | AF398640 | AF398602 | |
AF398722 | AF398692 | AF398603 | |
0669 | 2247 | 0669 | |
AF012483 | 2200 | 2200 | |
|
|||
AF012486 | AF398675 | AF398596 | |
AF002784 | AF398684 | 1627 | |
0893 | AF438100 | AF437971 | |
|
|||
AF012512 | AF398702 | AF398591 | |
|
|||
AF002785 | AF398699 | AF398587 | |
AF002786 | AF398700 | AF398613 | |
0631,1710 | 0631 | 0631 |
Within
Taxon sampling of trechites. Four-digit numbers in entries are D.R. Maddison voucher numbers; further information on the specimens is given in the Appendix; where two numbers are listed, the sequence was formed by combining data from both specimens. Other entries are GenBank numbers of previously published sequences from
|
|
|
|
---|---|---|---|
|
|||
1808 | 0691 | ||
0678 | AF438112 | AF437978 | |
1707 | 0824 | 1707 | |
0767 | |||
0823 | 0823 | ||
0705 | 0705 | 0705 | |
0606 | |||
1709 | 0723 | 1709 | |
1575 | 0762 | ||
|
|||
AF002793 | |||
AF398673 | 0587 | ||
0571 | 0571 | 0571 | |
1066 | |||
0670 | 0670 | ||
1076 | |||
0575 | 0575 | 0575 | |
|
|||
AF012487 | 0453 | 0453 | |
AF012488 | 0387 | 0387 | |
AF002787 | 0354 | 0354 | |
AF002788 | 0339 | 0339 | |
|
|||
AF002789 | AF438060 | AF437938 | |
1711 | 0679 | 0679 | |
0703 | 0530 | ||
|
|||
0988 | 0988 | 0988 | |
0605 | 0605 | ||
0410 | 0410 | ||
0411 | 0411 | 0411 | |
0761 | |||
0713 | 0713 | ||
AF002790 | 0429 | 0429 | |
0717, 0718 | 0718 | ||
0760 | |||
0604 | 0604 | ||
0573 | AF438141 | AF438002 | |
|
|||
AF012489 | 0409 | 0409 | |
0989 | 0989 | ||
0684 | 0684 | 0684 | |
0592 | 0592 | ||
|
|||
0690 | 0690 | ||
1084 | 1084 | ||
0572,1718 | 0572 | 0572 | |
0696 | |||
|
|||
0585 | 0585 | ||
0574 | |||
AF002792 | 0267 | 0267 | |
0576 | 0576 | ||
0569 | 0569 | ||
0776 | 0692 | ||
0603 | 0603 | ||
0714 | 0714 | ||
0916 | 0916 | ||
0602 | 0602 | ||
0444 | 0444 | ||
EF648613 | EF648838 | EF649474 | |
EF648618 | EF648837 | EF649481 | |
0896 | 0896 | ||
EF648659 | EF649056 | EF649609 | |
EF648620 | EF648842 | EF649480 | |
0763 | 0763 | ||
AF012490 | 0260 | 0262 | |
0895 | 0895 | ||
0601 | 0601 | ||
0676 | 0676 | 0676 | |
0607 | 0607 | 0607 | |
0595 | 0595 | 0595 |
Locality information for the specimens newly sequenced in this paper is given in the Appendix. Voucher specimens are deposited in the David Maddison voucher collection in the Oregon State Arthropod Collection at Oregon State University.
Primers used for DNA amplification and sequencing. Dir: direction of primer, either forward (F) or reverse (R). Syn: primer synonym. Kind: primer used for original PCR amplification and sequencing (A) or primer used only for sequencing (S). Original references for primer sequences are given in
Gene | Primer | Syn | Dir | Kind | Sequence |
---|---|---|---|---|---|
28S | LS58F | D1 | F | A | GGGAGGAAAAGAAACTAAC |
LS998R | D3 | R | A | GCATAGTTCACCATCTTTC | |
18S | SS27F | 518S | F | A | TATGCTTGTCTCAAAGATTAA |
S1893R | 18L | R | A | CACCYACGGAAACCTTGTTACGACTT | |
SS398F | 18Sai | F | S | CCTGAGAAACGGCTACCACATC | |
SS1054F | 760F | F | S | ATCAAGAACGAAAGT | |
SS1090R | 18Sbi | R | S | GAGTCTCGTTCGTTATCGGA | |
SS1554R | 909R | R | S | GTCCTGTTCCATTATTCCAT | |
wg | wg550F | F | A | ATGCGTCAGGARTGYAARTGYCAYGGYATGTC | |
wgAbRZ | R | A | CACTTNACYTCRCARCACCARTG | ||
wg578F | F | A | TGCACNGTGAARACYTGCTGGATG | ||
wgAbR | R | A | YTCGCAGCACCARTGGAA | ||
B5wg1 | F | A | GARTGYAAGTGTCAYGGYATGTCTGG | ||
5wg | F | A | GARTGYAARTCYCAYGGYATGTCTGG | ||
5wgB | F | A | ACBTGYTGGATGCGNCTKCC | ||
3wg2 | R | A | CTCGCARCACCARTGGAATGTRCA | ||
B3wg2 | R | A | ACTCGCARCACCAGTGGAATGTRCA | ||
3wg | R | A | ACTCGCARCACCARTGGAATGTRCA |
Assembly of multiple chromatograms for each gene fragment and initial base calls were made with Sequencher (Gene Codes Corporation) or using Phred (
Newly obtained sequences have been deposited in GenBank with accession numbers GU556024 through GU556153.
The amino acid translation of the
Most-parsimonious trees were sought using PAUP* (
For parsimony bootstrap analyses in PAUP*, 1000 bootstrap replicates were conducted, each of which used a heuristic search with five replicates, each beginning with a starting tree formed by the random addition sequence option, with TBR branch rearrangement, with each replicate saving no more than 25 trees.
Models of nucleotide evolution chosen with the aid of ModelTest (
Bayesian analyses were conducted using MrBayes (
Likelihood analyses of nucleotide data were conducted using RAxML version 7.0.4 (
Several of the analyses of 18S rDNA yielded trees with the trechine
All trees are shown rooted within the outgroup, arbitrarily next to
Grebennikov’s (2008) larval morphological data were reanalyzed using TNT version 1.1 (
Phylogenetic trees inferred from individual genes are shown in
Majority-rule consensus tree of trees sampled in Bayesian analysis, with branch lengths proportional to average branch lengths across trees that contain that branch, for 28S rDNA data. Branch lengths were reconstructed by MrBayes; scale bar units are substitutions per site. Thickness and shade of branches indicate support for that clade, based upon estimated Bayesian Posterior Probability percentages (BPP), Maximum Likelihood bootstrap values (MLBoot), and parsimony bootstrap values (parsBoot).
Majority-rule consensus tree of trees sampled in Bayesian analysis, with branch lengths proportional to average branch lengths across trees that contain that branch, for 18S rDNA data. See caption of Fig. 2 for additional details.
Majority-rule consensus tree of trees sampled in Bayesian analysis, with branch lengths proportional to average branch lengths across trees that contain that branch, for the complete
Majority-rule consensus tree of trees sampled in Bayesian analysis for all three genes analyzed together. Ovals on branches indicate support for the clade based upon Bayesian (left), maximum likelihood (center), and parsimony (right) analyses. Darkest tones indicate strongest support for (grays and black) or against (pinks) the clade, with values indicating posterior probability expressed as a percentage (Bayesian), or bootstrap percentage (likelihood and parsimony).
Support values for various groups outside of
|
|
|
|
|
|||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
B | ML | P | B | ML | P | B | ML | P | B | ML | P | B | ML | P | |
|
100 | 100 | 100 | 100 | 100 | 100 | 100 | 100 | 100 | -100 | -78 | -75 | x | ✓ | |
100 | 99 | 70 | 100 | 99 | 70 | 56 | x | x | 88 | ✓ | 88 | ✓ | ✓ | ||
100 | 92 | 80 | 54 | 58 | 66 | -66 | x | x | 100 | 58 | 100 | 59 | ✓ | ||
|
100 | 93 | 66 | 100 | 70 | 53 | -66 | x | x | 100 | 77 | 100 | 75 | ✓ | |
|
99 | 79 | 86 | 100 | 83 | 64 | -66 | x | x | 100 | 98 | 78 | 100 | 98 | 75 |
|
100 | 95 | 98 | 62 | 70 | 96 | 100 | 80 | 70 | 100 | 99 | 80 | 100 | 100 | 79 |
|
94 | 64 | 78 | -66 | x | ✓ | -89 | x | x | 100 | 82 | 100 | 79 | ||
99 | 79 | 86 | 100 | 83 | 64 | 95 | ✓ | 60 | - | - | - | - | - | - | |
|
100 | 100 | 100 | 100 | 98 | 97 | 100 | 72 | 72 | 100 | 100 | 100 | 100 | 100 | 100 |
|
100 | 100 | 100 | 100 | 96 | 96 | 100 | 100 | 100 | 100 | 99 | 97 | 100 | 97 | 92 |
Support values for various groups of
|
|
|
|
|
|||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
B | ML | P | B | ML | P | B | ML | P | B | ML | P | B | ML | P | |
-88 | x | x | -85 | x | x | -98 | x | x | -100 | -63 | x | -100 | -56 | x | |
100 | 92 | 85 | 100 | 72 | 66 | -62 | x | x | 68 | x | x | 80 | ✓ | ✓ | |
|
100 | 88 | x | 99 | 67 | x | -62 | x | x | 99 | ✓ | x | 87 | ✓ | x |
|
100 | 99 | 100 | 100 | 80 | 75 | 89 | 71 | 69 | 99 | 88 | 85 | 100 | 88 | 89 |
87 | ✓ | ✓ | 93 | ✓ | ✓ | - | - | - | - | - | - | - | - | - | |
x | x | x | x | - | - | - | - | x | 51 | x | x | ||||
91 | ✓ | ✓ | x | x | 100 | 76 | 78 | 100 | ✓ | ✓ | 89 | x | x | ||
75 | x | ✓ | x | -54 | x | -57 | 89 | ✓ | ✓ | 83 | x | ||||
100 | 91 | 89 | 91 | ✓ | ✓ | 100 | 98 | 98 | 100 | 98 | 96 | 100 | 95 | 93 | |
100 | 91 | 89 | 52 | ✓ | ✓ | -100 | -91 | -91 | 100 | 98 | 96 | 100 | 95 | 93 | |
100 | 87 | 88 | 91 | ✓ | ✓ | 100 | 98 | 98 | 98 | 60 | 67 | 97 | 57 | 66 | |
100 | 84 | 64 | 99 | 79 | 78 | - | - | - | 99 | ✓ | ✓ | 93 | ✓ | ✓ |
Summary of subtribal and tribal relationships supported by individual genes. Triangles indicate monophyletic groups; quadrangles represent paraphyletic groups
Summary of relationships in
Support values for various groups in analyses of 18S constrained to keep
Results for the reanalysis of Grebennikov’s (2008) larval data are presented in
Support values for various groups outside of
|
|
|
|||||||
---|---|---|---|---|---|---|---|---|---|
B | ML | P | B | ML | P | B | ML | P | |
56 | x | x | 59 | x | -63 | 50 | ✓ | x | |
-66 | x | x | 99 | 95 | 94 | 94 | ✓ | 53 | |
|
-66 | x | x | n/a | n/a | n/a | x | ✓ | |
|
-66 | x | x | -85 | x | ✓ | n/a | n/a | n/a |
|
100 | 80 | 70 | 99 | 82 | 69 | 99 | 82 | 70 |
|
-89 | x | x | -85 | x | 64 | 3 | x | |
95 | ✓ | 60 | 89 | ✓ | 67 | 100 | 76 | 84 |
We here discuss in turn the evidence available for various relationships within trechites. As significant results have been found within the outgroups sampled, we will discuss these first.
Among the carabids currently considered to belong to
Our data indicate that
Our results indicate strong support for monophyly of
Consistent with most morphological data, our 28S and
Shared derived characters that provide evidence for monophyly of
The primary synapomorphy suggesting the monophyly of
Our results from 28S,
In Jeannel’s great work
In recent years larval structure and DNA sequences have been used in a few explicit phylogenetic studies within trechines. The most complete available larval data (
Our results (
In the original description of
Although our study cannot be a strong test of the monophyly of zolines, as we do not have members of two subtribes (
As delimited in this paper,
Our results are consistent with the view that
This subtribe was established by
Monophyly of
Bayesian analysis of 28S,
Most anillines are minute, blind, wingless, pale inhabitants of soil and deep leaf litter; members of a few genera have small eyes, e.g.,
If
The exclusion of anillines from the
The majority of species within subtribe
More recently, other groups have been excluded from
Our data suggest that some of these smaller genera are indeed outside of
On the other hand, some of the groups that have been recently considered outside of
When described,
The only well-supported result we obtained about the relationships between the tribes or subtribes of trechites was the sister-group relationship between
While our results have clarified the position of a number of enigmatic lineages within
Future work should increase taxon sampling, to split long branches in the tree, and add missing lineages. Additional genes, especially those with relatively longer lengths for the deeper branches (such as those seen in
Our heartfelt thanks go to Ross and Joyce Bell, who have provided inspiration over the years to both of us, through their excellent work and generous natures.
Many people aided this project by providing valuable specimens, and we thank them all: David Kavanaugh, Alfred Newton, Margaret Thayer, Wendy Moore, Geoff Monteith, Wayne Maddison, Konjev Desender, Betsy Arnold, Julia Amerongen Maddison, A.S. Gerber, P.M. Johns, Allan Ashworth, Matthias Hartmann, J. M. Pérez Zaballos, J.I. Townsend, Wolfgang Dormann, Dietrich Mossakowski, D.J. Cook, S. Endrödy-Younga, O. Junco, W. Reeves, Rich Leschen, Chuck Bellamy, Karl Kjer, Roger Blahnik, Vasily Grebennikov, and Kipling Will.
For help in identifying specimens, we thank Terry Erwin, Konjev Desender, J. M. Pérez Zaballos, Matthias Hartmann, Paolo Bonavita, Geoff Monteith, Igor Sokolov, and Vasily Grebennikov.
I thank Vasily Grebennikov for making the original data matrix available from his 2008 study. Thanks as well to the Willi Hennig Society for making TNT available through its sponsorship.
This project was funded primarily by NSF grants DEB-9420219 and DEB-9981935 to DRM, as well as funds generously provided by the University of Arizona, and the Harold E. and Leona M. Rice Endowment Fund at Oregon State University.
Locality data for specimens sequenced in this study. # is the D.R. Maddison voucher number.
|
|
|
---|---|---|
|
||
|
0669 | Australia: North Queensland: Devil’s Thumb via Mossman |
2247 | Australia: North Queensland: Upper Whitehall Gully | |
2200 | Chile: Reg. IX: Parque Nacional Nahuelbuta | |
|
||
|
1627 | USA: New Mexico: Gila National Forest, Pine Flats Campground |
|
0893 | USA: Arizona: Pima Co., Rincon Peak |
|
||
1808, 0691 | México: Sonora: Alamos, Rio Cuchujaqui | |
0678 | Republic of South Africa: Kwazulu-Natal, Ngome Forest Reserve | |
|
1707 | Spain: Madrid: Rio Cofio |
|
0824 | Russia: NW Caucasus: Krasnodar Dist., r. Belaya, Nikel |
|
0767 | Australia: Queensland: Gray’s Waterhole, Gayndah. |
|
0823 | Russia: NW Caucasus: Krasnodar Dist., r. Belaya, Nikel |
|
0705 | Australia: Queensland: Cow Bay |
|
0606 | Madagascar: Fianarantsoa Province: Ranomafana National Park |
1709 | Republic of South Africa: North Cape Prov.: Farm Klipdam | |
|
1575, 0762 | Australia: Queensland: Gayndah,Gray’s Waterhole |
|
||
|
0587 | USA: Montana: Glacier Co., Divide Creek |
|
0571 | Chile: Malleco Pr.: Coimallin area, 8.2 km NW Los Portones |
|
1066 | Chile: Malleco Pr.: Coimallin area, 8.2 km NW Los Portones |
|
0670 | Argentina: Tierra Del Fuego: 78 km E. of Ushuaia. |
1076 | Costa Rica: Cerro de la Muerte | |
|
0575 | Chile: Palena Pr.: Austral Highway km 67.9 (11 km S. Contao turnoff) |
|
||
|
0453 | Chile: Valdivia Province: Rincón de la Piedra, 14.8 km SE Valdivia |
0387 | New Zealand: South Island, Canterbury Prov, Arthur’s Pass Nat. Park | |
|
0354 | New Zealand: South Island, Canterbury Prov, Arthur’s Pass Nat. Park |
|
0339 | Australia: Tasmania: Mount Field N.P., Lake Dobson Rd., E end Wombat Moor |
|
||
|
1711, 0679 | Spain: Cádiz: El Puerto de Sta. Maria |
|
0703, 0530 | USA: California: Marin Co., Tiburon Peninsula |
|
||
0988 | Malaysia: Sabah: Kinabatangan River | |
0605 | USA: Arizona: Pima Co., Tucson | |
|
0410 | USA: Arizona: Santa Cruz Co., Santa Cruz River near Tumacacori |
|
0411 | USA: Arizona: Santa Cruz Co., Santa Cruz River near Tumacacori |
0761 | Republic of South Africa: Kwa-Zulu-Natal: Near Bayala | |
0713 | Republic of South Africa: North Cape Prov.: Farm Klipdam | |
|
0429 | USA: Arizona: Pima Co., Arivaca Creek |
|
0717, 0718 | USA: Arizona: Gila Co., Gila River near Winkelman |
|
0760 | USA: California: San Diego Co., Batiquitos Lagoon |
|
0604 | USA: Arizona: Gila Co., Winkelman |
|
0573 | USA: Mississippi: Noxubee Co., Noxubee Nat. Wildlife Refuge |
|
||
|
0409 | Ecuador: Sucumbios: Cuyabeno Faunal Reserve |
|
0989 | Ecuador: Orellana Province: Tiputini |
|
0684 | USA: Mississippi: Noxubee Co., Noxubee Nat. Wildlife Refuge |
|
0592 | Australia: Queensland: Mt. Lewis Rd |
|
||
0690 | USA: Georgia: Habersham Co., Big Panther Creek Trail | |
1084 | USA: North Carolina: Graham Co., Santeetlah Lake | |
|
0572, 1718 | Spain: Cádiz: Tarifa |
0696 | New Zealand: 3.5 km N Rapahoe | |
|
||
|
0585 | USA: Alaska: mile 412.3 Dalton Highway |
|
0574 | Nepal: Prov. Karnali, Dolpo, Tripurakot Flußufer |
|
0267 | USA: Massachusetts: Norfolk Co., Jamaica Plain |
0576 | USA: Utah: Abajo Mountains | |
|
0569 | Belgium: Schorisse |
|
0776 | USA: California: Del Norte Co., Smith River |
|
0692 | USA: Montana: Jefferson Co., Boulder River at Galena Gulch |
|
0603 | Italy: Tuscany: Vallombrosa |
0714 | Peru: Pisac, tributary of Rio Urubamba, 3020m | |
0916 | China: Yunnan Prov.: Gaoligong Shan, Nujiang Prefecture, 13.5 air km SSW of Gof Gonshan | |
|
0602 | Germany: Wadden Sea, Mellum Island |
|
0444 | USA: Arizona: Cochise Co., 2.2 km S of Willcox |
|
0896 | USA: Washington: Columbia Co., Blue Mountains |
|
0763 | USA: Nebraska: Lancaster Co., Lincoln |
|
0260 | USA: Arizona: Cochise Co., Turkey Creek, Chiricahua Mtns |
|
0895 | Canada: Ontario: Burlington |
|
0601 | Canada: British Columbia: Alexander Creek on highway 3 |
|
0676 | Canada: Alberta: Bayette Lake near Flatbush |
|
0607 | New Zealand: Tekapo River Delta, Lake Benmore |
0595 | New Zealand: Foxton Beach, Manuwatu |