Research Article |
Corresponding author: Sohath Yusseff-Vanegas ( sohath.yusseff@gmail.com ) Academic editor: Pierfilippo Cerretti
© 2016 Sohath Yusseff-Vanegas, Ingi Agnarsson.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Yusseff-Vanegas S, Agnarsson I (2016) Molecular phylogeny of the forensically important genus Cochliomyia (Diptera: Calliphoridae). ZooKeys 609: 107-120. https://doi.org/10.3897/zookeys.609.8638
|
Cochliomyia Townsend includes several abundant and one of the most broadly distributed, blow flies in the Americas, and is of significant economic and forensic importance. For decades, Cochliomyia hominivorax (Coquerel) and C. macellaria (Fabricius) have received attention as livestock parasites and primary indicator species in forensic entomology. However, C. minima Shannon and C. aldrichi Del Ponte have only been subject to basic taxonomy and faunistic studies. Here we present the first complete phylogeny of Cochliomyia including numerous specimens per species, collected from 13 localities in the Caribbean. Four genes, the mitochondrial COI and the nuclear EF-1α, 28S rRNA, and ITS2, were analyzed. While we found some differences among gene trees, a concatenated gene matrix recovered a robustly supported monophyletic Cochliomyia with Compsomyiops Townsend as its sister group and recovered the monophyly of C. hominivorax, C. macellaria and C. minima. Our results support a close relationship between C. minima and C. aldrichi. However, we found C. aldrichi containing C. minima, indicating recent speciation, or issues with the taxonomy of the group. We provide basic information on habitat preference, distribution and feeding habits of C. minima and C. aldrichi that will be useful for future forensic studies in the Caribbean.
Forensic entomology, Caribbean region, habitat preferences, Cochliomyia minima , Cochliomyia aldrichi , Cochliomyia macellaria , Cochliomyia hominivorax
Cochliomyia Townsend is endemic to the Americas and includes only four species: Cochliomyia minima Shannon, C. aldrichi Del Ponte, C. macellaria (Fabricius) and C. hominivorax (Coquerel). All of them are flesh eaters during their larval stage and are locally abundant. In particular, Cochliomyia macellaria is one of the most broadly distributed blow flies in the New World (
Cochliomyia hominivorax and C. macellaria have been intensely studied due to their commercial and forensic importance. Cochliomyia macellaria is one of the most forensically important species commonly found on decomposing remains. This species is considered important for post mortem interval estimations (
The other two congeners, C. minima and C. aldrichi, are poorly known and research has been limited to descriptive morphology and faunistics (
Although the adult morphology of the four species is well known (
Here we provide a robust phylogenetic hypothesis of Cochliomyia based on four genes sequenced from 38 individuals collected throughout the Caribbean, including for the first time molecular data about C. minima and C. aldrichi. Our main goals are to test the monophyly of this genus and the validity of, and relationships among, its species.
A total of 44 specimens were included in this study, 38 representing the ingroup plus six outgroup species [Chrysomya megacephala (Fabricius), C. rufifacies (Macquart), Hemilucilia sp., Lucilia cuprina (Wiedemann), Compsomyiops fulvicrura (Robineau-Desvoidy) and Compsomyiops callipes (Bigot)]. All sequences used here are new except for Compsomyiops fulviclura and C. callipes (Table
Species name – Voucher Number | Location | CO1 | EF-1α | ITS2 | 28S rRNA |
---|---|---|---|---|---|
Cochliomyia macellaria CO002 | Colombia, El refugio Dry Forest | KX529522 | KX529616 | KX529574 | KX529487 |
Cochliomyia macellaria CO010 | Colombia, Choco, Jardín botánico del Pacífico | KX529545 | KX529617 | KX529575 | KX529488 |
Cochliomyia macellaria CO017 | Colombia, Santander, Chipatá, Finca el Castillo | KX529543 | KX529618 | KX529576 | KX529489 |
Cochliomyia macellaria ME015* | Mexico, Torreon, Coahuila | KX529546 | KX529629 | KX529588 | KX529492 |
Cochliomyia macellaria FL006 | USA, Florida, Everglades National Park, Northeast | KX529535 | KX529623 | KX529581 | KX529503 |
Cochliomyia macellaria JA002 | Jamaica, Marshall’s Pen House | KX529538 | KX529624 | KX529582 | KX529502 |
Cochliomyia macellaria CU018 | Cuba, Pinar del Rio, Viñales Nacional Park | KX529526 | KX529620 | KX529578 | KX529499 |
Cochliomyia macellaria CU014 | Cuba, Pinar del Rio, Viñales Nacional Park | KX529541 | KX529619 | KX529577 | KX529497 |
Cochliomyia macellaria DR134 | Dominican Republic, Puerto Plata | KX529527 | KX529622 | KX529580 | KX529504 |
Cochliomyia macellaria DR010 | Dominican Republic, El Morro, Monte Cristi | KX529536 | KX529621 | KX529579 | KX529496 |
Cochliomyia macellaria PR129 | Puerto Rico, Vieques, Monte Pirata | KX529542 | - | KX529591 | KX529501 |
Cochliomyia macellaria PR128 | Puerto Rico, Vieques, Monte Pirata | KX529540 | - | KX529590 | KX529494 |
Cochliomyia macellaria PR121 | Puerto Rico, Trujillo Alto, Ciudad Universitaria | KX529544 | KX529630 | KX529589 | KX529500 |
Cochliomyia macellaria M112 | Puerto Rico, Isla de Mona, Los Caobos | KX529528 | - | KX529587 | KX529493 |
Cochliomyia macellaria M081 | Puerto Rico, Isla de Mona, Los Caobos | KX529537 | KX529628 | KX529586 | KX529498 |
Cochliomyia macellaria M077 | Puerto Rico, Isla de Mona, Bajuras - Cerezos | KX529539 | KX529627 | KX529585 | KX529495 |
Cochliomyia macellaria LA142 | Saint Barts, Colombier Deciduos Dry Forest | KX529523 | KX529631 | KX529592 | - |
Cochliomyia macellaria LA096 | Martinique, Cap de Macré Coastal Forest | KX529524 | KX529626 | KX529584 | KX529491 |
Cochliomyia macellaria LA071 | Dominica, Middleham Falls Trail | KX529525 | KX529625 | KX529583 | KX529490 |
Cochliomyia aldrichi M080 | Puerto Rico, Isla de Mona, Near Cueva Portugues | KX529529 | KX529605 | KX529563 | KX529513 |
Cochliomyia aldrichi M085 | Puerto Rico, Isla de Mona, Los Caobos | KX529530 | KX529606 | KX529564 | KX529515 |
Cochliomyia aldrichi M086 | Puerto Rico, Isla de Mona, Camino del Indio | KX529531 | KX529607 | KX529565 | KX529514 |
Cochliomyia aldrichi M103 | Puerto Rico, Isla de Mona, Los Caobos | KX529532 | KX529608 | KX529566 | KX529516 |
Cochliomyia aldrichi M105 | Puerto Rico, Isla de Mona, Near Cueva Portugues | KX529533 | KX529609 | KX529567 | KX529518 |
Cochliomyia aldrichi M107 | Puerto Rico, Isla de Mona, Near Cueva Portugues | KX529534 | KX529610 | KX529568 | KX529517 |
Cochliomyia minima CU046 | Cuba, Guantanamo, Alejandro de Humboldt National Park | KX529547 | KX529633 | KX529595 | KX529510 |
Cochliomyia minima CU022 | Cuba, Pinar del Rio, Viñales National Park | KX529549 | KX529632 | KX529593 | KX529511 |
Cochliomyia minima CU023 | Cuba, Pinar del Rio, Viñales National Park | KX529550 | - | KX529594 | KX529508 |
Cochliomyia minima DR136 | Dominican Republic, Puerto Plata | KX529548 | KX529635 | KX529597 | KX529509 |
Cochliomyia minima DR055 | Dominican Republic, Haitises National Park | KX529552 | KX529634 | KX529596 | KX529507 |
Cochliomyia minima PR141 | Puerto Rico, Loiza, Mangrove area | KX529551 | - | KX529600 | KX529512 |
Cochliomyia minima PR132 | Puerto Rico, Loiza, Mangrove area | KX529553 | KX529636 | KX529598 | - |
Cochliomyia minima PR133 | Puerto Rico, Vieques, Monte Pirata | KX529554 | KX529637 | KX529599 | KX529506 |
Cochliomyia hominivorax CO001 | Colombia, El refugio Dry Forest | - | KX529611 | KX529569 | KX529482 |
Cochliomyia hominivorax CU020 | Cuba, Pinar del Rio, Viñales Nacional Park | - | KX529612 | KX529570 | KX529483 |
Cochliomyia hominivorax CU033 | Cuba, Pinar del Rio, Viñales Nacional Park | KX529556 | KX529613 | KX529571 | KX529484 |
Cochliomyia hominivorax DR042 | Dominican Republic, Rabo de Gato | KX529557 | KX529614 | KX529572 | KX529485 |
Cochliomyia hominivorax DR105 | Dominican Republic, East National Park, Yuma | KX529558 | KX529615 | KX529573 | KX529486 |
Chrysomya megacephala FL003 | USA, Florida, Everglades National Park, Northeast | KX529521 | KX529603 | KX529561 | KX529480 |
Chrysomya rufifacies CU004 | Cuba, Granma: Turquino National Park | KX529555 | KX529604 | KX529562 | KX529481 |
Hemilucilia sp. CO018 | Colombia, Santander, Chipatá, Finca el Castillo | KX529560 | KX529638 | KX529601 | KX529519 |
Lucilia cuprina PR073 | Puerto Rico, Trujillo Alto, Ciudad Universitaria | KX529559 | KX529639 | KX529602 | KX529520 |
Compsomyiops fulvicrura | As Published ( |
FJ025607 | FJ025667 | - | FJ025504 |
Compsomyiops callipes | As Published ( |
AF295549 | - | - | - |
We amplified regions of three nuclear loci: the protein coding elongation factor-1 alpha (EF-1α), the ribosomal 28S, and internal transcribed spacer 2 (ITS2), plus the mitochondrial protein coding cytochrome oxidase I (COI). The primer sequences are listed in Table
Gene | Primer name | Sequence (5’ to 3’) | Source |
---|---|---|---|
COI | LCO1490 | GGTCAACAAATCATAAAGATATTGG |
|
CI-N-2776 | GGATAATCAGAATATCGTCGAGG |
|
|
EF-1α | B1 | CCCATYTCCGGHTGGCACGG |
|
C1 | CTCTCATGTCACGDACRGCG |
|
|
28S | D1.F | CCCCCTGAATTTAAGCATAT |
|
D35.486.R | TCGGAAGGAACCAGCTACTA |
|
|
ITS | ITS4 | TCCTCCGCTTATTGATATGC |
|
ITS5.8 | GGGACGATGAAGAACGCAGC |
|
We partitioned each gene and codon position for a total of eight partitions that were exported from Mesquite for model choice and the appropriate models were chosen using jModeltest v2.1.4 (
The phylogenetic analyses of the concatenated matrix, either using Bayesian or maximum likelihood approaches, recovered a generally well supported monophyletic Cochliomyia (Fig.
Phylogenetic relationship within Cochliomyia (ingroup) based on partitioned Bayesian analysis of the combined gene (COI, EF-1α, 28S rRNA and ITS2) data set. Branch support values: normal fond, Bayesian posterior probability; bold-italic font, maximum likelihood percentage bootstrap. Each color represents different species.
Independent analyses of 28S and ITS2 supported the monophyly of Cochliomyia, while COI and EF-1α recovered it as a paraphyletic group (Suppl. material
The concatenated dataset yielded a topology supporting a close relationship between C. minima and C. aldrichi which is congruent with the current taxonomy and indicates C. macellaria as the sister lineage of these two.
We present the first species complete phylogeny of the genus Cochliomyia including samples collected throughout the Caribbean from 13 different localities (Table
Independent gene trees did not yield fully congruent relationships among species, unsurprising as genes have independent histories. Two nuclear genes, 28S and ITS2 (adjacent loci), strongly supported the monophyly of Cochliomyia while the other two genes, COI and EF-1α did not. These results differ from
The monophyly of C. hominivorax is supported in all analyses, however, independent gene trees were not congruent with regards to other species. The relatively slowly evolving nuclear genes EF-1α and 28S supported C. macellaria but failed to distinguish between C. minima and C. aldrichi. The relatively rapidly evolving COI “DNA barcode” was found suitable for species identification and delineation (
Despite the incongruence detected between the four genes, a concatenate matrix recovered the monophyly of C. hominivorax, C. macellaria and C. minima, and supported the monophyly of C. minima plus C. aldrichi, mostly congruent with the current taxonomy. However, we found that C. minima is nested within C. aldrichi. That one species is paraphyletic with respect to another is not unexpected and does not necessarily refute their species status. The non-monophyly of C. aldrichi is surprising in that all specimens included in this study were collected from the tiny Mona Island (22 square miles). This indicates incomplete lineage sorting, or possibly recent speciation, rather than other processes like gene flow among species (given Mona’s isolation, expectation of panmixia among C. aldrichi on the tiny island, and absence of C. aldrichi from other islands sampled). In contrast, C. macellaria and C. minima are present on most of the islands (Table
The variability in feeding habits, habitat preference and morphology within Cochliomyia is considerable (Fig.
Variability in feeding habits, habitat preference and morphology within Cochliomyia. *C. aldrichi has been reported in the Florida Keys Islands. **We refer to temperatures around 10–15 °C. ● Carrion feeder; ▴ primary facultative parasite; ■ secondary facultative parasite; ★ obligate parasite.
The habitat preferences of C. hominivorax and C. macellaria are largely known (
Two of the four species, C. minima and C. aldrichi are Caribbean endemics while the other two are widespread (Figs
We provide the first complete phylogeny of Cochliomyia, supporting its monophyly and placement within the subfamily Chrysomyinae. Given incongruence among gene trees and low level of information at the species level for slowly evolving genes, the resolution of the outstanding questions in Cochliomyia phylogeny will require more data rich approaches, such as those offered by NGS methods. Nevertheless, we advance knowledge on the phylogeny, distribution, and life history of these species that should prove useful in future research and in realizing the potential of these species as forensic insects.
We would like to thank all the members of the CarBio team for their valuable collecting efforts, especially those involved in expeditions in Puerto Rico (2011), the Dominican Republic (2012) Cuba (2012), Jamaica (2013), Lesser Antilles (2013), North America (2013) and Colombia (2014). We would also like to thanks Fabián García Espinoza from Universidad Antonio Narro Unidad Laguna for supplying specimens from Mexico and to Molly Mactaggart for collecting specimens from Bahamas (2015). We are especially grateful to the following for help with organizing fieldwork Alexander Sanchez (Cuba), Lauren Esposito, Gabriel de los Santos, Solanlly Carrero, and Kelvin Guerrero (Dominican Republic), Lauren Esposito (Jamaica, Colombia and the Lesser Antilles). Our sincere thanks to all our CarBio collaborators for participation in these fieldtrips and research (see islandbiogeography.org). Many current and graduated members of the Agnarsson and the Binford labs were also instrumental in organizing and executing fieldwork including Lisa Chamberland, Federico Lopez-Osorio, Carol Yablonsky, Laura Caicedo-Quiroga, Jose Sanchez, Angela Alicea, Trevor Bloom, Ian Petersen, Alex Nishita, Katy Loubet-Senear, Angela Chuang, Anne McHugh, Micah Machina and many more. Thanks to Sean Kelly, Rebecca Rivera, Ricardo Burgos and to members of the Agnarsson laboratory for comments that improved this manuscript, Laura May–Collado, Lisa Chamberland, Laura Caicedo, Federico López-Osorio, Jie Lui, Muhammad Kala and Gabriel Melo Alves dos Santos. We also would like to thank the undergraduate students, Cole Rachman and Omar Neyra who performed some of the DNA extraction and help in the sorting and identification process. All material was collected under appropriate collection permits and approved guidelines. Funding for this work comes from National Science Foundation (DEB-1314749 and DEB-1050253) to I. Agnarsson and G. Binford. Development of this project was further supported by a UVM APLE grant to Omar Neyra. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Phylogenetic relationship within Cochliomyia (ingroup) based on a Bayesian analysis of nucleotide data from (a) 28S, (b) COI, (c) EF-1α and (d) ITS2
Data type: molecular data
Explanation note: Numbers indicate posterior probability support values.