Research Article |
Corresponding author: Haijun Zhang ( haijunzhang@163.com ) Academic editor: Saskia Brix
© 2016 Xuexia Geng, Ruixue Cheng, Tianyi Xiang, Bin Deng, Yaling Wang, Daogui Deng, Haijun Zhang.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Geng X, Cheng R, Xiang T, Deng B, Wanga Y, Deng D, Zhang H (2016) The complete mitochondrial genome of the Chinese Daphnia pulex (Cladocera, Daphniidae). ZooKeys 615: 47-60. https://doi.org/10.3897/zookeys.615.8581
|
Daphnia pulex has played an important role in fresh-water ecosystems. In this study, the complete mitochondrial genome of Daphnia pulex from Chaohu, China was sequenced for the first time. It was accomplished using long-PCR methods and a primer-walking sequencing strategy with genus-specific primers. The mitogenome was found to be 15,306 bp in length. It contained 13 protein-coding genes, two rRNA genes, 22 tRNA genes and a typical control region. This research revealed an overall A+T content of 64.50%. All of the 22 typical animal tRNA genes had a classical clover-leaf structure except for trnS1, in which its DHU arm simply formed a loop. The lengths of small and large rRNA were 744 bp and 1,313 bp, respectively. The A+T-rich region was 723 bp in length, which is longer than that from the North American species (689 bp). In terms of structure and composition, many similarities were found between the Chinese and North American Daphnia pulex.
Daphnia pulex , gene order, mitochondrial genome, secondary structure
Cladocerans (“water fleas”) are an important component of the microcrustacean zooplankton. Their habitats are mostly continental fresh and saline waters (
The sequence and structure of mitochondrial genomes has been frequently used to study phylogenetic relationships of animal taxa. More specifically, the unusual characters of mitochondrial genome DNA, for instance its small size, fast evolutionary rate, simple structure, maternal inheritance and high informational content, have been widely regarded as a molecular marker for phylogenetic analysis (
All metazoan animals contain their own circular mitochondrial genome with two strands (a J-strand and an N-strand) (Simon et al. 2014), which range from 14 kb to 42 kb in length (
The main purpose of this study was to disclose the complete mitochondrial genome sequence of the Chinese Daphnia pulex for the first time, and to compare its features with other available cladoceran mitochondrial genomes.
This study also served as a useful source of information for both nuclear and mitochondrial markers in comparative analyses of the evolution of mitochondrial genomes in Cladocerans.
Total DNA was extracted from individual specimens using a TIANamp Micro DNA Kit (TIANGEN BIOTECH (BEIJING) CO., LTD) following manufacturer protocols. DNA samples were stored at -20 °C until further use.
The Daphnia pulex mitochondrial genome was amplified using five pairs of primers (Table
Details of the primers used to amplify the mitogenome of Chinese Daphnia pulex.
Primer pair | Size (bp) | Primer sequence(5’-3’) |
---|---|---|
F1 | AGAAGGGAATTTGAGCTCTTTTWGT | |
R1 | 5450 | TTACCCTAGGGATAACAGCGTAA |
F2 | TCGTCTCGTCATTCATACCAGC | |
R2 | 2221 | GTGCCAGCAGYYGCGGTTANAC |
F3 | ATAAYAGGGTATCTAATCCTRGT | |
R3 | 3122 | ACTTCCWGATTGTCCYAAYTC |
F4 | ACTACCCGCAAACGATCTGG | |
R4 | 4000 | TGGGATGGGTTGGGGCTAAT |
F5 | AGCCCCAAAAATTGGATTTCCC | |
R5 | 750 | TGGCTTCGGCAACGGATAG |
The PCRs were performed by using an Eppendorf Thermal Cycler (5331AH760577, Eppendorf, Germany) with a 25 µL volume reaction mixture containing 2.5 µL 10×LA-Taq Buffer II(Mg2+ plus), 4 µL dNTP Mixture (2.5 mM), 2 µL DMSO, 1 µL genomic DNA, 1 µL 10 µM of each primer, 0.5 µL MgCl2 (25 mM) and 0.25 µL 2.5 units of LA Taq polymerase (TaKaRa Biomedical, Japan), and 12.25 µL distilled water.
The reaction conditions were one cycle of denaturation at 95 °C 5 min, 35 cycles of denaturation at 95 °C 30 s, annealing at 50 °C 30 s, extension at 72 °C for 2 to 8 min and a final extension at 72 °C for 10 min. Each amplicon (5 µL) was examined with agarose gel electrophoresis to validate amplification efficiency. PCR products were sequenced directly by primer walking from both directions after purification.
The raw sequences of mitochondrial genome were edited and assembled by using the program Seqman (DNAStar, Inc.) and then adjusting them manually. Protein-coding genes and rRNA genes were identified by the MITOS WebServer (http://mitos.bioinf.uni-leipzig.de/index.py) and the similarity between Daphnia pulex and that published in NCBI database were distinguished by BLAST search function (http://www.ncbi.nlm.nih.gov/BLAST/). Nucleotide sequences of PCGs were translated using the invertebrate mitochondrial genetic code. The tRNA genes were initially identified by the MITOS WebServer (http://mitos.bioinf.uni-leipzig.de/index.py) and their secondary structures were predicted and modified based on other metazoan’s secondary structure of tRNA genes.
The exact initiation and termination codons were identified by using Clustal X version 2.0 (
The mitochondrial genomes of the Chinese Daphnia pulex used in this study were similar to that of the Daphnia pulex in North America (
Structure of Chinese Daphnia pulex mitochondrial genome. COI, COII, COIII refer to the cytochrome oxidase subunits, Cytb refers to cytochrome b, ND1 - ND6 refer to NADH dehydrogenase components, and rrL and rrnS refer to rRNAs. tRNA genes are denoted by one letter symbol according to the IPUC-IUB single-letter amino acid codes. L1, L2, S1 and S2 denote tRNALeu(CUN), tRNALeu(UUR), tRNASer(AGN) and tRNASer(UCN), respectively. D-loop indicates A+T-rich region. Gene names outside the ring are coded on the majority strand while those inside are on the minority strand.
The mitochondrial genome of the Chinese Daphnia pulex has an A+T content of 64.50%, which is a little higher than that of the North American species (62.26%). Furthermore, it was determined that the AT skew was 0.006, and the GC skew was -0.107. AT skew and GC skew for a given strand were calculated as (G-C)/(G+C) and (A-T)/(A+T), respectively, with negative values in skewness meaning the coding strand is enriched for T or C. In contrast, positive values infer more As and Gs. On the whole, AT skew was slightly negative, or positive in the third codon position of vestimetiferans, and GC skew was more negative than AT skew (Table
Nucleptide composition in different regions of the Daphnia pulex mitochondrial from different areas.
areas | length (bp) | A(%) | T(%) | G(%) | C(%) | A+T(%) | G+C(%) | AT skew | GC skew | |
---|---|---|---|---|---|---|---|---|---|---|
The whole mitochondrial genome | Ch | 15306 | 32.45 | 32.04 | 15.84 | 19.66 | 64.49 | 35.50 | 0.006 | -0.107 |
Na | 15333 | 31.47 | 30.79 | 16.69 | 21.05 | 62.26 | 37.74 | 0.011 | -0.116 | |
Protein-coding genes | Ch | 11026 | 24.73 | 38.64 | 18.31 | 18.32 | 63.37 | 36.63 | -0.219 | -0.0002 |
Na | 11074 | 23.39 | 37.04 | 19.40 | 20.17 | 60.43 | 39.57 | -0.226 | -0.019 | |
1st | Ch | 3665 | 26.63 | 29.66 | 25.21 | 18.50 | 56.29 | 43.71 | -0.054 | 0.154 |
Na | 3681 | 25.94 | 29.34 | 25.42 | 19.29 | 55.28 | 44.71 | -0.061 | 0.137 | |
2nd | Ch | 3665 | 17.11 | 45.70 | 16.92 | 20.27 | 62.81 | 37.19 | -0.455 | -0.090 |
Na | 3681 | 17.33 | 45.18 | 16.54 | 20.95 | 62.51 | 37.49 | -0.445 | -0.117 | |
3rd | Ch | 3665 | 30.23 | 40.52 | 12.91 | 16.34 | 70.75 | 29.25 | -0.145 | -0.118 |
Na | 3681 | 26.68 | 36.57 | 16.30 | 20.46 | 63.25 | 36.76 | -0.156 | -0.113 | |
tRNA | Ch | 1448 | 33.22 | 33.01 | 18.99 | 14.78 | 66.23 | 33.77 | 0.003 | 0.124 |
Na | 1452 | 32.78 | 32.99 | 19.42 | 14.81 | 65.77 | 34.23 | -0.003 | 0.134 | |
rRNA | Ch | 2057 | 34.03 | 34.71 | 16.67 | 14.58 | 68.74 | 31.25 | -0.010 | 0.067 |
Na | 2067 | 35.41 | 32.41 | 15.19 | 16.98 | 67.82 | 32.17 | 0.044 | -0.056 | |
D-loop | Ch | 723 | 32.09 | 33.33 | 16.04 | 18.53 | 65.42 | 34.57 | -0.019 | -0.072 |
Na | 689 | 32.37 | 34.69 | 15.38 | 17.56 | 67.06 | 32.94 | -0.035 | -0.066 |
Codon | Count | RSCU | Codon | Count | RSCU | Codon | Count | RSCU | Codon | Count | RSCU |
---|---|---|---|---|---|---|---|---|---|---|---|
UUU(F) | 20.1 | 1.39 | UCU(S) | 8 | 2.04 | UAU(Y) | 7.9 | 1.27 | UGU(C) | 3.5 | 1.3 |
UUC(F) | 8.8 | 0.61 | UCC(S) | 3 | 0.76 | UAC(Y) | 4.5 | 0.73 | UGC(C) | 1.9 | 0.7 |
UUA(L) | 12.3 | 1.76 | UCA(S) | 3.7 | 0.94 | UAA(*) | 5.9 | 1.01 | UGA(*) | 4.5 | 0.77 |
UUG(L) | 6.3 | 0.9 | UCG(S) | 1.8 | 0.45 | UAG(*) | 7.2 | 1.22 | UGG(W) | 3.8 | 1 |
CUU(L) | 9.2 | 1.32 | CCU(P) | 5 | 1.71 | CAU(H) | 3.3 | 1.23 | CGU(R) | 1.2 | 0.63 |
CUC(L) | 5.2 | 0.74 | CCC(P) | 3.2 | 1.08 | CAC(H) | 2.1 | 0.77 | CGC(R) | 1.1 | 0.59 |
CUA(L) | 5.3 | 0.76 | CCA(P) | 1.5 | 0.5 | CAA(Q) | 3.5 | 1.08 | CGA(R) | 1.9 | 1.05 |
CUG(L) | 3.6 | 0.52 | CCG(P) | 2.1 | 0.71 | CAG(Q) | 2.9 | 0.92 | CGG(R) | 1 | 0.55 |
AUU(I) | 12.2 | 1.57 | ACU(T) | 6 | 1.88 | AAU(N) | 5.6 | 1.4 | AGU(S) | 4.6 | 1.18 |
AUC(I) | 5 | 0.64 | ACC(T) | 2.4 | 0.75 | AAC(N) | 2.4 | 0.6 | AGC(S) | 2.5 | 0.63 |
AUA(I) | 6.2 | 0.79 | ACA(T) | 2.9 | 0.92 | AAA(K) | 4.4 | 1.1 | AGA(R) | 3.8 | 2.06 |
AUG(M) | 5 | 1 | ACG(T) | 1.5 | 0.46 | AAG(K) | 3.6 | 0.9 | AGG(R) | 2.1 | 1.13 |
GUU(V) | 5.2 | 1.41 | GCU(A) | 4 | 1.81 | GAU(D) | 4.3 | 1.23 | GGU(G) | 2.4 | 0.62 |
GUC(V) | 2.3 | 0.62 | GCC(A) | 1.8 | 0.83 | GAC(D) | 2.7 | 0.77 | GGC(G) | 2.1 | 0.54 |
GUA(V) | 4.6 | 1.24 | GCA(A) | 2.2 | 0.97 | GAA(E) | 1.8 | 0.69 | GGA(G) | 4.4 | 1.13 |
GUG(V) | 2.7 | 0.73 | GCG(A) | 0.8 | 0.38 | GAG(E) | 3.4 | 1.31 | GGG(G) | 6.6 | 1.71 |
Amino acids are denoted as one-letter symbol according to the IUPAC-IUB single letter amino acid codes.
The complete mitochondrial DNA of Chinese Daphnia pulex from Chaohu had 13 protein-coding genes. Nine of these genes were located on the J-strand while the others were found on the N-strand; the same as the Daphnia pulex in North America (Table
As is the case with some other arthropod species, the initiation functions of the COIcodon has not been fully investigated. Atypical initiating codons for the COI gene in mitochondrial genomes have been reported in many studies, examples of these genes are: CGA (
Nine of the 13 protein-coding genes used the typical termination codon TAN. ND2 and ATP8 terminated with TAG. COIII, ND3, Cytb, ATP6, ND4L, ND6 and ND1 all terminated with TAA. COI, COII, ND4 and ND5 used the incomplete termination codon T. Both of the complete termination codons TAG and TAA and two additional abbreviated termination codons T and TA were found in the North American Daphnia pulex (Table
Organization of the mitochondrial genomes of Daphnia pulex from Chinese Chaohu (Ch) and that from North America (Na).
Gene/strand | position | length | Start/stop codon | |||
---|---|---|---|---|---|---|
Ch | Na | Ch | Na | Start codon (Ch/Na) | Stop codon (Ch/Na) | |
trnI/J | 1–64 | 1–64 | 64 | 64 | ||
trnQ/N | 66–133 | 66–133 | 68 | 68 | ||
trnM/J | 134–197 | 134–197 | 64 | 64 | ||
ND2/J | 198–1139 | 198–1185 | 942 | 988 | ATG/ATG | TAG/T__ |
trnW/J | 1138–1202 | 1186–1251 | 65 | 66 | ||
trnC/N | 1206–1268 | 1253–1316 | 63 | 64 | ||
trnY/N | 1278–1340 | 1328–1391 | 63 | 64 | ||
COI/J | 1350–2886 | 1397–2934 | 1537 | 1538 | ATA/(A)TTA | T__/T__ |
trnL2/J | 2887–2954 | 2935–3002 | 68 | 68 | ||
COII/J | 2956–3634 | 3004–3682 | 679 | 679 | ATG/ATG | T__/T__ |
trnK/J | 3635–3704 | 3683–3752 | 70 | 70 | ||
trnD/J | 3709–3773 | 3757–3821 | 65 | 65 | ||
ATP8/J | 3774–3935 | 3821–3982 | 162 | 162 | GTG/GTG | TAG/TAG |
ATP6/J | 3929–4603 | 3976–4649 | 675 | 674 | ATG/ATG | TAA/TA_ |
COIII/J | 4603–5391 | 4650–5438 | 786 | 789 | ATG/ATG | TAA/TAA |
trnG/J | 5393–5456 | 5439–5499 | 64 | 61 | ||
ND3/J | 5457–5810 | 5500–5852 | 354 | 353 | ATC/ATT | TAA/TA_ |
trnA/J | 5811–5874 | 5853–5918 | 64 | 66 | ||
trnR/J | 5876–5940 | 5920–5984 | 65 | 65 | ||
trnN/J | 5943–6010 | 5985–6051 | 68 | 67 | ||
trnS1/J | 6011–6075 | 6052–6116 | 65 | 65 | ||
trnE/J | 6076–6141 | 6117–6184 | 66 | 68 | ||
trnF/N | 6141–6205 | 6184–6249 | 65 | 66 | ||
ND5/N | 6207–7913 | 6250–7957 | 1707 | 1708 | GTG/ATG | T__/T__ |
trnH/N | 7908–7971 | 7952–8015 | 64 | 64 | ||
ND4/N | 7972–9292 | 8016–9336 | 1321 | 1321 | ATG/ATG | T__/T__ |
ND4L/N | 9295–9570 | 9339–9614 | 276 | 276 | GCT/ATT | TAA/TAA |
trnT/J | 9602–9664 | 9646–9710 | 63 | 65 | ||
trnP/N | 9665–9730 | 9711–9775 | 66 | 65 | ||
ND6/J | 9733–10245 | 9778–10290 | 513 | 513 | ATC/ATT | TAA/TAA |
Cytb/J | 10245–11378 | 10298–11431 | 1134 | 1134 | ATG/ATG | TAA/TAA |
trnS2/J | 11379–11447 | 11432–11500 | 69 | 69 | ||
ND1/N | 11438–12373 | 11494–12426 | 936 | 936 | ATG/ATG | TAA/TAA |
trnL1/N | 12377–12443 | 12430–12496 | 67 | 67 | ||
rrnL/N | 12454–13766 | 12506–13819 | 1313 | 1314 | ||
trnV/N | 13769–13840 | 13821–13892 | 72 | 72 | ||
rrnS/N | 13840–14583 | 13892–14644 | 744 | 753 | ||
D-loop/J | 14584–15306 | 14645–15333 | 723 | 689 |
The use of incomplete termination codons on these genes might serve the purpose of avoiding overlapping nucleotides between adjacent genes (He et al. 2012). The incomplete termination codons would become functional termination codons after polycistronic transcript cleavage and polyadenylation processes have occured (
Many composition similarities were noted between the two different species compared in this study (Fig.
Nucleotide compositions of the two Daphnia pulex from Chinese Chaohu (Ch) and North America (Na). CDS: protein-coding genes; 1st: first codon position; 2nd: second codon position; 3rd: third codon position; tRNA: tRNA genes; rRNA: rRNA genes; D-loop: A+T-rich region. In addition, stop codons were excluded.
All of the 22 typical arthropod tRNAs were found in the Chinese Daphnia pulex mitochondrial genome. They ranged from 63 to 72 bp in size. A schematic drawing of their respective secondary structures is shown in Figure
Non-canonical pairs, which possessed non Watson-Crick matches, commonly manifest in mitochondrial tRNA gene secondary structures. There are 30 base pair mismatches present in the tRNA secondary structures of Chinese Daphnia pulex mtDNA, including 15 wobble G-U pairs, 13 U-G pairs , two U-U pairs, one A-A pair and one U-C pair mismatch (Fig.
Both the rrnL and rrnS genes were present in Chinese Daphnia pulex mitochondrial genome. They were located between trnL1 and the non-coding putative control region and separated by trnV, as similarly found in vertebrate mitochondrial genomes (
Large and small ribosomal RNA genes (rrnL and rrnS) in Chinese Daphnia pulex were 1,313 bp and 744 bp long, respectively. The lengths of the two rRNAs were almost similar to that of the Daphnia pulex in North America (1,314 bp and 753 bp, respectively).
There are 15 non-coding regions ranging from 1 to 31 bp except for the A+T-rich region in the Chinese Daphnia pulex mitochondrial genome.
A 31 bp intergenic sequence was present between ND4L and trnT, which is also found in the North American Daphnia pulex mitochondrial DNA. The longest intergenic region in Chinese Daphnia pulex was the A+T-rich region. It was between rrnS and trnI with the length of 723 bp. It has an A+T content of 65.42%. It was a little longer than that of the North American Daphnia pulex mitochondrial DNA (689 bp), but lower in A+T content. This region usually contains replication and transcription areas in both vertebrates and invertebrates (
The phylogenetic relationships among the Daphnia pulex from different areas were reconstructed based on nucleotide sequences of the COI gene by using the maximum likelihood (ML) mothod (Fig.
The mapping of the mitochondrial genome of the Chinese Daphnia pulex was completed in this study. It was found to be 15,306 bp in length and had a similar composition in size and structure to the Daphnia pulex mitochondrial DNA in North America published in GenBank AF117817 (
The authors are grateful to Jun Li for his help with experiments. This work was supported by the National Natural Science Foundation of China (81272377, 31370470), the Natural Science Foundation of Anhui Province of China (1208085MC45) and the open-ended fund of Anhui Key Laboratory of Plant Resources and Biology (ZYZWSW2014014).