We describe a new species of Pristimantis from the humid sub-montane forest of the Región Cusco in Peru. Pristimantis pluvialis sp. n. was collected in the Kosñipata and Entoro valleys at elevations from 740 to 1110 m a.s.l., near the borders of Manu National Park and within the Huachiperi Haramba Queros Conservation Concession. The new species can be distinguished from other members of the genus Pristimantis by its rostral tubercle, smooth dorsal skin, and by its advertisement call. Pristimantis lacrimosus and P. waoranii superficially most resemble the new species, but P. pluvialis sp. n. differs from both species by having a rostral tubercle (absent in P. waoranii and variable in P. lacrimosus) and larger size, from P. lacrimosus by its call emitted at a lower frequency, and from P. waoranii for its dorsal coloration with dark markings. Two other species have partially overlapping distributions and resemble the new species, P. mendax and P. olivaceus, but they produce advertisement calls with much higher dominant frequencies than the advertisement call of the new species. Furthermore, P. mendax differs from the new species by lacking a rostral tubercle and by having a sigmoid inner tarsal fold, whereas P. olivaceus differs by being smaller and by having dorsal skin shagreen with scattered tubercles. The new species has snout-vent length of 21.8–26.9 mm in males (n = 12) and 28.8 mm in a single female.

Describimos una nueva especie de Pristimantis de los bosques sub-montanos de la Región Cusco, en Perú. Pristimantis pluvialis sp. n. fue colectada en los valles de Kosñipata y Entoro a altitudes entre 740 y 1110 m.s.n.m., cerca del límite del Parque Nacional del Manu y dentro de la Concesión para Conservación Huachiperi Haramba Queros. La nueva especie se diferencia de otros miembros del género Pristimantis por su tubérculo rostral, piel dorsal lisa, y por su canto de anuncio. Superficialmente, Pristimantis lacrimosus y P. waoranii se asemejan a la nueva especie, pero P. pluvialis sp. n. difiere de ambas por tener un tubérculo dorsal (ausente en P. waoranii y variable en P. lacrimosus) y mayor tamaño; además, se diferencia de P. lacrimosus por tener un canto de anuncio producido a frecuencias más bajas, y de P. waoranii por su coloración dorsal con manchas oscuras. Dos especies con distribución parcialmente simpátrica se asemejan morfológicamente a la nueva especie, P. mendax y P. olivaceus. Ambas especies producen cantos de anuncio a frecuencias mucho más altas que la nueva especie. Además, P. mendax se distingue de P. pluvialis sp. n. por carecer de tubérculo rostral y por tener un pliegue tarsal interno sigmoideo, mientras que P. olivaceus se distingue por su menor tamaño, y por tener piel finamente granular con algunos tubérculos diseminados en la parte dorsal. La nueva especie tiene una longitud hocico-cloaca de 21.8–26.9 mm en machos (n = 12) y de 28.8 mm en una hembra.

Frog, Cusco, Paucartambo, Pristimantis pluvialis , new species

Rana, Cusco, Paucartambo, especie nueva, Pristimantis pluvialis

The wet tropics are a region of incredibly high biodiversity. The combination of historical, climatic and geographic characteristics foster high speciation rates. In particular, Manu National Park and its surrounding areas have one of the highest herpetofaunal diversity in the world (Catenazzi et al. 2013). Over 155 amphibian species are known from this region, comprising over 2% of known amphibians (Catenazzi et al. 2013). Despite intensive survey efforts, new amphibian species are frequently discovered (Catenazzi et al. 2012; Chaparro et al. 2015; De la Riva et al. 2012).

Manu NP is particularly rich in members of the genus Pristimantis (Craugastoridae), as are other regions in the upper Amazon Basin and the eastern slopes of the Andes. This is one of the largest genera of all vertebrates, and is incredibly understudied. It contains nearly 500 species distributed throughout the New World (AmphibiaWeb 2016; Hedges et al. 2008). Pristimantis and most members of the Craugastoridae are primarily terrestrial and are generally assumed to be direct-developing, lacking an aquatic tadpole stage (Duellman and Lehr 2009).

A relatively recent divergence and morphological similarities among species may indicate remarkable cryptic diversity within Pristimantis (Ortega-Andrade et al. 2015). It can be difficult to discern new species without genetic information, particularly in Peru where this genus is diverse (Aguilar et al. 2010) and counts up to 125 species (AmphibiaWeb 2016). However, surveys sometimes reveal species with unique morphological traits, such is the case of a new, relatively large Pristimantis species bearing a rostral tubercle, related to P. lacrimosus, that we discovered during surveys in the Kosñipata Valley near Manu NP and within the Huachiperi Haramba Queros Conservation Concession. Here we describe this new species.

The format of the diagnosis, measurements and description follows Duellman and Lehr (2009). Taxonomy follows Hedges et al. (2008), except that we followed Pyron and Wiens (2011) for family placement. Specimens were fixed in 10% formalin and preserved in 70% ethanol. Sex and maturity of specimens were determined by observing sexual characters and gonads through dissections. We measured the following variables to the nearest 0.1 mm with digital calipers under a stereomicroscope: snout–vent length (SVL), tibia length (TL), foot length (FL, distance from proximal margin of inner metatarsal tubercle to tip of Toe IV), head length (HL, from angle of jaw to tip of snout), head width (HW, at level of angle of jaw), eye diameter (ED), tympanum diameter (TY), interorbital distance (IOD), upper eyelid width (EW), internarial distance (IND), and eye–nostril distance (E–N, straight line distance between anterior corner of orbit and posterior margin of external nares). Fingers and toes are numbered preaxially to postaxially from I–IV and I–V respectively. We compared the lengths of toes III and V by adpressing both toes against Toe IV; lengths of fingers I and II were determined by adpressing the fingers against each other. Photographs taken by A. Shepack and A. Catenazzi in the field were used for descriptions of coloration in life, and have been deposited at the Calphotos online database (http://calphotos.berkeley.edu).

We used two sets of recordings to describe the advertisement call. Holotype, CORBIDI 16510 (SVL 24.6 mm; recording #9846 deposited at the Fonoteca Zoológica, Museo Nacional de Ciencias Naturales, Madrid, www.fonozoo.com) was recorded at the type locality at 20:30 on 16 January 2015 (T_air = 21.4 °C), along with several unvouchered males. We used a digital recorder (Zoom H2; WAV format, 44 KHz, 24 bit) to record these advertisement calls in 2015. In a second set of recordings, we recorded paratype MUSM 35217 at 21:00 on 2 September 1999 (SVL =22.5 mm; T_air = 20.2 °C; recording #9847 deposited at the Fonoteca Zoológica, Museo Nacional de Ciencias Naturales, Madrid), along with several uncaptured males, using a portable cassette recorder (Aiwa HS-F150), a small microphone, and audiotapes.

We used Raven, version 1.4 (Cornell Laboratory of Ornithology) to analyze call length, peak frequency, and calling rate. The Hamming window function for the spectrogram was set at 256 bands. We report means ± SD. We analyzed a total of 380 calls.

We determined the phylogenetic position of the new species with respect to other Pristimantis species through analysis of DNA sequence data. Our analysis included the 16S rRNA mitochondrial fragment and the protein-coding gene cytochrome c oxidase subunit I (COI). We used tissue samples from specimens collected in southern Peru (Cusco and Madre de Dios regions) to obtain DNA sequences for the new species and another undescribed Pristimantis from the foothills of Manu National Park (Appendix 1). Additionally, we downloaded sequences from Genbank (Appendix 1) of morphologically similar species (P. bromeliaceus, P. galdi, P. mendax, P. mindo, P. moro, P. omeviridis, P. schultei, P. subsigillatus) in the putative P. lacrimosus group (sensu (Arteaga et al. 2013); but see (Padial et al. 2014). Sequences for several other species of Pristimantis that possess a rostral tubercle were not available in Genbank. We included the distantly related Pristimantis ridens as outgroup (Padial et al. 2014).

Extraction, amplification, and sequencing of DNA followed protocols previously used for Pristimantis species (Hedges et al. 2008). We used the 16SA (forward) primer (5’-3’ sequence: CGCCTGTTTATCAAAAACAT) and the 16SB (reverse) primer (5’-3’ sequence: CCGGTCTGAACTCAGATCACGT) to amplify 16S (Palumbi et al. 2002), and we used the dgLCO1490 (forward) primer (GGTCAACAAATCATAAAGAYATYGG) and the dgHCO2198 (reverse) primer (TAAACTTCAGGGTGACCAAARAAYCA) to amplify COI (Meyer et al. 2005). We employed the following thermocycling conditions to amplify DNA using the polymerase chain reaction (PCR): 1 cycle of 96 °C/3 min; 35 cycles of 95 °C/30 s, 55 °C/45 s, 72 °C/1.5 min; 1 cycle 72 °C/7 min. We completed the cycle reactions by using the corresponding PCR primers and the BigDye Terminator 3.1 (Applied Biosystems), and obtained sequence data by running the purified reaction products in an ABI 3730 Sequence Analyzer (Applied Biosystems). We deposited the newly obtained sequences in GenBank (Appendix 1).

We used Geneious R6, v. 6.1.8 (Biomatters, http://www.geneious.com/) to align the sequences with MAFFT, v. 7.017 (Katoh and Standley 2013) alignment program. Prior conducting phylogenetic analysis, we used PartitionFinder, v. 1.1.1 (Lanfear et al. 2012) to select the appropriate models of nucleotide evolution and determined the best partitioning scheme and substitution model for each gene with a Bayesian information criterion (BIC) to. We employed a Maximum Likelihood (ML) approach using RaxML, v. 8.2.4 (Stamatakis 2006) to infer a molecular phylogeny. We used the “f- a” function to conduct a bootstrap analysis and search for the optimal likelihood tree. Our analysis included 20 terminals and a 1064 bp alignment for the concatenated dataset. We used the GTR + Γ model of nucleotide substitution, performed 200 tree searches, and assessed node support using 1000 bootstrap replicates. Additionally, we used the R package APE (Paradis et al. 2004) to estimate uncorrected p-distances (i.e., the proportion of nucleotide sites at which any two sequences are different).

We quantified infection by Batrachochytrium dendrobatidis(Bd) by swabbing frogs with a synthetic dry swab (Medical Wire & Equipment, #113) using a standardized swabbing protocol. Swabs were stroked across the skin a total of 30 times: 5 strokes on each side of the abdominal midline, 5 strokes on the inner thighs of each hind leg, and 5 strokes on the foot webbing of each hind leg (total of 30 strokes/frog). We used a real-time Polymerase Chain Reaction (PCR) assay on material collected on swabs to quantify the level of infection (Boyle et al. 2004). After extraction using PrepMan Ultra, we analyzed DNA amplification in a Life Technologies StepOne Plus qPCR instrument following the protocol outlined in Hyatt et al. (2007) and Boyle et al. (2004), except that extracts were analyzed once. We calculated ZE, the genomic equivalent for Bd zoospores by comparing the qPCR results to a set of standards, and considered any sample with ZE > 1 to be infected or Bd-positive.

Specimens examined are listed in Appendix 2; codes of collections are: CORBIDI = Herpetology Collection, Centro de Ornitología y Biodiversidad, Lima, Peru; KU = Natural History Museum, The University of Kansas, Lawrence, Kansas, USA; MUSM = Museo de Historia NaturalUniversidad Nacional Mayor de San Marcos, Lima, Peru; MHNG = Muséum d’Histoire Naturelle, Genève, Switzerland; MTD = Museum für Naturkunde Dresden, Dresden, Germany; ROM = Royal Ontario Museum; USNM = National Museum of Natural History (USA).

Our phylogenetic analysis indicates that P. pluvialis is most closely related to two undescribed Pristimantis species, one from the same valley near the type locality of P. pluvialis, and one from Guyana (Fig. 6; Padial et al. 2014). The species from Guyana (Pristimantis sp. ROM 43978) had previously been identified as P. zeuctotylus (Hedges et al. 2008). Furthermore, four other species, P. omeviridis, P. galdi, P. mindo, and P. subsigillatus, are closely related to P. pluvialis (Fig. 6). The most comprehensive molecular phylogenetic study of terraranas to date also found that most of these taxa form one clade (Padial et al. 2014). Nevertheless, given that there was low resolution in some nodes, both in the study by Padial et al. (2014) and this study, analyses including additional genes are needed to further examine the relationships among species in this group.

The morphologically similar P. lacrimosus presumably is a complex of at least two species, formed by lowland populations of small-sized individuals around the type locality in Ecuador, and larger individuals from the Andean slopes (Duellman 1978a; Lynch and Duellman 1980), which possibly form a distinct and still unrecognized species. Pristimantis pluvialis is larger, calls at lower frequency, and occurs at higher elevations than P. lacrimosus. Furthermore, the locality of the neotype of P. lacrimosus, collected at Santa Cecilia (Heyer and Hardy 1991), is 1600 km NW of the type locality of P. pluvialis, a very long distance considering the degree of endemism in montane and sub-montane Pristimantis. We lack sequences for P. waoranii, but the absence of rostral tubercle and dark dorsal markings in this species differentiates it from all individuals of P. pluvialis in our type series.

Pristimantis pluvialis is morphologically similar to P. olivaceus, which has previously been reported from Manu NP (Duellman and Lehr 2009) and southeastern Peru (Köhler et al. 1998). In light of our present description, a closer examination of existing museum specimens, along with DNA sequence data and call recordings for new observations of putative P. olivaceus from southeastern Peru, are needed to confirm assignment of museum specimens to this species, and to properly identify newly collected specimens. Of the characters we have mentioned in the diagnosis and comparisons, skin texture should be used with caution, because previous work shows that this trait is variable in some Pristimantis (Guayasamin et al. 2015), and because three of our types, despite not displaying the shagreen skin texture seen in P. olivaceus, differ from other smooth-skin types by having minute, scattered tubercles on dorsal surfaces.

Pristimantis pluvialis and P. olivaceus are most easily distinguished by their overall coloration, which is reddish-brown in P. pluvialis and green in P. olivaceus, by the larger size of P. pluvialis (SVL of males <22 mm in P. olivaceus, and >22 mm in P. pluvialis), and most notably by differences in their advertisement calls. Both species produce calls consisting of short, single notes, but whereas P. pluvialis emits “tocks” with a dominant frequency at ~2500 Hz during an initial burst followed by downward frequency modulation in the middle of the call, P. olivaceus emits “chirps” with a dominant frequency at ~4900 Hz with increasing frequency during the call but little amplitude modulation (Köhler et al. 1998).

With the addition of P. pluvialis the genus Pristimantis now contains 474 known species (AmphibiaWeb 2016). This cryptically diverse group surely contains even more undescribed species (Ortega-Andrade et al. 2015). We discovered P. pluvialis in a region where multiple researchers, including the authors, have worked previously. This suggests that continued surveying efforts are necessary to achieve a full understanding of herpetological diversity in this area (Catenazzi et al. 2013; Catenazzi and von May 2014).

We thank I. De la Riva, M. Ortega, and D. B. Provete for comments on an earlier version of the manuscript, A. Yonaje, R. Yonaje, and M. Britton for field assistance, F. and W. Qertehuari for arranging our visits in Queros, and Perú Verde and the Comunidad Nativa Queros for permission to work inside their protected areas (Área de Conservación Privada Bosque Nublado and Concesión para la Conservación Haramba Queros Wachiperi, respectively) and for logistic support. Field work was supported by grants from the Mohamed bin Zayed Species Conservation Fund, the Disney Worldwide Conservation Fund, the Fondation Matthey-Dupraz, the Andrew Sabin Family Foundation, and SIU startup funds to AC. RvM thanks the National Science Foundation Postdoctoral Research Fellowship in Biology (DBI-1103087). Collecting permits 89-98-INRENA-DGANPFS-DANP, 120-2012-AG-DGFFS-DGEFFS, 064-2013-AG-DGFFS-DGEFFS, 359-2013-MINAGRI-DGFFS-DGEFFS, and 292-2014-MINAGRI-DGFFS-DGEFFS. were issued by the Ministry of Agriculture.