Research Article |
Corresponding author: Luke Tornabene ( luke.tornabene@gmail.com ) Academic editor: Kyle Piller
© 2016 Luke Tornabene, D. Ross Robertson, Carole C. Baldwin.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Tornabene L, Robertson DR, Baldwin CC (2016) Varicus lacerta, a new species of goby (Teleostei, Gobiidae, Gobiosomatini, Nes subgroup) from a mesophotic reef in the southern Caribbean. ZooKeys 596: 143-156. https://doi.org/10.3897/zookeys.596.8217
|
We describe a new species of goby, Varicus lacerta sp. n., which was collected from a mesophotic reef at Curacao, southern Caribbean. The new species is the tenth species of Varicus, all of which occur below traditional SCUBA depths in the wider Caribbean area. Its placement in the genus Varicus is supported by a molecular phylogenetic analysis of three nuclear genes and the mitochondrial gene cytochrome b. In addition, the new species has one anal-fin pterygiophore inserted anterior to the first haemal spine, which distinguishes Varicus species from most species in the closely related and morphologically similar genus Psilotris. Varicus lacerta sp. n. is distinguished from all other named species of Varicus by the absence of scales, having highly branched, feather-like pelvic-fin rays, and in its live coloration. We provide the cytochrome c oxidase I DNA barcode of the holotype and compare color patterns of all species of Varicus and Psilotris for which color photographs or illustrations are available. This study is one of several recent studies demonstrating the utility of manned submersibles in exploring the diversity of poorly studied but species-rich deep-reef habitats.
Systematics, molecular phylogeny, deep reefs, submersible, Curaçao, Psilotris
Operating out of Substation Curaçao (www.substation-curacao.com), the Smithsonian Institution’s Deep Reef Observation Project (DROP) uses the manned submersible Curasub to capture tropical marine fishes and invertebrates at depths up to 300 m, providing new information on the fauna that inhabits poorly studied deep-reef ecosystems. DROP’s exploratory submersible diving in the southern Caribbean has led to the discovery of a cache of undescribed fish biodiversity, some of which has been recently described (
The new species was collected using the Curasub manned submersible. The sub has two hydraulic arms, one equipped with a suction hose and the other with a quinaldine-ejection system used to anaesthetize fishes. Specimens collected with the suction hose are deposited into a vented acrylic cylinder attached to the outside of the sub. The captured holotype was brought to the surface alive, where it was photographed and tissue sampled prior to fixation in 10% buffered formalin and subsequent storage in 75% ethanol.
Tissue from the holotype was stored in saturated salt-DMSO (dimethyl sulfoxide) buffer (
All measurements were taken with digital calipers to the nearest 0.1 mm. Vertebral counts and pterygiophore patterns were taken from digital radiographs. Dorsal pterygiophore formula is that of
Godzilla Goby
Curaçao, southern Caribbean.
Holotype.
ATAAAGATATTGGCACCCTCTATTTGATCTTCGGCGCCTGAGCTGGCATAGTCGGCACTGCTCTAAGCCTTCTTATTCGGGCAGAGCTAAGCCAACCTGGCGCCCTTTTAGGGGATGACCAGATCTACAACGTGATCGTTACTGCCCACGCCTTCGTAATAATCTTCTTTATAGTAATACCCGTCATGATTGGGGGCTTTGGGAACTGGCTCGTCCCTCTTATGATTGGGGCCCCCGATATGGCCTTTCCCCGAATAAATAACATAAGCTTCTGACTCCTCCCCCCCTCTTTCCTCCTGCTCTTAGCCTCCTCCGGCGTTGAAGCAGGCGCTGGCACAGGGTGAACCGTATACCCCCCCCTAGCCGGAAACCTCGCCCACGCCGGGGCCTCTGTTGATTTAACAATTTTTTCCCTCCACTTAGCAGGCATTTCCTCAATCCTAGGAGCCATTAACTTTATTACCACCATCCTCAACATAAAGCCCCCAGCAATCTCGCAATATCAAACCCCCCTTTTTGTATGGGCCGTGCTAATTACGGCTGTTCTTCTATTACTCTCCCTGCCCGTCCTAGCTGCAGGAATTACAATACTTCTTACCGATCGTAACCTAAATACAACCTTTTTTGACCCCGCAGGAGGGGGAGACCCCATTCTCTACCAACACCTCTTCTGATTCTT
In addition to molecular characters supporting the phylogenetic placement (Fig.
Second dorsal fin I,9; anal fin I,7; pectoral fin 18; no scales; cephalic papillae rows 5s and 5i connected, forming a single row; pelvic rays 1-4 highly branched and feather-like; one anal-fin pterygiophore inserted anterior to first haemal spine; body with five broad, indistinct, dark vertical bands washed with bright yellow in life; pelvic, pectoral and anal fins yellow-orange in life, dorsal, anal, and caudal fins yellow with faint orange tint.
General shape: body robust, widest and deepest at head, trunk tapering in width and depth posteriorly, dorsal head profile gradually sloping from dorsum to lips.
Median and paired fins: first dorsal fin VII, second spine longest, tips of spines projecting from fin membrane; second dorsal fin I,9, last ray branched to the base; anal fin I,7, last ray branched to the base; pectoral fin 18/18, fin extending posteriorly to vertical through anus; pelvic fins I,5, fins well separated, lacking both anterior frenum and membrane connecting bases of innermost rays; 4th pelvic-fin ray longest, extending posteriorly to anus; rays 1–4 connected by a thin membrane, each ray with one primary bifurcation followed by numerous thin branches off main branch that are united by a continuous membrane to the tip of the ray, giving each ray a feather-like appearance; 5th ray unbranched and 60–70% the length of 4th ray; caudal fin rounded, branched caudal-fin rays 15, segmented caudal-fin rays 17.
Squamation: no scales on head and trunk.
Head: jaw terminal, angled approximately 40 degrees from horizontal axis of body, extending posteriorly to a vertical at anterior end of pupil; anterior nares elongate narrow tubes; posterior nares inconspicuous openings covered by a short flap; no cephalic lateralis pores on head or preopercle; eyes large, dorsolateral, extending slightly above head profile; interorbital space narrow; operculum opening slightly wider than width of pectoral-fin base; teeth in upper jaw in two rows, outer row enlarged, canine-like, recurved, and evenly spaced, extending along most of premaxilla; inner rows smaller, more numerous, and more tightly spaced; teeth in lower jaw in three rows, outermost and innermost rows slightly enlarged, middle row smaller and more numerous; tongue truncate, tip with very slight indentation.
Morphometrics (% SL): head length 33.1; eye diameter 9.4; interorbital 2.6; snout length 8; upper-jaw length 12.4; predorsal length 40.1; body depth at origin of first dorsal 19.1; body depth at anal-fin origin 15.2; body depth at caudal peduncle 10.2; caudal-peduncle length 21.1; pectoral-fin length 24.0; pelvic-fin length 26.0; caudal-fin length 27.1.
Genitalia: male with short, conical, pointed papilla, wide at base and tapering distally to a point, no melanophores present; female unknown.
Color in life (Figs
Head with areas of bright yellow pigment heavily speckled with black dots on snout, along upper lip, as an irregular blotch over most of opercle, in a broad band across nape, and as two irregular bars below the eye, one beneath center of eye and extending to rear corner of mouth, the other running obliquely back from posteroventral corner of eye to lower corner of preopercle; iris greenish yellow, heavily speckled with silver and black dots; a thin silvery-white inner ring around pupil.
Body with four broad yellow bars heavily speckled with black dots, one on upper half of body under first dorsal fin; second and third extending from dorsal midline nearly to ventral midline, second positioned under anterior half of second dorsal fin and third under posterior corner of second dorsal and anterior half of caudal peduncle; fourth and narrowest bar covering most of posterior end of caudal peduncle and extending onto base of caudal fin; first three body bars (and bar across the nape) appearing as double bars due to irregular pale blotches in centers; interspaces between first three body bars with small, black-speckled yellow blotches and short, thin yellow bars; pale areas on head and trunk with silver, iridescent markings that are most conspicuous along mid-flank in the photograph of the live fish (Fig.
First dorsal fin yellow with fine yellow and orange dots on the inner two-thirds of fin, gradually replaced with silvery white dots on membranes of outer one fourth of fin; second dorsal fin similarly colored, but with silvery speckling predominating on outer one-third of fin. Basal three-quarters of caudal fin yellow, spangled with orange (mainly) and whitish dots; outer one-quarter of fin with rays gray and membranes translucent with heavy silver-white speckling, rear edge of fin with darker grey pigment suffused with orange. Anal fin orange, strongly so distally in live fish and basally in freshly dead fish (Figs
Color in preservation (Fig.
Sensory papillae (Fig.
Vertebral skeleton: dorsal pterygiophore formula 3-221110; one anal-fin pterygiophore inserted anterior to first haemal spine; second neural spine expanded and slightly spatulate at tip; hypurals 1–2 fused with hypurals 3–4 along approximately one-half of their length; 27 vertebrae, 11 precaudal, 16 caudal.
The only known specimen was collected at 129–143 m. Quinaldine was dispersed around a yellow sponge (~20 cm tall) tentatively identified from videos by Allen Collins (National Marine Fisheries Service) as Dactylocalyx pumiceus, situated on a rocky outcropping along the deep-reef slope. After approximately 20 seconds the stunned fish emerged from a space in the rocky substrate at the base of the sponge and was captured. It is unclear whether the fish was originally in direct association with the sponge itself or was instead sheltering in spaces within the rock. Video of the capture taken from a high-definition video camera mounted on the outside of the Curasub is available online (https://youtu.be/UvxJEi-vER0). Subsequent collections targeting similar sponges and rocky substrates within this depth range at the type locality have not yielded additional specimens.
Known only from the type location in Curaçao.
The specific epithet ‘lacerta’ (Latin for ‘lizard’) is in reference to the reptilian or saurian appearance of this species, as indicated by its bright yellow and orange coloration, green eyes, disproportionately large head possessing raised ridges of papilla, and multiple rows of recurved canine teeth in each jaw. The common name Godzilla goby (gobio Godzilla in Spanish) refers to the radioactive reptilian monster from the sea that appeared in Japanese science-fiction films as Gojira, renamed Godzilla in subsequent English-language films.
The molecular phylogeny (Fig.
The absence of scales and the presence of highly branched pelvic rays without fleshy tips make this species superficially similar to species of Psilotris. No single morphological character unambiguously distinguishes Varicus from Psilotris, but the most consistent morphological feature thus far is the presence of a single anal-fin pterygiophore inserted before the first haemal spine in Varicus versus two in all but one species of Psilotris. Psilotris laurae Van Tassell, Tornabene & Baldwin, 2016, has a single pterygiophore anterior to the haemal spine, and it is the only known deep-reef species of Psilotris. The relationship between anal-fin pterygiophore pattern and habitat depth warrants further investigation.
Despite the morphological similarities between V. lacerta and species of Psilotris, the new species is easily distinguished by live coloration (Fig.
Meristic and papillae characters for Varicus and Psilotris. AP = anal pterygiophores inserted anterior to haemal spine.
Species | Second dorsal | Anal | Pectoral | AP | Papillae rows 5i/5s | Body Scales | Basicaudal Scales |
---|---|---|---|---|---|---|---|
Varicus adamsi | I,9 | I,7–8 | 18 | 1 | connected | present | present |
Varicus benthonis | I,8 | I,7 | 16 | 1 | separate | present | present |
Varicus bucca | I,9 | I,7–8 | 16–19 | 1 | connected | present | present |
Varicus cephalocellatus | I,10 | I,9 | 19–20 | 1 | variable | present | present |
Varicus decorum | I,9 | I,7–8 | 17 | 1 | connected | absent | present |
Varicus lacerta sp. n. | I,9 | I,7 | 18 | 1 | connected | absent | absent |
Varicus marilynae | I,8 | I,7 | 16–18 | 1 | connected | present | present |
Varicus nigritus | I,9 | I,8 | 17 | 1 | connected | present | present |
Varicus veliguttatus | I,8 | I,6–7 | 17–19 | 1 | connected | present | present |
Varicus vespa | I,9 | I,7 (rarely I,6 or I,8) | 15–17 | 1 | separate | present | present |
Psilotris alepis | I,9 (rarely I,8) | I,7–8 | 15 | 2 | separate | absent | absent |
Psilotris boehlkei | I,9–10 | I,9 | 16–18 | 2 | separate | absent | absent |
Psilotris celsa | I,9–10 (rarely I,8) | I,9–10 (rarely I,8) | 16–17 | 2 | connected | absent | absent |
Psilotris kaufmani | I,10 (rarely I,9) | I,10 (rarely I,9) | 16–19 | 2 | connected | absent | absent |
Psilotris laetarii | I,9–10 | I,7–8 | 15–17 | 2 | connected | absent | absent |
Psilotris laurae | I,9 | I,8 | 18 | 1 | connected | absent | absent |
We thank Thomas Devine for assistance in the field and with DNA barcoding the holotype specimen; Matthew DeSaix for his help with molecular work; Jeffrey T. Williams and Diane Pitassy for cataloging material, and Sandra Raredon for photographing the preserved holotype and assisting with radiographs. We are grateful for the help of Cristina Castillo, Adriaan ‘Dutch’ Schrier, Barry Brown, Bruce Brandt, and the rest of the staff of Substation Curacao for their assistance in the field. The project was funded in part by the Smithsonian Peter Buck Fellowship to LT. Funding for the Smithsonian Institution’s Deep Reef Observation Project was provided internally by the Consortium for Understanding and Sustaining a Biodiverse Planet to CCB, the Competitive Grants for the Promotion of Science program to CCB and DRR, the Herbert R. and Evelyn Axelrod Endowment Fund for systematic ichthyology to CCB, and externally by the Prince Albert II of Monaco Foundation. This study is Ocean Heritage Foundation/Curacao Sea Aquarium/Substation Curacao contribution number OHF/CSA/SC#24.