Research Article |
Corresponding author: Wei-Chuan Zhou ( wczhou@163.com ) Corresponding author: Chung-Chi Hwang ( cchwang@nuk.edu.tw ) Corresponding author: Hong-Mu Ai ( aihongmu@yahoo.com.cn ) Academic editor: Frank Köhler
© 2016 Hong-Li Ding, Pei Wang, Zhou-Xing Qian, Jun-Hong Lin, Wei-Chuan Zhou, Chung-Chi Hwang, Hong-Mu Ai.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Ding H-L, Wang P, Qian Z-X, Lin J-H, Zhou Z-C, Hwang C-C, Ai H-M (2016) Revision of sinistral land snails of the genus Camaena (Stylommatophora, Camaenidae) from China based on morphological and molecular data, with description of a new species from Guangxi, China. ZooKeys 584: 25-48. https://doi.org/10.3897/zookeys.584.7173
|
The camaenid land snail genus Camaena is widely distributed throughout Southeast Asia. Thirteen species are found in China alone. Among these, C. cicatricosa (Müller, 1774) is the most widely distributed species, including four subspecies, C. c. ducalis (Ancey, 1885), C. c. inflata (Möllendorff, 1885), C. c. obtecta (Fischer, 1898) and C. c. connectens (Dautzenberg & Fischer, 1906). The systematics of these taxa is revised herein based on comparative shell morphology and anatomy as well as analyses of DNA sequences of two mitochondrial genes (COI, 16S rRNA) and one nuclear marker, ITS2. We found that all subspecies form well-supported clades in a molecular phylogeny and are well-differentiated from each other by genetic distances that are consistent with amounts of interspecific differentiation. In addition, they clearly differ from each other in reproductive features. Based on these observations, we elevate all four subspecies to the rank of full species. Moreover, based on morphological and mitochdondrial differentiation, we describe a new species, Camaena poyuensis sp. n. from Guangxi, China. The new species conspicuously differs from its sibling species C. cicatricosa in having a larger and more depressed shell, a completely covered umbilicus, more or less purplish peristome, an obtuse angle at the junction of the basal and columellar lip, longer pedunculus of the bursa copulatrix, thicker epiphallus and penis, and short conic verge. Previous named species are also redescribed on their shell and anatomical characters, because the original descriptions are uninformative.
Land snail, Gastropoda , camaenid, taxonomy, anatomy, molecular phylogeny
The genus Camaena Albers, 1850, with the type species Helix cicatricosa Müller, 1774, is distributed throughout Southeast Asia where it occurs in southern China, Indo-China, Eastern India, the Philippines and Sulawesi (
The shells of all but two Chinese species are dextral. Among the two sinistral species, C. seraphinica Heude, 1890 is known only from the type locality, Dingan Town, Tianlin County (formerly “Si-lin”), Guangxi Province. The type locality of the second sinistral species, Camaena cicatricosa cicatricosa (Müller, 1774) is unknown, but specimens exhibiting typical features, such as a sinistral, umbilicated, subcarinated, depressed-globular, yellowish shell with numerous chestnut coloured bands, are widely distributed throughout southern China (
So far, anatomical characters of sinistral camaenids have not been studied except for C. cicatricosa (
Owing to the incongruent delimitation of species in the past, which reflect exclusive reliance on shell characters and the incomplete description of these species, an up-dated revision using modern techniques and species delimitation is required. The mtDNA COI (cytochrome c oxidase subunit I) gene is a commonly used marker for the DNA barcode identification system and is potentially useful for species discovery and identification (
This study is based on material collected by the authors at several sites in China (Fig.
Map of locations of Camaena species. C. cicatricosa: A Nanning, Guangxi, China B Guiping, Guangxi, China C Yangchun, Guangdong, China D Gaoming, Canton, Guangdong, China E Yingde, Guangdong, China F Shantou, Guangdong, China. C. obtecta: G Buhaitun, Jinxi, Guangxi, China H Longbang, Jingxi, Guangxi, China I Cao Bang, Vietnam (type locality). C. inflata: J Qianlin park, Guiyang, Guizhou, China K Ziyun, Guiyang, Guizhou, China. C. connectens: L Tianbao, Malipo, Yunnan, China M Ha Giang, Vietnam (type locality). C. poyuensis sp. n.: N Poyue, Bama, Hechi, Guangxi, China (type locality). C. seraphinica: O Dingan, Tianlin, Guangxi, China (type locality).
A piece of foot muscle tissue of about 0.05 g was used for DNA extraction. The muscle tissue was bathed in sterile water for 3–6 hours to remove residual alcohol. Genomic DNA was isolated using a DNeasy Blood and Tissue Kit (Qiagen, Beijing), examined by agarose gel electrophoresis, and stored at -20 °C for further use. Three specimens from each sampling locality were used for DNA extraction. Fragments of the partial mitochondrial cytochrome c oxidase subunit 1 (COI) and 16S rRNA (16S), and the internal transcribed spacer 2 (ITS2) region of nuclear ribosomal DNA were amplified by PCR using the primer pairs and amplification conditions listed in Table
Primer pairs and PCR conditions used in the analysis of the COI, 16S rRNA and ITS2 genes of Camaena.
Gene | Primer pairs (5’-3’) | Cycling conditions | Reference |
---|---|---|---|
COI |
LCO:GGTCAACAAATCATAAAGATATTGG HCO:TAAACTTCAGGGTGACCAAAAAATCA |
94°: 30s; 94°: 10s, 45°: 50s, 72°: 1min, 40 cycles; 72°: 10min. |
|
16S | 16SAR: CGCCTGTTTATCAAAAACAT 16SBR: CCGGTCTGAACTCAGATCACGT |
94°: 30s; 94°: 10s, 45°: 50s, 72°: 1min50s, 40 cycles; 72°: 10min. |
|
ITS2 | FYIT2:CATCGACATCTTGAACGCACAT RYIT2: TCCCAAACAACCCGACTCCT |
94°: 30s; 94°: 10s, 55°: 30s, 72°: 1min30s, 40 cycles; 72°: 10min. | Present study |
Both strands of PCR products were purified and sequenced by use of the PCR primers. After sequencing, raw sequence files were proof-read based on chromatograms and assembled in BioEdit 7.2 (
16S, 16S rRNA gene; COI, cytochrome c oxidase subunit 1 gene; FJIQBC, Fujian Entry-Exit Inspection & Quarantine Bureau, Fuzhou, Fujian, China; ITS2, internal transcribed spacer 2 region of nuclear ribosomal DNA;
Molecular phylogenetic analyses were based on DNA sequences from forty-one specimens of Camaena from 14 localities as well as sequences from two additional specimens of Bradybaena sequiniana and Cornu aspersum that were used as outgroup to root the tree (Table
Sampling information and GenBank accession numbers. Localities are all in China otherwise noted.
Species / Locality | Coordinates | Collection date | COI | 16S | ITS2 |
---|---|---|---|---|---|
C. cicatricosa | |||||
Guiping, Guangxi | 23°23'58"N; 110°03'44"E | 2013.11.02 |
KU061276
KU061277 KU586516 |
KU586474
KU586475 KU586476 |
KU586555
KU586556 KU586557 |
Yingde, Guangdong | 24°09'44"N; 113°24'06"E | 2014.09.17 |
KU586533
KU586534 KU586535 |
KU586495
KU586496 KU586497 |
KU586576
KU586577 KU586578 |
Gaoming, Guangdong | 22°54'8"N; 112°53'2"E | 2009.10.22 |
KU586513
KU586514 KU586515 |
KU586471
KU586472 KU586473 |
KU586552
KU586553 KU586554 |
Nanning, Guangxi | 22°47'27"N; 108°23'33"E | 2013.05.18 |
KU586521
KU586522 KU586523 |
KU586483
KU586484 KU586485 |
KU586564
KU586565 KU586566 |
Yangchun, Guangdong | 22°10'3"N; 111°47'8"E | 2014.04.01 |
KU586530
KU586531 KU586532 |
KU586492
KU586493 KU586494 |
KU586573
KU586574 KU586575 |
Shantou, Guangdong | 23°16'60"N; 116°44'23"E | 2010.11.03 |
KU586527
KU586528 KU586529 |
KU586489
KU586490 KU586491 |
KU586570
KU586571 KU586572 |
C. obtecta | |||||
Longbang, Guangxi | 22°53'00"N; 106°19'34"E | 2015.10.03 |
KU055610
KU055611 KU586517 |
KU586477
KU586478 KU586479 |
KU586558
KU586559 KU586560 |
Buhaitun, Guangxi | 22°52'38"N; 106°19'39"E | 2015.10.03 |
KU586508
KU586509 KU586510 |
KU586465
KU586466 KU586467 |
KU586546
KU586547 KU586548 |
C. inflata | |||||
Guiyang, Guizhou | 26°36'8"N; 106°41'15"E | 2008.10.16 |
KU586524
KU586525 KU586526 |
KU586486
KU586487 KU586488 |
KU586567
KU586568 KU586569 |
Ziyun, Guizhou | 25°41'42"N; 106°14'31"E | 2014.04.18 |
KU586536
KU586537 KU586538 |
KU586498
KU586499 KU586500 |
KU586579
KU586580 KU586581 |
C. connectens | |||||
Tianbao, Malipo, yunnan | 22°57'57"N; 104°49'25"E | 2015.04.17 |
KU586518
KU586519 KU586520 |
KU586480
KU586481 KU586482 |
KU586561
KU586562 KU586563 |
Camaena poyuensis sp. n. | |||||
Poyue town, Bama, Hechi, Guangxi | 24°17'30"N; 107°05'32"E | 2014.05.25 |
KU061273
KU586511 KU586512 |
KU586468
KU586469 KU586470 |
KU586549
KU586550 KU586551 |
C. menglunensis | |||||
Xishuangbanna, Yunnan | 21°51'36"N; 101°24'53"E | 2011.07.24 |
KU586506
KU586507 |
KU586463
KU586464 |
KU586544
KU586545 |
C. jinpingensis | |||||
Jinping, Yunnan | 22°53'18"N; 103°20'23"E | 2011.07.29 |
KU586503
KU586504 KU586505 |
KU586460
KU586461 KU586462 |
KU586541
KU586542 KU586543 |
Bradybaena sequiniana (Family Bradybaenidae) | |||||
Badong, Hubei | 31°02'46"N; 110°22'18"E | 2011.06.13 | KU586501 | KU586458 | KU586539 |
Cornu aspersum (Family Helicidae) | |||||
Italy | 2010.04.06 | KU586502 | KU586459 | KU586540 |
The bootstrap support values smaller than 50% were considered poorly supported and are not considered below. Seven Camaena clades, which represent candidate species, with terminal clustering of sequences were identified from the reconstructed phylogeny. Although only a limited number of species was sampled, the phylogeny confirmed the monophyly of the five sinistral species from China (Fig.
Genetic distances between the seven Camaena clades varied from 13 to 22% (average = 17%) in COI, from 5 to 15% (average = 12%) in 16S, and from 1 to 12% (average = 7%) in ITS2 (Table
Average genetic distance of COI, 16S and ITS2 genes between and within (diagonal) species.
COI | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | |
1 | C. cicatricosa | 0.008 | ||||||||
2 | C. inflata | 0.166 | 0.011 | |||||||
3 | C. obtecta | 0.164 | 0.180 | 0.003 | ||||||
4 | C. connectens | 0.133 | 0.184 | 0.165 | 0.000 | |||||
5 | C. poyuensis sp. n. | 0.135 | 0.178 | 0.169 | 0.126 | 0.000 | ||||
6 | C. jinpingensis | 0.178 | 0.200 | 0.189 | 0.179 | 0.193 | 0.001 | |||
7 | C. menglunensis | 0.183 | 0.200 | 0.217 | 0.181 | 0.181 | 0.133 | 0.003 | ||
8 | B. sequiniana | 0.214 | 0.229 | 0.220 | 0.215 | 0.220 | 0.230 | 0.233 | - | |
9 | Co. aspersum | 0.215 | 0.220 | 0.237 | 0.228 | 0.223 | 0.233 | 0.235 | 0.240 | - |
16S | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | |
1 | C. cicatricosa | 0.000 | ||||||||
2 | C. inflata | 0.083 | 0.003 | |||||||
3 | C. obtecta | 0.099 | 0.100 | 0.004 | ||||||
4 | C. connectens | 0.072 | 0.101 | 0.141 | 0.000 | |||||
5 | C. poyuensis sp. n. | 0.052 | 0.106 | 0.114 | 0.101 | 0.000 | ||||
6 | C. jinpingensis | 0.121 | 0.138 | 0.147 | 0.132 | 0.144 | 0.000 | |||
7 | C. menglunensis | 0.129 | 0.149 | 0.143 | 0.132 | 0.152 | 0.066 | 0.000 | ||
8 | B. sequiniana | 0.210 | 0.227 | 0.216 | 0.224 | 0.230 | 0.218 | 0.221 | - | |
9 | Co. aspersum | 0.230 | 0.244 | 0.237 | 0.244 | 0.236 | 0.241 | 0.239 | 0.247 | - |
ITS2 | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | |
1 | C. cicatricosa | 0.002 | ||||||||
2 | C. inflata | 0.016 | 0.000 | |||||||
3 | C. obtecta | 0.028 | 0.012 | 0.001 | ||||||
4 | C. connectens | 0.034 | 0.019 | 0.012 | 0.013 | |||||
5 | C. poyuensis sp. n. | 0.028 | 0.024 | 0.027 | 0.032 | 0.000 | ||||
6 | C. jinpingensis | 0.114 | 0.113 | 0.118 | 0.122 | 0.104 | 0.000 | |||
7 | C. menglunensis | 0.116 | 0.114 | 0.120 | 0.123 | 0.103 | 0.014 | 0.006 | ||
8 | B. sequiniana | 0.245 | 0.242 | 0.249 | 0.250 | 0.243 | 0.244 | 0.238 | - | |
9 | Co. aspersum | 0.291 | 0.287 | 0.288 | 0.291 | 0.302 | 0.292 | 0.285 | 0.265 | - |
The well supported clades by means of bootstrap values and sufficient differentiation between clades in terms of branch lengths and genetic distances well delimited these clades as species rank. Six of the seven clades were recognized as already described species or subspecies and one clade represented a new taxon, after examining morphological characters (see Systematics part below). The comparative anatomy and nomenclatural act will be assessed in Systematics part. For clarifying, these recognized species have been labeled in figures and tables with the names and ranks of taxa treated or described below.
Helix cicatricosa Müller, 1774, subsequent designation by Martens, 1860.
Helix cicatricosa Müller, 1774: 42;
Nanina (Ariophanta) cicatricosa,
Helix (Camaena) cicatrosa,
Helix (Camaena) cicatricosa,
Camaena (Camaena) cicatricosa,
Camaena cicatricosa,
Unknown.
See Table
Measurements of shells (mm). Localities are all in China otherwise noted. n sample size SH shell height SW shell width AH aperture height AW aperture width.
Species / Locality | Voucher | SH | SW | SW/SH | AH | AW | AW/AH |
---|---|---|---|---|---|---|---|
C. cicatricosa | |||||||
Guiping, Guangxi |
FJIQBC 18503–18542 (n = 40) |
21.26–32.86 | 35.00–42.64 | 1.28–1.65 | 16.68–21.44 | 21.26–27.40 | 1.18–1.34 |
(27.61±3.17) | (39.50±2.21) | (1.44±0.11) | (19.53±1.33) | (24.36±1.74) | (1.25±0.04) | ||
Yingde, Guangdong |
FJIQBC 18543–18616 (n = 74) |
26.78–36.00 | 39.10–48.74 | 1.35–1.56 | 19.62–24.92 | 22.10–22.90 | 1.05–1.26 |
(28.66±2.45) | (41.87±2.83) | (1.46±0.05) | (21.28±0.05) | (24.94±2.30) | (1.17±0.06) | ||
Gaoming, Guangdong |
FJIQBC 18617–18640 (n = 24) |
26.48–33.30 | 38.20–44.84 | 1.31–1.56 | 19.20–21.56 | 24.64–29.60 | 1.23–1.37 |
(30.53±2.45) | (41.40±2.19) | (1.43±0.22) | (20.61±0.09) | (27.1±0.17) | (1.32±0.05) | ||
Nanning, Guangxi |
FJIQBC 18641–18670 (n = 30) |
22.10–30.00 | 36.26–43.76 | 1.43–1.64 | 18.08–21.88 | 22.00–18.64 | 1.19–1.32 |
(26.59±2.12) | (40.95±2.24) | (1.54±0.07) | (20.31±1.13) | (25.48±1.73) | (1.26±0.04) | ||
Yangchun, Guangdong |
FJIQBC 18671–18710 (n = 40) |
23.44–30.00 | 33.76–44.26 | 1.20–1.52 | 15.86–21.66 | 19.42–27.06 | 1.11–1.25 |
(27.00±1.94) | (37.76±3.10) | (1.40±0.10) | (18.45±1.61) | (22.07±1.96) | (1.20±0.04) | ||
Shantou, Guangdong |
FJIQBC 18711–18742 (n = 32) |
23.40–27.26 | 35.44–39.64 | 1.44–1.57 | 17.64–19.36 | 21.18–24.14 | 1.19–1.29 |
(25.07±1.44) | (37.58±1.53) | (1.50±0.05) | (18.61±0.61) | (22.89±1.04) | (1.23±0.04) | ||
C. obtecta | |||||||
Longbang, Guangxi |
FJIQBC 18743–18764 (n = 22) |
35.76–44.10 | 53.20–61.74 | 1.33–1.57 | 26.70–32.26 | 33.28–38.80 | 1.15–1.29 |
(39.46±2.22) | (57.93±2.53) | (1.47±0.07) | (29.64±1.70) | (35.54±1.51) | (1.19±0.04) | ||
Buhaitun, Guangxi |
FJIQBC 18765–18781 (n = 17) |
32.56–40.70 | 51.64–59.86 | 1.40–1.59 | 23.74–30.08 | 31.54–38.90 | 1.27–1.37 |
(36.90±2.72) | (55.88±2.77) | (1.52±0.06) | (27.12±1.73) | (36.10±2.48) | (1.33±0.03) | ||
C. inflata | |||||||
Guiyang, Guizhou |
FJIQBC 18782–18813 (n = 32) |
25.90–38.60 | 38.40–46.08 | 1.19–1.55 | 20.28–23.02 | 22.00–38.24 | 1.09–1.66 |
(29.97±3.31) | (42.87±2.18) | (1.44±0.10) | (21.39±0.80) | (26.50±0.40) | (1.24±0.14) | ||
Ziyun, Guizhou |
FJIQBC 18814–18825 (n = 12) |
31.66–40.40 | 48.52–56.66 | 1.40–1.55 | 21.74–28.62 | 27.50–33.20 | 1.11–1.32 |
(35.43±3.08) | (52.15±2.96) | (1.48±0.06) | (25.08±2.43) | (30.43±1.88) | (1.22±0.70) | ||
C. connectens | |||||||
Tianbao, Malipo, yunnan |
FJIQBC 18826–18835 (n = 10) |
30.40–37.44 | 48.18–55.26 | 1.37–1.59 | 22.08–27.80 | 29.20–34.10 | 1.23–1.32 |
(34.47±2.69) | (51.61±2.35) | (1.50±0.08) | (24.37±1.86) | (31.14±1.65) | (1.28±0.40) | ||
Camaena poyuensis sp. n. | |||||||
Poyue town, Bama, Hechi, Guangxi | Holotype FJIQBC 18484 | 38.08 | 56.08 | 1.47 | 27.92 | 34.72 | 1.24 |
Paratypes FJIQBC 18485–18486, 18489–18502 (n = 16) | 34.12–41.00 | 52.50–58.74 | 1.43–1.63 | 23.32–29.00 | 32.00–37.06 | 1.21–1.38 | |
(37.02±2.22) | (55.82±1.74) | (1.51±0.06) | (27.09±1.65) | (34.88±1.32) | (1.29±0.05) |
Shell sinistral, medium sized, thick, depressed-globular, yellowish brown, with obtuse apex and high dome-shaped spire; with 5 1/2 rapidly increasing and rather flat whorls separated by deep suture; body whorl convex, not descending behind the aperture; periphery bluntly angulate, becoming round behind aperture. Sculpture of fine, dense, irregular and oblique wrinkles and malleation, with low radiate folds below suture. Aperture roundly lunate, white inside, with curved margin. Peristome white, expanded, slightly reflected, thickened and glossy; columellar margin expanded; inner lip thin, callous. Basal lip curved, forming an obtuse angle at junction with straight and oblique columellar lip. Umbilicus half covered by reflected columellar lip. Color pattern of numerous wavy, reddish brown spiral bands of various thickness; subperipheral and subsutural bands much wider (Fig.
Shells of sinistral Chinese species of Camaena. A C. cicatricosa (FJIQBC 18483, Guiping, Guangxi, China) B C. obtecta (FJIQBC 18743, Longbang, Jingxi, Guangxi, China) C C. inflata (FJIQBC 18782, Qianlin park, Guiyang, Guizhou, China) D C. connectens (FJIQBC 18826, Tianbao, Malipo, Yunnan, China) E C. seraphinica (syntype,
Penis swollen, tapering distally, with a rounded bulge in correspondence of verge. Epiphallus thin with short, thin and wide penis retractor muscle. Flagellum slender, tapering distally. Vas deferens long and thin. Vagina long and thin, thickened proximally. Bursa copulatrix oval with medium-lengthened and thin pedunculus, expanded at base. Verge long, conic, with dense, weak longitudinal grooves. Inner penial wall supporting longitudinal, prominent and narrowly spaced pilasters (Fig.
Reproductive system of sinistral Chinese sinistral species of Camaena. A C. cicatricosa (FJIQBC 18483, Guiping, Guangxi, China) B C. obtecta (FJIQBC 18743, Longbang, Jinxi, Guangxi, China) C C. inflata (FJIQBC 18797, Qianlin park, Guiyang, Guizhou, China) D C. connectens (FJIQBC 18832, Tianbao, Malipo, Yunnan, China) E C. poyuensis sp. n. (FJIQBC 18484, Poyue, Bama, Guangxi, China). Abbreviations: V, verge; AG, albumen gland; BC, bursa copulatrix; E, epiphallus; F, flagellum; HD, hermaphroditic duct; P, penis; PR, penis retractor muscle; PBC, pedunculus of bursa copulatrix; VD, vas deferens.
Guangdong Province to Nanning, Guangxi (Fig.
This species is locally found in high densities in a variety of habitats, which include virgin forests, semi-natural woodland, farmlands and even urban parks. Animals breed during April to September, and reach sexual maturity at 7–8 months of age (
Distinguished from all the other sinistral species of Camaena by its smaller size, having half opened umbilicus, and thin shell, as well as by having only longitudinal pilasters on the inner penial wall, and a long conical penial verge with longitudinal wrinkles. The shell is similar in size as C. inflata, but the latter differs by having a more globular shape and thicker shell, more convex whorls, and narrowly-spaced transverse wrinkles on the inner penial wall and penial verge.
Helix (Camaena) cicatricosa var. obtecta Fischer, 1898: 315, pl. 17, figs 5–6.
Vietnam: Luc Chu and Cao Bang
See Table
Shell sinistral, large, thick, solid, depressed-globular, yellowish brown to dark brown, with obtuse apex and low dome-shaped spire; 5 1/2 rapidly increasing and slightly convex whorls separated by deep suture; body whorl expanded, descending in front; periphery bluntly angulate in front of aperture, becoming round behind peristome. Surface with thick growth lines, fine spiral ribs, and weak malleation. Aperture ovate-lunate, white inside, with curved margin. Peristome white, expanded, reflected, thickened and glossy; columellar margin strongly expanded; inner lip thick, callous. Basal lip straight, forming an obtuse angle at junction with straight and oblique columellar lip. Umbilicus completely covered by reflected columellar lip and thickened callus when fully matured. Hump beside umbilicus present. Color pattern of numerous wavy, reddish brown spiral bands of various thickness; subperipheral and subsutural bands much wider (Fig.
Penis short, swollen, with a rounded bulge in correspondence of verge. Epiphallus medium with short, thin and wide penis retractor muscle. Flagellum elongated, tapering distally. Vas deferens long and thin. Vagina short and thickened. Bursa copulatrix clavate with long and thin pedunculus, apparently expanded at basal one-third its length. Verge conic, with irregular and curly wrinkles. Inner penial wall supporting transverse and narrowly spaced pilasters (Fig.
This species has previously been recorded from Cao Bang and Luc Chu in northern Vietnam. Luc Chu is the area north of Cao Bang to the border with China according to
This species inhabits forests on limestone, including degraded forests.
This species is characterized in having a hump beside the completely covered umbilicus, thick shell, ovate-lunate aperture, transverse only pilasters on inner penial wall, and a conic verge with irregularly curly wrinkles. It differs from C. cicatricosa by having a larger shell, a completely covered umbilicus, humped base beside umbilicus, more convex whorls and ovate-lunate aperture. It forms a well-differentiated clade in the phylogenetic tree (Fig.
Helix cicatricosa var. inflata Möllendorff, 1885: 393.
Helix (Camaena) cicatricosa var. inflata,
Camaena cicatricosa var. inflata,
Camaena cicatricosa cicatricosa,
Tshien-ti-shan, province of Guidshou [Tshien-te-shan (Yen, 1939)].
Holotype.
Additional material see Table
Shell sinistral, medium, thick, solid, globular, yellowish brown to brown, with obtuse apex and dome-shaped spire; 5 rapidly increasing and convex whorls separated by deep suture; body whorl expanded, slightly shouldered, slightly descending in front; periphery weakly angulate in front of aperture, becoming round before peristome. Surface with thick growth lines, and fine spiral ribs. Aperture roundly lunate, white inside, with curved margin. Peristome white, expanded, reflected, thickened and glossy; columellar margin expanded. Upper lip decline quickly; inner lip thickly callous. Basal lip curved, forming a smooth junction with oblique columellar lip. Umbilicus narrow, more than two-third of its area covered by reflected columellar lip. Hump beside umbilicus present. Color pattern of 3–5 reddish brown spiral bands on upper surface and numerous wavy, reddish brown spiral bands of various thickness bands on base; subperipheral and subsutural bands much wider (Fig.
Penis short, swollen, with a rounded bulge in correspondence of verge. Epiphallus swollen, with short and thin penis retractor muscle. Flagellum thickened, tapering distally. Vas deferens long and thin. Vagina short and swollen. Bursa copulatrix oval with long and thin pedunculus, expanded at basal half its length. Verge long, bluntly conic, with widely-spaced transverse wrinkles basally, dense and weak longitudinal grooves apically. Inner penial wall supporting several weak and dense pilasters: proximally transverse surrounding verge, distally longitudinal (Fig.
Known only from Guizhou, China (Fig.
This species inhabits limestone forest. The animals appeared sensitive to environmental condition and can not be observed in farmland. Animals copulate during April to August (May and June mostly), lay eggs in September-October which hatch in 30 to 40 days (
This species is characterized in having a globular and solid shell, the swelling and gibbous last whorl, a roundly lunate aperture, an almost covered umbilicus, both transverse and longitudinal pilasters on inner penial wall, and a bluntly conic verge with transverse and longitudinal wrinkles. Shell size varied between the two sampled populations (Table
Camaena cicatricosa var. connectens Dautzenberg and Fischer, 1906: 356.
Camaena cicatricosa connectens,
Vietnam, Ha-Giang
Type material. Syntype. MNHN-IM 2000-2020.
Additional material see Table
Shell sinistral, large, thick, solid, depressed-globular, yellowish brown to brown, with obtuse apex and low dome-shaped spire; 5 1/2 rapidly increasing and slightly convex whorls, separated by shallow suture; body whorl expanded, weakly shouldered, slightly descending in front; periphery bluntly angulate in front of aperture, becoming round behind peristome. Surface with rough growth lines, spiral ribs, and apparent malleation. Aperture roundly lunate, white inside, with curved margin. Peristome white, expanded, reflected, thickened and glossy; columellar margin expanded. Inner lip thickly callous; basal lip curved, forming a smooth junction with oblique columellar lip. Umbilicus narrow, more than two-third of its area covered by reflected columellar lip. Hump beside umbilicus present. Color pattern of a few faint, wavy, reddish brown spiral bands of various thickness bands; subperipheral and subsutural bands much wider (Fig.
Penis swollen, slightly tapering distally, with a rounded bulge in correspondence of verge. Epiphallus thick, with long and thin penis retractor muscle. Flagellum long, thick basally, tapering distally. Vas deferens short and thin. Vagina short and swollen. Bursa copulatrix elongated-oval with long and thin pedunculus, expanded at basal half. Verge bluntly conic, with dense, deep longitudinal grooves. Inner penial wall supporting proximally transverse, short, weak, narrowly-spaced wrinkles surrounding verge, and distally longitudinal, prominent and widely spaced pilasters (Fig.
This species has previously been recorded from Ha Giang in northern Vietnam only. In addition, it is now recorded from Tianbao, Malipo, southeastern Yunnan, China, approximately 20 km northwest of Ha Giang (Fig.
This species inhabits humid limestone forest and can not be found in farmland.
Camaena connectens can be distinguished from other sinistral Camaena species by having a rougher surface, an almost covered umbilicus, fewer and faint spiral bands, a hump beside umbilicus, both transverse and longitudinal pilasters on inner penial wall, and a bluntly conic verge with longitudinal grooves. Camaena hahni broti (Dautzenberg & d’Hamonville, 1887) resemble C. connectens in having a sinistral shell with rough surface, but the former has a nearly opened umbilicus, and carinate periphery. Camaena connectens differs from C. cicatricosa in having a larger shell, a narrower umbilicus, a hump beside umbilicus, and both transverse and longitudinal wrinkles on inner penial wall. This species can be distinguished from C. obtecta by having a larger shell, a wider umbilicus, a curved basal lip, and both transverse and longitudinal wrinkles on inner penial wall. This taxon is raised to species rank because of the well-differentiation of molecular and morphological characters.
Holotype. FJIQBC 18484, specimen preserved in ethanol, China, Guangxi Zhuang Autonomous Region, Hechi City, Bama County, Poyue town, 24°17'30"N; 107°05'32"E (Fig.
Paratypes. 19 specimens with the same data as holotype but with the following specimen codes: 4 in ethanol (FJIQBC 18485–18488), 2 adults; 15 empty shells (FJIQBC 18489–18503), 9 adults.
Measurements of shells see Table
Shell sinistral, large, thick, discoidal, with obtuse apex and low dome-shaped spire; 5 1/2 rapidly increasing and slightly convex whorls separated by deep suture; body whorl expanded; peripheral angle blunt. Surface with thick growth lines, and fine spiral ribs. Aperture lunate, angulated by peripheral carina. Peristome expanded, reflected, thickened and glossy. Inner lip thin, forming a smooth, semi-translucent, and purplish callus. Basal lip and columellar lip straight, with obtuse angle at junction. Umbilicus covered completely by reflected columellar lip. Color pattern of several wavy, reddish brown spiral bands of various thickness, peripheral and subsutural bands much wider; spire dark brown. Peristome and callus tinted purplish (Fig.
Animal light brown, tentacles dark brown, distinct yellowish line, running from the head between tentacles to the collar near the peristome (Fig.
For the type locality, adjective of feminine gender.
This species is known from the type locality only.
The new species habits in a well-preserved subtropical evergreen broadleaved forest, and is not common. The animal was not found in farmland adjacent to the forest.
Diagnostic comparisons of morphological characters of the new species and the other four Camaena were summarized in Table
Diagnostic comparisons of morphological characters of five sinistral Camaena from China.
Character | C. cicatricosa | C. obtecta | C. inflata | C. connectens | C. poyuensis sp. n. |
---|---|---|---|---|---|
SW (mm) | 33.8–48.7 | 53.2–61.9 | 38.4–56.7 | 48.2–55.3 | 52.5–58.7 |
Umbilicus | half covered | completely covered | almost covered | almost covered | completely covered |
Shell shape | depressed-globose | depressed-globose | globose | depressed-globose | depressed-globose |
Shell thickness | thin | thick | thick | thick | thin |
Basal lip | curved | straight | curved | curved | straight |
Hump beside umbilicus | absent | humped | humped | humped | absent |
Pilaster on inner penial wall | longitudinal, narrowly-spaced | transverse, narrowly-spaced | proximal: transverse, narrowly-spaced distal: longitudinal, narrowly-spaced |
proximal: transverse, widely-spaced wrinkles distal: longitudinal, widely-spaced |
proximal: transverse, narrowly-spaced distal: longitudinal, widely-spaced |
Verge | long conic | conic | bluntly long conic | bluntly conic | short conic |
Verge surface | longitudinal, dense, weak wrinkles | irregularly curly, weak wrinkles | Proximal: transverse, deep wrinkles distal: longitudinal, dense, shallow wrinkles |
longitudinal, dense, deep grooves | longitudinal, deep grooves |
The morphology of the reproductive system of C. poyuensis is similar to C. cicatricosa, but differs in the following characters: The pedunculus of the bursa copulatrix is longer, more than twice as long as the vagina (it is about as long as the vagina in C. cicatricosa). The epiphallus and penis are thicker than in C. cicatricosa, and the penis has a visible projection. Camaena poyuensis sp. n. has shorter verge with both transverse and longitudinal grooves, and transverse pilasters in proximal part of penis. The verge of C. obtecta is similar to that of C. poyuensis sp. n. in shape, but its surface is covered throughout with irregular, fine and curly wrinkles. Only transverse pilasters are present in the penis of C. obtecta, whereas both the transverse and longitudinal pilasters are seen in the new species.
The systematics of four of the five subspecies of C. cicatricosa has been revised in this study. The genetic distances of the COI barcoding region between C. cicatricosa, C. inflata, C. obtecta, C. connectens and the new species agree with the interspecific genetic distances of other camaenid groups, such as, for example, the Australian camaenid Kimberleytrachia (0.055–0.161, Criscione and Köhler, 2014), the Japanese camaenid Luchuhadra (0.003–0.205,
Live specimens of two Chinese sinistral Camaena were not collected in the present study: C. c. ducalis and C. seraphinica. Their systematic position are not revised and remained as their current taxonomic ranks. Camaena c. ducalis was named based on a single specimen collected from Kouy-Yang-Fou (nowadays Guiyang), Guizhou. No further specimens were confirmedly recorded since its publication. The present authors and Prof. Tai-Chang Luo (a malacologist based on Guizhou Normal University, Guiyang, personal communication) have spent decades in biodiversity survey in Guizhou, but no shell fullfil the original descriptions were collected (
The molecular data also confirms the widely distributed C. cicatricosa a well-delineated species by including samples from subtropical lowland and hill region of Guangdong and eastern Guangxi Province. An extreme example is that individuals from Shantou and Nanning, populations that are about 1000 km apart (Fig.
Most of Camaena (Camaena) are distributed in the area of southwestern China and northern Vietnam, where is located at northern part of the Indo-Burma Hotspot and at transition to the Mountains of Southwest China Hotspot (
The present molecular data set using three genetic markers supports the previous separations of C. cicatricosa based exclusively on shell morphology. However, more work is needed to sort out some systematic issues: (1) the taxonomy and phylogenetic relationship of all of the Camaena species, especially those inhabit around the border between Vietnam and China (2) the mechanism of speciation of Camaena in this area (3) the phylogeography of C. cicatricosa, the most widely distributed species in China.
We sincerely thank associate professor Wei-Hong Zhang of the University of Xinjiang, professor Tai-Chang Luo of Guizhou Normal University, and professor De-Niu Chen of Institute of Zoology, Chinese Academy of Science for helpful comments on the manuscript. We are grateful to Dr. R. Janssen of