Research Article
Print
Research Article
Species delimitation of the Hyphydrus ovatus complex in western Palaearctic with an update of species distributions (Coleoptera, Dytiscidae)
expand article infoJohannes Bergsten, Elisabeth Weingartner§, Jiří Hájek|
‡ Swedish Museum of Natural History, Stockholm, Sweden
§ Stockholm University, Stockholm, Sweden
| National Museum of Prague, Prague, Czech Republic
Open Access

Abstract

The species status of Hyphydrus anatolicus Guignot, 1957 and H. sanctus Sharp, 1882, previously often confused with the widespread H. ovatus (Linnaeus, 1760), are tested with molecular and morphological characters. Cytochrome c oxidase subunit 1 (CO1) was sequenced for 32 specimens of all three species. Gene-trees were inferred with parsimony, time-free bayesian and strict clock bayesian analyses. The GMYC model was used to estimate species limits. All three species were reciprocally monophyletic with CO1 and highly supported. The GMYC species delimitation analysis unequivocally delimited the three species with no other than the three species solution included in the confidence interval. A likelihood ratio test rejected the one-species null model. Important morphological characters distinguishing the species are provided and illustrated. New distributional data are given for the following species: Hyphydrus anatolicus from Slovakia and Ukraine, and H. aubei Ganglbauer, 1891, and H. sanctus from Turkey.

Keywords

Dytiscidae , Hyphydrus , new records, Palaearctic region, Slovakia, Turkey, Ukraine, GMYC, species delimitation, reciprocal monophyly

Introduction

History of classification

The genus Hyphydrus Illiger, 1802 represents a well-defined group of medium sized, globular shaped Dytiscidae. Altogether 139 species occur in all regions of the Old World, with most species distributed in tropical Africa (Miller and Bergsten 2016; Nilsson and Hájek 2017a). A taxonomic revision of the genus was published by Biström (1982).

Only three Hyphydrus species occur in Europe (cf. Nilsson and Hájek 2017b). While the Mediterranean H. aubei Ganglbauer, 1891 can be easily identified based on black markings on ferrugineous dorsal surface, the uniformly dark-ferrugineously coloured H. anatolicus Guignot, 1957 is very similar to the widespread western Palaearctic H. ovatus (Linnaeus, 1760) and it was not recognised until 1957. Hyphydrus anatolicus was described originally from Angora [= Ankara], Turkey (Guignot 1957). Subsequently Sanfilippo (1963) described the same species under the name H. carrarai Sanfilippo, 1963 from Italy. The synonymy of both species was established by Pederzani (1976). The species was later included in the revision of Biström (1982), who synonymized H. anatolicus with the older name H. sanctus Sharp, 1882, known previously only from the Levant region. Biström (1982) also argued that H. sanctus and H. ovatus should possibly be regarded as subspecies, but that more work was needed. Although Wewalka (1984) described the differences between H. anatolicus and H. sanctus, and a habitus photo of H. anatolicus was published by Hájek (2009), both mentioned species remain enigmatic, predominantly because of their similarity with H. ovatus, and because their distribution is not satisfactorily known.

Molecular data from museum specimens

With the advance of DNA Barcoding, extraction and amplification techniques have moved forwards in two directions. First towards high-throughput low-cost facilities racing from specimens to barcodes (Ivanova et al. 2006) and boosted by next-generation sequencing techniques (Shokralla et al. 2014). Second towards non-destructively generating DNA sequence data from older museum material with degenerated DNA (Gilbert et al. 2007). The latter will get ever more important as local and global extinction of species due to human activities means that getting fresh material of many species will be impossible or increasingly difficult. Therefore the only resort is to old, often dry-pinned or dry-mounted museum material, with the DNA degraded to various degrees. Little is known about exactly how fast DNA degrades under various conditions (but see Allentoft et al. 2012), but any probability model will have longer half-time the shorter the fragment. Thus, aiming for shorter amplicon size has been the preferred method, not least seen in the field of ancient DNA (Thomsen et al. 2009).

In this study, one of the three focal species is very rarely collected hence we attempt to amplify a >800bp segment of cytochrome c oxidase subunit 1 (CO1), from 19–25 years old dry-mounted specimens. We do this by using additives to standard DNA extraction lysis solutions and designing a number of internal primers to amplify the target segment in six short but overlapping fragments. Extractions are done on whole body but completely non-destructive, an important requirement for invaluable museum specimens.

We also use the general mixed Yule coalescence model (Pons et al. 2006) and a likelihood ratio test to explicitly test whether the H. ovatus-complex is better seen as one species (null hypothesis) or several species (alternative hypothesis) in a statistical likelihood framework. The GMYC model was developed as a tool for exploring and delimiting poorly known faunas based on DNA sequences. However here we use it in the context of testing questioned taxa of unsettled taxonomic status in an integrated toolbox where both DNA sequence data, speciation/coalescence models and morphological data bear evidence on the hypothesis.

To clarify the status and distribution of Hyphydrus anatolicus and H. sanctus, we provide a basal differential diagnosis of both species and related H. ovatus. We confirm the specific status of all taxa with molecular analysis. In addition, we review published records and add new faunistic data for H. anatolicus and H. sanctus, as well as the first record of H. aubei from Turkey.

Material and methods

Hyphydrus ovatus was sampled throughout Europe. We acquired fresh material of H. anatolicus from Russia and dry-mounted specimens from Turkey, Greece and Slovakia. Hyphydrus sanctus was available only as dry-mounted specimens from Israel and Turkey for molecular analysis; H. aubei was used as an outgroup in the parsimony and non-clock analyses. The specimens included in this study are deposited in the following institutional collections; for specimens included in molecular analysis, see Table 1.

Table 1.

Data on extracted specimens, depository, catalogue number and genbank accession number for the CO1 fragment.

Cat. ID Species Country Region Place Date Lat / Lon Collector Depository CO1bp Acc. No.
704819 Hyphydrus ovatus UK:Scotland Carrick Kirkcudbrightshire, Syllodioch 25:VI:2005 55.215N, -4.499W G.N. Foster NHM:BMNH 825 FN998871
721926 Hyphydrus aubei Spain Tarragona riu Algars, Horta de San Joan 26:V:2005 40.991N, 0.277E I. Ribera NHM:BMNH 825 FN998872
722129 Hyphydrus ovatus UK:England Norfolk East Harling Common 10:VII:2005 52.451N, 0.942E G. Nobes NHM:BMNH 825 FN998873
722301 Hyphydrus ovatus UK:Scotland Carrick Boreland of Girthon, Kirkcudbrightshire 02:VII:2005 55.215N, -4.499W G.N. Foster NHM:BMNH 788 FN998874
722447 Hyphydrus ovatus UK:England Norfolk Thompson Common 03:VII:2005 52.532N, 0.855E G. Nobes NHM:BMNH 689 FN998875
724810 Hyphydrus ovatus UK:England Norfolk Thompson Common 25:IX:2005 52.529N, 0.854E G. Nobes NHM:BMNH 731 FN998876
749803 Hyphydrus ovatus Sweden Ångermanland Torrböle 12:VI:2005 63.716N, 19.558E AN. Nilsson NHM:BMNH 751 FN998877
729468 Hyphydrus ovatus Sweden Öland Borgholm, Langlöt 20:VI:2005 56.747N, 16.685E J. Geijer NHM:BMNH 702 FN998878
729591 Hyphydrus ovatus Sweden Öland Borgholm, Högsrum 19:VII:2005 56.795N, 16.598E J. Geijer NHM:BMNH 825 FN998879
729653 Hyphydrus ovatus Latvia Riga district Gaujus National Park, Sigulda, Maza velnala 10:VI:2005 57.152N, 24.865E L. Hendrich NHM:BMNH 825 FN998880
729731 Hyphydrus ovatus Latvia Cesis district Gaujas National Park, Klamani village 11:VI:2005 57.3N, 25.25E L. Hendrich NHM:BMNH 825 FN998881
743243 Hyphydrus ovatus Germany Bavaria Eitting, Eittinger Moos 19:VI:2005 48.3N, 11.933E M. Balke NHM:BMNH 825 FN998882
743298 Hyphydrus ovatus Germany Brandenburg 1.5 km N Fresdorf 18:X:2005 52.267N, 13.083E L. Hendrich NHM:BMNH 750 FN998883
743957 Hyphydrus ovatus Germany Bavaria Murnauer Moos, Rollisch See 06:IX:2005 47.683N, 11.2E M. Balke NHM:BMNH 825 FN998884
743962 Hyphydrus ovatus Sweden Öland Borgolm, Vanserum 16:VIII:2005 56.691N, 16.641E J. Geijer NHM:BMNH 825 FN998885
743968 Hyphydrus ovatus Sweden Öland Borgolm, Runsten 07:VII:2005 56.716N, 16.633E J. Geijer NHM:BMNH 825 FN998886
743973 Hyphydrus ovatus Sweden Öland Mörbylånga, Algustrum 27:VIII:2005 56.687N, 16.598E J. Geijer NHM:BMNH 825 FN998887
800099 Hyphydrus ovatus Russia Volgograd Obl between Lisov & Polodin 29:IV:2002 48.617N, 43.169E J. Bergsten NRM:NHRS 825 FN998888
800100 Hyphydrus anatolicus Russia Volgograd Obl between Lisov & Polodin 29:IV:2002 48.617N, 43.169 J. Bergsten NRM:NHRS 825 FN998889
800104 Hyphydrus anatolicus Russia Volgograd Obl between Lisov & Polodin 30:IV:2002 48.617N, 43.169E J. Bergsten NRM:NHRS 825 FN998890
800105 Hyphydrus anatolicus Russia Volgograd Obl Artyedinsko Donskie Peski 03:V:2002 49.686N, 43.333E J. Bergsten NRM:NHRS 825 FN998891
800108 Hyphydrus ovatus Russia Volgograd Obl Krasnoslobodsk N.P. 4-5:V:2002 48.7N, 44.6E J. Bergsten NRM:NHRS 825 FN998892
800109 Hyphydrus anatolicus Russia Volgograd Obl Kretskiy 05:V:2002 48.608N, 44.706E J. Bergsten NRM:NHRS 825 FN998893
800115 Hyphydrus ovatus Russia Volgograd Obl Baybaev, river Don 8-11:V:2002 49.175N, 44.007E J. Bergsten NRM:NHRS 825 FN998894
824863 Hyphydrus ovatus UK:England Cornwall The Lizard Hayle Kimbro pool 01:VII:2005 50.255N, -5.242W D. Bilton NHM:BMNH 825 FN998895
JLKB241 Hyphydrus sanctus Israel Hula reserve 21:III:1985 33.103N, 35.609E M. Jäch NMPC:ENT 825 FN998896
JLKB242 Hyphydrus sanctus Israel Talme Elazar 21:IV:1986 32.445N, 34.978E M. Jäch NMPC:ENT 825 FN998897
JLKB243 Hyphydrus sanctus Turkey Mugla Köycegiz 27:V:1991 36.973N, 28.686E M. Jäch NMPC:ENT 147 FN998898
JLKB244 Hyphydrus sanctus Turkey Mugla Köycegiz 27:V:1991 36.973N, 28.686E Schödl NMPC:ENT 665 FN998899
JLKB518 Hyphydrus anatolicus Turkey Mugla Köycegiz 27:V:1991 36.973N, 28.686E Schödl NMPC:ENT 825 JX221701
JLKB519 Hyphydrus anatolicus Slovakia Slov. Mer. Tvrdosovce, 1 km N of Tvrdosovce 24:IV:2000 48.147N, 18.065E T. Kopecky NMPC:ENT 825 JX221702
JLKB520 Hyphydrus anatolicus Greece Chalkidiki Sithonia, 2 km S Kalamitsi 12:VIII:2000 39.97N, 23.988E J. Hotovy NMPC:ENT 825 JX221703

BMNHNatural History Museum [former British Museum (Natural History)], London, Great Britain (Christine Taylor);

HFCB Hans Fery collection, Berlin, Germany (property of NHMW);

NHMWNaturhistorisches Museum, Wien, Austria (Manfred A. Jäch);

NHRSNaturhistoriska Riksmuseet (= Swedish Museum of Natural History), Stockholm, Sweden (Johannes Bergsten);

NMPCNárodní muzeum, Praha, Czech Republic (Jiří Hájek);

ZMASZoological Institute, Russian Academy of Science, Sankt Petersburg, Russia (Alexander G. Kirejtshuk).

Molecular analyses

The extraction protocol was different for the fresh alcohol-material of H. ovatus and H. anatolicus (from Russia) versus the dry-mounted older material of H. anatolicus and H. sanctus. The former was extracted in 96-well Wizard SV plates following the manufacturers instructions (Promega). The 3’ end of cytochrome c oxidase subunit 1 (CO1) was amplified with the primers PatDyt or RonDyt (Isambert et al. 2011) and Jerry (Simon et al. 1994) using 1ul of DNA, Bioline Taq and the following cycling conditions: 94° for 2min, 35 to 40 cycles of 94° for 30s, 51–53° for 60s and 70° for 90-120s, and a final extension of 70° for 10 min. PCR products were cleaned with a 96-well Millipore multiscreen plate, sequenced in both directions using a Big Dye 2.1 terminator reaction, and analysed on an ABI 3730 automated sequencer. PatDyt and Jerry were used as sequencing primers. The older dry-mounted specimens were extracted using the QIAamp® DNA Micro Kit (QIAGEN®), following the tissue protocol with the addition of 20ul of DTT (Dithiothreitol)(Sigma-Aldrich). PCR was done with a set of 6 newly designed primer pairs (Table 2) amplifying the complete 825bp CO1 segment in shorter overlapping segments between 147 and 228bp long. We used Ready-ToGo™ PCR beads (Amersham Biosciences) together with 1ul of 10uM of each primer, 2ul of DNA and 21ul water in a 25ul reaction. Cycling conditions started with a 5 min denaturation step at 95°C followed by two cycles of 30 s at 95°C, 30 s at 45°C (first, second and fourth fragments) or 50°C (third, fifth and sixth fragments), and 40 s at 72°C, then two cycles of 30 s at 95°C, 30 s at 43°C or 48°C and 40 s at 72°C, and 39 cycles of 40 s at 95°C, 40 s at 41°C or 46°C, 50 s at 72°C, then a final extension step of 8 min at 72°C. PCR reactions were purified with Exonuclease I and FastAP (Fermentas) in the proportion 1:4, and sequenced with a BigDye™ Terminator ver. 1.1 Cycle Sequencing Kit (Applied Biosystems), cleaned with a DyeEx 96 kit (QIAGEN) and run on an ABI Prism 3100 Genetic Analyzer (Applied Biosystems). Sequences are submitted to Genbank under accession codes FN998871-FN998899 and JX221701- JX221703.

Table 2.

Newly designed primers (apart from Jerry and PatDyt) used to amplify 825bp of CO1 in 6 overlapping fragments from 11-25 years old, dry-pinned, Hyphydrus specimens.

Primer 5’ à 3’ Pair Length
Jerry CAACATTTATTTTGATTTTTTGG 1 178bp
Hyp178rw AATATGCTCGAGTATCAAC 1
Hyp161fw GTTGTATGAGCTCATCATATA 2 189bp
Hyp349rw TAGATGAATTTGCAAGGACTAC 2
Hyp276fw AGCTACCCTTCACGGATCTC 3 125bp
Hyp400rw CATAATGAAAGTGAGCCACTAC 3
Hyp371fw GTAGTCCTTGCAAATTCATCT 4 228bp
Hyp598rw CAGGATAGTCTGAGTAACG 4
Hyp507fw TTACAGGACTATCATTAAATTCTA 5 147bp
Hyp653rw CTCCAATAAATGATATAGTAGATC 5
Hyp616fw CTCGACGTTATTCAGACTATCC 6 210bp
Patdyt TCATTGCACTAATCTGCCATATTAG 6

Sequences were assembled and edited in Sequencher 4.8 (Gene Codes Corporation) and aligned in ClustalX 2.0 (Larkin et al. 2007) with default settings of 15 as gap opening penalty and 6.66 as gap extension penalty. The alignment contained no gaps. Bayesian analysis was done with MrBayes 3.2.1 (Ronquist et al. 2012). We set up a partitioned model based on 3rd resp. 1st+2nd codon positions and applied a HKY+G+I model to each partitions, unlinking statefrequencies, t-ratio, shape and proportion of invariable sites. Partitions were allowed separate rates with a variable rate prior. All other prior and proposal settings were left as default. We ran two separate runs each with four chains (one cold and three incrementally heated) 3 million generations sampled every 1000th generation. First 25% was discarded as burn-in. For the first analysis we used a time-free model and rooted the tree with the outgroup Hyphydrus aubei. For the second analysis we excluded the outgroup and instead tested the placement of the root with a clockmodel. We used a Bayes Factor test to assess if the data was compatible with a strict molecular clock or if a relaxed clock should be used. A heuristic parsimony analysis was run in Nona (Goloboff 1999) (hold 10000, Mult*100, hold/10, mult*max*) spawned from Winclada (Nixon 1999-2002). The parsimony analysis was followed by optimising the characters on the most parsimonious tree. This was done to show discrete character support for the three species. We performed a species-delimitation analysis using the general mixed yule coalescence model (GMYC) as implemented in R (R Development Core team 2005) with the package Splits (Ezard et al. 2009; Fujisawa and Barraclough 2013). We tested the null-hypothesis that the Hyphydrus ovatus-complex is a single species versus the alternative hypothesis that it consists of more than one species with a likelihood ratio test under the GMYC model. The GMYC method optimizes the likelihood of a single threshold across an ultrametric gene-tree. The threshold defines speciation branches towards the root from the threshold and within-species coalescence branches towards the tips from the threshold. The older branches are modelled with a Yule (speciation) model while the younger branches are delimited into n-groups where each group is modelled with a separate coalescent process model. The maximum likelihood solution of the GMYC model (the likelihood is calculated placing the threshold at each node across the tree) is compared against a model treating the entire gene-tree as a single coalescence (i.e. as a single species) in the likelihood ratio test. We used the ultrametric clock-tree generated above as input to the species delimitation test.

Morphological observations

The specimens were examined using an Olympus SZX12 stereomicroscope. Measurements were taken with an ocular graticule. Habitus photographs were taken using a Canon MP-E 65mm f/2.8 macro lens with 5:1 optical magnification on bellows attached to a Canon EOS 550D camera. Drawings were made based on photographs taken using an Olympus SZX12 microscope equipped with a Canon EOS 1100D digital camera. Images of the same specimen/structure at different focal planes were combined using Helicon Focus 5.1.19 software. To avoid artefacts due to desiccation of poorly sclerotised parts, the genitalia were illustrated mounted in dimethyl hydantoin formaldehyde resin (DMHF) on the same card as the beetle.

Results

Molecular analyses

Amplification was highly successful with the short fragment PCRs of old dry-mounted material (Table 3). The full-length 825bp segment was achieved for the two H. sanctus specimens from Israel, 665bp for one of the Turkish specimens, and a 147bp segment of the second Turkish specimen, with three ambiguous base calls. The last specimen also gave a 175bp sequence from primer pair 1 (Table 2) that turned out to be contaminated DNA with closest BLAST hit on Genbank being saccharomycete fungi. This is always a risk when extracting DNA from the whole body of a specimen. All three dry-mounted H. anatolicus specimens yielded full-length CO1 sequences.

Table 3.

Details on the older extracted specimens and the associated DNA data.

Species GUID NMPC: Country Specimen state Age (years) Bp Ambiguous base calls
Hyphydrus anatolicus JLKB000000518 Turkey Dry-mounted 20 825 0
Hyphydrus anatolicus JLKB000000519 Slovakia Dry-mounted 11 825 0
Hyphydrus anatolicus JLKB000000520 Greece Dry-mounted 11 825 0
Hyphydrus sanctus JLKB000000244 Turkey Dry-mounted 20 665 0
Hyphydrus sanctus JLKB000000241 Israel Dry-mounted 25 825 0
Hyphydrus sanctus JLKB000000242 Israel Dry-mounted 24 825 0
Hyphydrus sanctus JLKB000000243 Turkey Dry-mounted 20 147 3

Genetic distances between the three presumed species in the ovatus-complex turned out to be large (Table 4). The distance between H. ovatus and H. anatolicus or H. sanctus was 9.4–11.4% (K2P-model). The distance between H. sanctus and H. anatolicus was slightly less, 6.7–7.1%. These genetic distances strongly indicate that we are dealing with three valid and separate species in the ovatus-complex. Within-species variation was less than 1.4%. The time-free bayesian analysis as well as the parsimony analysis, both rooted with H. aubei as outgroup, confirmed that the three presumed species are reciprocally monophyletic and separated from each other with long branches (Figs 12). Posterior probability support values were 1.0–0.98 for all three species. H. sanctus and H. anatolicus are sister species according to this single-gene phylogeny both in the outgroup-rooted trees (Figs 12), and in the clock-rooted tree (Fig. 3). Parsimony analysis and character optimization confirmed the H. sanctus + H. anatolicus sister group relationship with 17 supporting unambiguous and non-homoplasious substitutions (Fig. 2). Also all three presumed species were supported with between 16 and 24 unambiguous and non-homoplasious substitutions (Fig. 2). The Bayes factor test strongly favoured the strict clock (LnL=-1701) over a time-free model (LnL=-1764) (2*LnBF=125), hence a strict, as oppose to a relaxed, clock model was used to generate an ultrametric tree (Fig. 3). The GMYC model delimited three clusters congruent with the three presumed species as the maximum likelihood solution (Fig. 3). An approximate confidence interval of 2log likelihood units from the maximum likelihood (3 clusters) did not include any other solution. The explicit likelihood ratio test of the null hypothesis of a single coalescing unit (species) was refuted in favour of the alternative hypothesis of three separately evolving and coalescing units (-Log Lone species= 211.9965, -Log Lthree species= 218.2261, Likelihood ratio=12.4592, p=0.00596).

Figure 1. 

Majority-rule consensus tree from the non-clock Bayesian analysis. Posterior probability clade support values >0.9 shown. Country abbreviations: SW=Sweden, GE=Germany, UK=United Kingdom, La=Latvia, RU=Russia, TU=Turkey, IS=Israel, GR=Greece, SL=Slovakia. Rooted (midpoint) with Hyphydrus aubei.

Figure 2. 

One of 14 most parsimonious trees (L=203, zero-length branches hard-collapsed) with unambiguous characters optimized. Black dots=non-homoplasious characters, white dots=homoplasious characters. Numbers refer to the character’s position in the alignment from 1-825. The other 13 cladograms only differed in within-species internal organizations. Rooted with Hyphydrus aubei. Country abbreviations as in Figure 1.

Figure 3. 

Clock-rooted ultrametric tree from Bayesian analysis with branches coloured according to the GMYC species delimitation analysis. Posterior probability clade support values >0.9 shown. Black branches=speciation events, red braches=within species coalescence events. Country abbreviations as in Figure 1.

Table 4.

Genetic distances between species calculated with Kimura 2-parameter model. Pairwise deletion of missing data was used, and the shortest fragment of H. sanctus (147bp) was deleted from comparison.

H. ovatus H. anatolicus H. sanctus H. aubei
H. ovatus 0.000–0.014 / / /
H. anatolicus 0.102–0.114 0.001–0.002 / /
H. sanctus 0.094–0.107 0.067–0.071 0.001–0.008 /
H. aubei 0.119–0.126 0.125–0.128 0.132–0.138 -

Systematics and distribution

All mentioned species belong to the Hyphydrus ovatus species group sensu Biström (1982). The group contains nine species occurring exclusively in the Palaearctic region. The members of the group are well characterised with the longer metatibial spur of males serrate (cf. Fig. 7). The four western Palaearctic species share the similar shape of the median lobe of aedeagus which is rather poorly sclerotised, in ventral view nearly parallel-sided with sides straight, very slightly and continually narrowing from base to apex (cf. Fig. 8). Finally, the three species of the H. ovatus complex (i.e. H. anatolicus, H. ovatus and H. sanctus) can be easily recognised by their more or less uniform dark ferrugineous to ferrugineous body colouration, rarely with minor pale markings.

Due to rather weak sclerotisation of external genitalia, the genital characters have only limited use for identification of species in this complex. Therefore, we focused more on habitus, punctuation and structure characters of the species. The most diagnostic character is probably the shape of the longer metatibial spur on males (see Fig. 7). A key to identification of all western Palaearctic species of the H. ovatus species group is presented at the end of the taxonomic section.

Hyphydrus anatolicus Guignot, 1957

Hyphydrus anatolicus Guignot, 1957: 91 (orig. descr.; type locality: “Angora” [Ankara, Turkey]).

Hyphydrus carrarai Sanfilippo, 1963: 77 (orig. descr.; type locality: “Macchia di Migliarino, Torre del Lago (Toscana)” [Italy]); synonymy by Pederzani 1976: 166.

Hyphydrus sanctus : Biström 1982: 39 (partim, misidentification).

Published records

Bosnia and Hercegovina: Biström (1982: 39 as H. sanctus). Croatia: Guéorguiev (1971: 8 as H. carrarai); Biström (1982: 39 as H. sanctus); Ádám (1992: 194 as Hyphydrus sanctus); Temunović et al. (2007: 17); Krčmar (2014: 20). Greece: Biström (1982: 39 as H. sanctus); Wewalka (1984: 131). Hungary: Ádám (1992: 194 as H. sanctus); Csabai et al. (1999: 148 as H. sanctus); Móra et al. (2004: 153); Csabai and Nosek (2006: 73); Kálmán et al. (2008: 76); Molnár (2008:110); Sóos et al. (2008: 223); Lőkkös (2010:161). Italy: Sanfilippo (1963: 77 as H. carrarai); Angelini (1972: 182 as H. carrarai; 1984: 54); Pederzani (1976: 166); Biström (1982: 39 as H. sanctus); Rocchi (1991: 68); Pederzani & Campadelli (1996: 21); Nardi (1997: 132); Bordoni et al. (2006: 87). Macedonia: Biström (1982: 39 as H. sanctus). Montenegro: Scheers (2016: 209). Russia: Biström (1982: 39 as H. sanctus). Serbia: Mesaroš (2015: 50). Turkey: Guignot (1957: 91).

Material examined

Greece: 2♂♂, Ionian Islands, Kerkyra, Chalikiopoulos [lagoon], 22.iv.1935 (NHMW); 1♂, Eastern Macedonia and Thrace, Évros Distr., plain of Évros river, 26.vii.1988, M. Jäch leg. (NHMW); 1♀, Central Macedonia, Khalkidhiki Distr., Sithonia, 2 km S of Kalamítsion, 12.viii.2000, J. Hotový leg. (NMPC); 5♂♂ 5♀♀, NW Peloponnese, 3 km S Kalogria, 38.1213N, 21.3810E, ca. 3 m, shallow seasonal swamp, 17.v.2010, H. Fery & L. Hendrich leg. (NMPC). Hungary: 1♂ 1♀, Hungary 46 36 (BMNH); 1♀, Bács-Kiskun, Kiskunmajsa env., 11.viii.1999, J. Hájek leg. (NMPC). Montenegro: 1♂, Vranjina env., Skadarsko jezero, 20.ix.2001, J. Hájek leg. (NMPC). Russia: 1♀, Orenburg reg., Totskoye, 1917, Š. Jureček leg. (NMPC); 2♂♂ 2♀♀, Samara, K. Fausta leg. (ZMAS); 1♀, Stavropol reg., Kuma river, 20.iv.1911 (ZMAS); 1♂ 2♀♀, Volgograd reg., 2 km south of Zryanin village, 48°36‘60‘‘N, 43°10‘10‘‘E, small lakes near Liska river, incl silty open bay with grasses, Alisma and Juncus, 29-30.iv.2002, J. Bergsten & A. Nilsson leg. (NHRS); 1♂ 1♀, Volgograd reg., Archeda-Don rivers alluvial sandy plain, 16 km ESE of Terkin village, 49.6861N, 43.3333E, different lakes, grassy ponds, fens and stream, 2-3.v.2002, J. Bergsten & A. Nilsson leg. (NHRS); 3♂♂ 2♀♀, Volgograd reg., Kretskiy, 48.6083N, 44.7061E, river-arm, newly flooded grassland, 5.v.2002, J. Bergsten & A. Nilsson leg. (NHRS). Turkey: 2 spec., Aydin vil. [= province], S of Aydin, ditch, 4.iv.14987, H. Fery leg. (HFCB); 4♂♂ 1♀, Muğla vil. [= province], Köyçeğiz, 27.v.1991, S. Schödl leg. (NHMW, NMPC). Slovakia: 1♂, 1 km N of Tvrdošovce, 24.iv.2000, T. Kopecký leg. (NMPC). Ukraine: 1♂, Kherson distr., monast. Korsunskij, cursus inf. fl. Dnjepr, 3.vi.1927, S. Medvedev leg. (ex coll. Zakharenko, ZMAS).

Diagnosis

Habitus as depicted in Figs 4c, 5c. Clypeus with anterior margin rounded (Fig. 6a). Reticulation of dorsal surface confined to head, more distinct and impressed anteriorly. Punctation of head fine, visible on whole surface; punctures sparse, distance between them usually equal or bigger than their diameter (Fig. 6a). Punctation of pronotum double, fine, distance between larger punctures bigger than their diameter. Punctation of elytra double, diameter of small puncture less than half of diameter of large punctures; distance between large punctures bigger than their diameter. Epipleura smooth with fine punctures. Metatibia with sinuous outer margin.

Figure 4. 

Hyphydrus male habitus. a H. aubei (Corsica; 4.9 mm) b H. ovatus (Sweden; 5.0 mm) c H. anatolicus (Slovakia, specimen post-extraction; 5.1 mm) d H. sanctus (Turkey; 5.2 mm).

Figure 5. 

Hyphydrus female habitus. a H. aubei (Croatia; 4.7 mm) b H. ovatus (Bohemia; 4.6 mm) c H. anatolicus (Greece; 5.0 mm) d H. sanctus (Turkey; 4.9 mm).

Figure 6. 

Hyphydrus head. a H. anatolicus b H. ovatus c H. sanctus. Not in scale.

Male. Longer metatibial spur long, nearly as long as metatarsomere I-II combined (Fig. 7a); spur bisinuate with only indistinct serration basally (Fig. 7a). Male genitalia as in Fig. 8a–d, median lobe in ventral view slightly narrowing from base to apex.

Female. Both shiny and matt forms known of females of H. anatolicus. Shiny form agreeing well with male; matt form with whole surface densely reticulated, meshes somewhat elongate on elytra. Large punctures well visible, small punctures indistinct among reticulation. Longer tibial spur shorter than in male; broad and with serration in basal two thirds, narrowed, slightly curved and without serration in apical third. Female genitalia as in Fig. 8e–g.

Habitat

The species inhabits various types of standing water, predominantly densely vegetated pools, ditches and small ponds. H. anatolicus tolerates also saline habitats.

Distribution

The species is distributed in the Eastern Mediterranean and in south-eastern Europe. It occurs in Italy, southernmost Slovakia, Hungary, the Balkan Peninsula, Turkey, southern Ukraine and Russia up to latitude 55° and east to the Ural Mountains (Fig. 9). First record from Slovakia and Ukraine.

Figure 7. 

Hyphydrus male metatibia, longer metatibial spur and metatarsomere I. a H. anatolicus b H. ovatus c H. sanctus. Scale bar 0.5 mm.

Figure 8. 

Hyphydrus male and female genitalia. a, h, o median lobe of aedeagus in ventral view b, i, p supplementary drawing of apex of median lobe c, j, q median lobe of aedeagus in lateral view d, k, r paramere e, l, s gonocoxa f, m, t gonocoxosternite g, n, u spermatheca. a–g H. anatolicus h–n H. ovatus o–u H. sanctus. Scale bar 0.5 mm.

Figure 9. 

Map of distribution of H. anatolicus (circles, dots) and H. sanctus (squares). White symbols represent records from the literature, large circles represent imprecise data for a larger region (country); black symbols represent records of specimens examined by us.

Hyphydrus ovatus (Linnaeus, 1760)

Dytiscus ovatus Linnaeus, 1760: 547 (type locality: Svecia [Sweden]). For full list of synonymy, see Nilsson & Hájek (2017a: 199).

Material examined

We have examined more than 600 specimens from the Czech Republic, Finland, France, Germany, Great Britain, Russia, Slovakia, Sweden, and Ukraine, deposited in NHRS and NMPC.

Diagnosis

Habitus as depicted in Figs 4b, 5b. Clypeus with anterior margin medially nearly straight (Fig. 6b). Reticulation of dorsal surface confined to head, more distinct and impressed anteriorly (Fig. 6b). Punctation of head fine, visible only in posterior half, punctures on clypeus imperceptible due to strong reticulation (Fig. 6b); punctures dense, distance between them smaller than their diameter (Fig. 6b). Punctation of pronotum double, coarse, distance between larger punctures smaller than their diameter. Punctation of elytra double, diameter of small puncture about half of diameter of large punctures; distance between large punctures, at least basally, smaller than their diameter. Epipleura smooth with fine punctures. Metatibia with outer margin nearly straight.

Male. Longer metatibial spur short, only slightly longer than metatarsomere I (Fig. 7b); spur nearly straight, broad with distinct serration (Fig. 7b). Male genitalia as in Fig. 8h–k, median lobe in ventral view parallel-sided in most of its length.

Female. Both shiny and matt forms are known for females of H. ovatus. Shiny form agreeing well with male; matt form with whole surface densely reticulated, meshes distinctly elongate on elytra. Large punctures well visible, small punctures indistinct among reticulation. Longer tibial spur similar to that of male. Female genitalia as in Fig. 8l–n.

Habitat

The species inhabits various types of standing and slowly flowing water bodies with at least some vegetation. The typical habitats represent (frequently eutrophic) ponds, densely vegetated pools, ditches, oxbows or open swamps.

Distribution

Widely distributed Palaearctic species. With the exception of the Iberian Peninsula, it occurs in most of territory of Europe and temperate Asia east to the Baikal Lake (east Siberia).

Hyphydrus sanctus Sharp, 1882

Hyphydrus sanctus Sharp, 1882: 380.

Published records

Israel: Sharp (1882: 380); Biström (1982: 39); Wewalka (1984: 131). Jordan: Biström (1982: 39); Wewalka (1984: 131). Syria: Biström (1982: 39); Wewalka (1984: 131).

Material examined

Israel: 2♂♂, 1♀, Hula reserve, 21.iii.1985; 4♂♂, 8♀♀, same locality, but 13.iv.1986; 1♂, 3♀♀, Talme Elazar, 21.iv.1986; 1♂, 6♀♀, Magan Michael, 21.iv.1986, all M. Jäch leg. (NHMW, NMPC). Turkey: 3♂♂, 13♀♀, Muğla vil. [=province], Köyçeğiz, 27.v.1991, S. Schödl leg. (NHMW, NMPC); 3♂♂, 2♀♀, same data, but M. Jäch leg. (NHMW, NMPC).

Diagnosis

Habitus as depicted in Figs 4d, 5d. Clypeus with anterior margin medially nearly straight (Fig. 6c). Reticulation of dorsal surface confined to head and more distinct and impressed anteriorly (Fig. 6c), and to sides of pronotum. Punctation of head fine, visible on whole surface (Fig. 6c); punctures dense, distance between them smaller than their diameter (Fig. 6c). Punctation of pronotum double, fine, distance between larger punctures bigger than their diameter. Punctation of elytra double, diameter of small punctures less than half of diameter of large punctures; distance between large punctures bigger than their diameter. Epipleura reticulated with very fine punctures. Metatibia with outer margin nearly straight.

Male. Longer metatibial spur long, nearly as long as metatarsomere I-II combined (Fig. 7c); spur broad and straight in basal two thirds with small but distinct serration, attenuated and curved apically (Fig. 7c). Male genitalia as in Fig. 8o–r, median lobe in ventral view slightly narrowing from base to apex.

Female. Only matt females of H. sanctus are known so far. Whole surface densely reticulated, meshes on elytra somewhat elongate. Large punctures well visible, small punctures indistinct among reticulation. Longer tibial spur similar to that of male, but almost straight in apical third. Female genitalia as in Fig. 8s–u.

Habitat

Similarly to the other two species, H. sanctus inhabits various types of standing and slowly flowing water bodies with at least some vegetation. Wewalka (1984) reported several specimens from a densely vegetated pool and single occurrences from an artificial pool with clear water, an irrigation ditch and from a stream.

Distribution

A species distributed in the Levant region of the Near East. So far recorded from several localities in Israel, Jordan and Syria (Fig. 9). First record from Turkey.

Hyphydrus aubei Ganglbauer, 1891

Note

Hyphydrus aubei is the fourth European species in the Hyphydrus ovatus species group sensu Biström (1982). It does not belong to the Hyphydrus ovatus complex as here defined and it is easily separated from the preceding three species based on colouration (Figures 45).

Material examined

Turkey: 1♂, 2♀♀, Muğla vil. [=province], Köyçeğiz, 27.v.1991, S. Schödl leg. (NHMW, NMPC).

Distribution

Predominantly a Mediterranean species. First record from Turkey.

Key to species

Key to western Palearctic species of the Hyphydrus ovatus species group

1 Elytra with distinct black maculate colour pattern on elytra; head bicoloured, testaceous anteriorly but distinct black areas posteriorly (Figs 4a, 5a) Hyphydrus aubei
Elytra unicoloured, dark ferrugineous to ferrugineous, or with vaguely delimited lighter macula basally and laterally on elytra; head unicoloured, testaceous to dark ferrugineous (Figs 4b–d, 5b–d) 2
2 Punctation of pronotum and elytra (males and shiny females) very coarse; distance between larger punctures smaller than their diameter. Longer male metatibial spur only little longer than metatarsomere I; straight and with distinct serration (Fig. 7b) Hyphydrus ovatus
Punctation of pronotum and elytra (males and shiny females) finer; distance between larger punctures larger than their diameter. Longer male metatibial spur almost as long as metatarsomeres I-II combined; spur not straight, bisinuate or apically curved; serration of spur small to indistinct (Fig. 7a, c) 3
3 Clypeus with anterior margin medially nearly straight; exterior side of metatibia almost straight; longer male metatibial spur straight basally but curved apically and with serration small but visible (Fig. 7c) Hyphydrus sanctus
Clypeus with anterior margin rounded; exterior side of metatibia somewhat sinuous; longer male metatibial spur bisinuate and with indistinct serration basally (Fig. 7a) Hyphydrus anatolicus

Discussion

Our findings from molecular and morphological data unambiguously support the presence of three species of the Hyphydrus ovatus complex in the western Palaearctic and the names H. ovatus, H. anatolicus and H. sanctus are the oldest available names for these three species. The additional distributional findings of H. anatolicus and H. sanctus indicate, that the distribution of the H. ovatus complex is more complex in the eastern part of its range than previously thought. A revision of all previous records of H. ovatus from the Balkan Peninsula and further east is needed. It is highly probable that many records may refer to the other two species, but whether H. ovatus is replaced by, or sympatric with, these remain to be investigated for many areas.

Acknowledgements

We are obliged to all colleagues mentioned in the list of collections for putting specimens at our disposal. Special thanks goes to Hans Fery (Berlin, Germany) who provided us with the specimens of H. anatolicus from Peloponnesus and reviewed the manuscript. The work of J. Hájek was supported by the Ministry of Culture of the Czech Republic (DKRVO 2017/14, National Museum, 00023272) and by the SYNTHESYS project (SE-TAF 386).

References

  • Ádám L (1992) Faunaterületünk ritkább vízibogarak (Coleoptera: Haliplidae, Gyrinidae, Dytiscidae, Hydroporidae). (Rare water beetles of the Carpathians Basin (Coleoptera: Haliplidae, Gyrinidae, Dytiscidae, Hydroporidae). In: Szél G (Ed.) Közlemények.(Contributions). Folia Entomologica Hungarica 52(1991), 189–195. [In Hungarian with English title]
  • Allentoft ME, Collins M, Harker D, Haile J, Oskam CL, Hale ML, Campos PF, Samaniego JA, Gilbert MTP, Willerslev E, Zhang G, Scofield RP, Holdaway RN, Bunce M (2012) The half-life of DNA in bone: measuring decay kinetics in 158 dated fossils. Proceedings of the Royal Society B 279: 4724–4733. https://doi.org/10.1098/rspb.2012.1745
  • Angelini F (1972) Hydroadephaga inediti per Puglia e Lucania. Bolletino della Società Entomologica Italiana 104: 179–194.
  • Angelini F (1984) Catalogo topografico dei ColeopteraHaliplidae, Hygrobiidae, Dytiscidae e Gyrinidae d’Italia. Memoire della Società Entomiologica Italiana, 61A(1982): 45–126.
  • Biström O (1982) A revision of the genus Hyphydrus Illiger (Coleoptera, Dytiscidae). Acta Zoologica Fennica 165: 1–121.
  • Bordoni A, Rocchi S, Cuoco S (2006) Ricerche sulla coleotterofauna delle zone umide della Toscana. VI. Piana di Guasticce – Livorno (Coleoptera). Quaderni della Stazione di Ecologia, Museo Civico di Storia Naturale Ferrara 16: 43–179.
  • Csabai Z, Gidó Z, Juhász P, Kiss B, Olajos P (1999) Adatok a Körös-Maros Nemzeti Park illetékességi területének vízibogár-faunájához (Coleoptera: Haliplidae, Dytiscidae, Noteridae, Gyrinidae, Hydrochidae, Helophoridae, Hydrophilidae). (Data to the water beetle fauna of Körös-Maros National Park (Coleoptera: Haliplidae, Dytiscidae, Noteridae, Gyrinidae, Hydrochidae, Helophoridae, Hydrophilidae)). Crisicum 2: 141–155. [In Hungarian with English abstract]
  • Csabai Z, Nosek JN (2006) Aquatic beetle fauna of Gemenc landscape protection area, south Hungary (Coleoptera: Hydradephaga, Hydrophiloidea). Acta Biologica Debrecina, Supplementum Oecologica Hungarica 14: 67–76.
  • Fujisawa T, Barraclough TG (2013) Delimiting species using single-locus data and the Generalized Mixed Yule Coalescent approach: a revised method and evaluation on simulated data sets. Systematic Biology 62: 707–724.
  • Goloboff P (1999) NONA (NO NAME) ver. 2. Published by the author, Tucumán, Argentina.
  • Guéorguiev VB (1971) Coleoptera: Hydrocanthares et Palpicornia. Catalogus faunae Jugoslaviae, III/6. Academia Scientarum et Artium Slovenica, Ljubljana, 45 pp. [In Slovene and English]
  • Guignot F (1957) Quarante-troisième note sur les hydrocanthares (Col.). Bulletin de la Société Entomologique de France 62: 91–94.
  • Hájek J (2009) Icones Insectorum Europae Centralis. Coleoptera: Dytiscidae. Folia Heyrovskyana Series B 13: 1–32.
  • Ivanova NV, deWaard JR, Hebert PDN (2006) An inexpensive, automation-friendly protocol for recovering high- quality DNA. Molecular Ecology Notes 6: 998–1002. doi: 10.1111/j.1471-8286.2006.01428.x
  • Isambert B, Bergsten J, Monaghan MT, Andriamizehy H, Ranarilalatiana T, Ratsimbazafy M, Andriniainimanana JR, Vogler AP (2011) Endemism and evolutionary history in conflict over Madagascar’s freshwater conservation priorities. Biological Conservation 144: 1902–1909. http://dx.doi.org/10.1016/j.biocon.2011.04.016
  • Kálmán Z, Soós N, Kálmán A, Csabai Z (2008) Contribution to the aquatic Coleoptera and Heteroptera fauna of the Upper-Tisza-Region (Coleoptera: Hydradephaga, Hydrophiloidea; Heteroptera: Gerromorpha, Nepomorpha). Acta Biologica Debrecina, Supplementum Oecologica Hungarica 18: 73–82.
  • Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947–2948. https://doi.org/10.1093/bioinformatics/btm404
  • Lőkkös A (2010) The water beetles (Coleoptera: Hydradephaga, Hydrophiloidea) of the Nagy-berek area, Lake Balaton, Hungary. Natura Somogyensis 17: 157–170.
  • Mesaroš G (2015) Nove vrste predatorskih akvatičnih tvrdokrilaca za faunu Srbije (Coleoptera: Adephaga). In: Jerinić-Prodanović D (Ed.) Symposium of entomologists in Serbia 2015 with international participation, Kladovo 23.–27.IX.2015. Abstracts. Entomological Society of Serbia, Beograd, viii + 58 pp. [In Serbian]
  • Miller KB, Bergsten J (2016) Diving Beetles of the World. Systematics and Biology of the Dytiscidae. Johns Hopkins University Press, Baltimore, 320 pp.
  • Molnár Á (2008) Vízibogár-faunisztikai adatok a Tápió-vidékről (Coleoptera: Hydradephaga, Hydrophiloidea). (Aquatic beetle faunistical records from the Tápió-landscape (Coleoptera: Hydradephaga, Hydrophiloidea)). Acta Biologica Debrecina, Supplementum Oecologica Hungarica 18: 109–113. [In Hungarian with English abstract]
  • Móra A, Csabai Z, Müller Z (2004) Contribution to the dragonfly, aquatic beetle and caddisfly fauna of the Jászság, Hungary (Odonata, Coleoptera: Hydradephaga and Hydrophiloidea, Trichoptera). Folia Historico-naturalia Musei Matraensis 28: 149–156.
  • Nardi G (1997) ColeopteraHaliplidae, Hygrobiidae, Gyrinidae, Dytiscidae, pp. 130-135. In: Zapparoli M (Ed.) Gli insetti di Roma. Comune di Roma, Dip.X Area Risorsa Suolo e Tutela Ambiente, Quaderni dell’Ambiente 6: 1–360.
  • Nilsson AN, Hájek J (2017a) A world catalogue of the family Dytiscidae, or the diving beetles (Coleoptera, Adephaga) Version 31.I.2017. Distributed as a PDF file via Internet. http://www.norrent.se and http://www.waterbeetles.eu [accessed 2017-04-27]
  • Nilsson AN, Hájek J (2017b) Catalogue of Palearctic Dytiscidae (Coleoptera). Version 1.I.2017. Distributed as a PDF file via Internet. http://www.waterbeetles.eu [accessed 2017-04-27]
  • Nixon KC (1999-2002) WinClada ver. 1.0000. Published by the author, Ithaca, NY, USA.
  • Pederzani F (1976) Sui coleotteri idroadefagi e palpicorni delle Pinete di Ravena e degli ambienti umidi circostanti. Bolletino della Società Entomologica Italiana 108: 157–174.
  • Pederzani F, Campadelli G (1996) Raccolte di idroadefagi e palpicorni nei biotopi di Punte Alberete e Bardello (Ravenna) e di Bosco Mesola (Ferrara) (Insecta, Coleoptera: Haliplidae, Dytiscidae, Hydrophilidae). Quaderno di Studi e Notizie di Storia Naturale della Romagna 6: 19–22.
  • Pons J, Barraclough TG, Gomez-Zurita J, Cardoso A, Duran DP, Hazell S, Kamoun S, Sumlin WD, Vogler AP (2006) Sequence-based species delimitation for the DNA taxonomy of undescribed insects. Systematic Biology 55: 595–609. https://doi.org/10.1080/10635150600852011
  • R Development Core Team (2005) R: A language and environment for statistical computing, reference index version 2.x.x. R Foundation for Statistical Computing, Vienna, Austria. http://www.R-project.org
  • Rocchi S (1991) Idroadefagi del “Padule” di Fucecchio e delle altre principali zone palustri della Toscana (Coleoptera: Haliplidae, Hygrobiidae, Gyrinidae, Dytiscidae). Redia 74: 51–75.
  • Ronquist F, Teslenko M, Mark Pvd, Ayres D, Darling A, Höhna S, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539–542. https://doi.org/10.1093/sysbio/sys029
  • Sanfilippo N (1963) Descrizione di una nuova specie del genere Hyphydrus rinvenuta in Italia (ColeopteraDytiscidae). Bolletino della Società Entomologica Italiana 93: 76–80.
  • Scheers K (2016) An updated checklist of the water beetles of Montenegro (Coleoptera, Hydradephaga). Spixiana 39: 205–212.
  • Sharp D (1882) On aquatic carnivorous Coleoptera or Dytiscidae. Scientific Transactions of the Royal Dublin Society (2)2: 179–1003 + pls. 7–18.
  • Shokralla S, Gibson JF, Nikbakht H, Janzen DH, Hallwachs W, Hajibabaei MD (2014) Next-generation DNA barcoding: using next generation sequencing to enhance and accelerate DNA barcode capture from single specimens. Molecular Ecology Resources 14: 892–901.
  • Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook P (1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America 87: 651–701.
  • Soós N, Kálmán Z, Csabai Z (2008) Contribution to the aquatic Coleoptera and Heteroptera fauna of Bodroköz, NE Hungary (Coleoptera: Hydradephaga, Hydrophiloidea; Heteroptera: Gerromorpha, Nepomorpha). Acta Biologica Debrecina, Supplementum Oecologica Hungarica 18: 219–230.
  • Temunović M, Šerić Jelaska M, Durbešić P (2007) Diversity of water beetles (Hydroadephaga, Coleoptera) in temporary ponds of Lonjsko Polje Nature Park, Croatia. Entomologica Croatica 11: 13–24.
  • Thomsen PF, Elias S, Gilbert MTP, Haile J, Munch K, Kuzmina S, Froese DG, Sher A, Holdaway RN, Willerslev E (2009) Non-destructive sampling of ancient insect DNA. PLoS ONE 4(4): e5048. http://dx.doi.org/10.1371/journal.pone.0005048
  • Wewalka G (1984) Neue und bemerkenswerte Schwimmkäfer aus dem Nahen Osten. Koleopterologische Rundschau 57: 129–140.
login to comment