Research Article
Print
Research Article
Molecular phylogeny of Atractus (Serpentes, Dipsadidae), with emphasis on Ecuadorian species and the description of three new taxa
expand article infoAlejandro Arteaga, Konrad Mebert§, Jorge H. Valencia|, Diego F. Cisneros-Heredia, Nicolás Peñafiel#, Carolina Reyes-Puig¤, José L. Vieira-Fernandes, Juan M. Guayasamin«
‡ Tropical Herping, Quito, Ecuador
§ Universidade Estadual de Santa Cruz, Ilhéus, Brazil
| Fundación Herpetológica Gustavo Orcés, Quito, Ecuador
¶ Universidad San Francisco de Quito, Quito, Ecuador
# Centro de Investigación de la Biodiversidad y Cambio Climático (BioCamb), Quito, Ecuador
¤ Museo Ecuatoriano de Ciencias Naturales, Quito, Ecuador
« Universidad Tecnológica Indoamérica, Quito, Ecuador
Open Access

Abstract

We present a molecular phylogeny of snake genus Atractus, with an improved taxon sampling that includes 30 of the 140 species currently recognized. The phylogenetic tree supports the existence of at least three new species in the Pacific lowlands and adjacent Andean slopes of the Ecuadorian Andes, which we describe here. A unique combination of molecular, meristic and color pattern characters support the validity of the new species. With the newly acquired data, we propose and define the A. iridescens species group, as well as redefine the A. roulei species group. The species A. iridescens is reported for the first time in Ecuador, whereas A. bocourti and A. medusa are removed from the herpetofauna of this country. We provide the first photographic vouchers of live specimens for A. multicinctus, A. paucidens and A. touzeti, along with photographs of 19 other Ecuadorian Atractus species. The current status of A. occidentalis and A. paucidens is maintained based on the discovery of new material referable to these species. With these changes, the species number reported in Ecuador increases to 27, a number that is likely to increase as material not examined in this work becomes available and included in systematic studies.

Keywords

Pacific lowlands, biodiversity, Ecuador, groundsnakes, Atractus, phylogeny, new species

Introduction

With 140 species, Atractus is the most speciose snake genus in the world, with 33 new species described only during the last ten years (Uetz et al. 2016). Most of these new species have been described using a combination of meristic and morphometric characters (Passos et al. 2009a, 2016, Passos and Lynch 2010, Schargel et al. 2013, Salazar-Valenzuela et al. 2014). However, with the exception of the preliminary phylogeny presented in De Oliveira and Hernández-Ruz (2016), no studies have involved a phylogenetic approach to test species arrangements and boundaries.

One recent work by Passos et al. (2009a) evaluated the taxonomic status of Atractus species from the Pacific lowland of Colombia and Ecuador, using a combination of meristic, morphometric, color pattern, and hemipenial characters. These authors described three new species and provided a comprehensive review of all Atractus known to occur in the region. However, when referring to this work to compare previously unexamined material from Ecuador, it became clear to us that several Ecuadorian specimens of Pacific lowland Atractus could not be assigned to any taxa currently recognized to occur in the country. Some specimens identified as A. medusa (Passos et al. 2009a) matched the coloration of the first specimen reported in Ecuador by Cisneros-Heredia and Romero (2015), but they did not match the coloration of the holotype (Passos et al. 2009a). Other specimens were closer in coloration and lepidosis to A. iridescens (Peracca, 1860) from Colombia, and others resembled both A. microrhynchus (Cope, 1868) and A. occidentalis (Savage, 1955). To further complicate matters, the taxonomic validity of A. occidentalis and A. paucidens (Despax, 1910) was not recognized in Arteaga et al. (2013), owing to their close morphological resemblance to A. dunni (Savage, 1955) and A. modestus (Boulenger, 1894), respectively.

To resolve these pending issues and to shed light on potentially unclear species boundaries, we report on new material of Atractus from Ecuador, review current knowledge on the species occurring in the Pacific lowlands and adjacent Andean slopes, present a new molecular phylogeny, including most Ecuadorian species, and describe three new species of Atractus.

Materials and methods

Ethics statement

This study was carried out in strict accordance with the guidelines for use of live amphibians and reptiles in field research compiled by the American Society of Ichthyologists and Herpetologists (ASIH), The Herpetologists’ League (HL) and the Society for the Study of Amphibians and Reptiles (SSAR). All procedures with animals (see below) were approved by the Centro de Investigación de la Biodiversidad y Cambio Climático (BioCamb) of the Universidad Tecnológica Indoamérica. They also were reviewed by the Ministerio de Ambiente del Ecuador (MAE) and specifically approved as part of obtaining the following field permits for research and collection: MAE-DNB-CM-2015-0017, granted to Universidad Tecnológica Indoamérica; and permit N°012-IC-FAN-DPEO-MAE, granted to the Museo Ecuatoriano de Ciencias Naturales. Specimens were euthanized with 20% benzocaine, fixed in 10% formalin or 70% ethanol, and stored in 70% ethanol. Museum vouchers were deposited at the Museo de Zoología of the Universidad Tecnológica Indoamérica (MZUTI).

Sampling

Tissue samples from 39 individuals representing 22 species (including three new species described here) were obtained throughout Ecuador. The majority of individuals were located by space-constrained visual examination of ground-level substrates (Campbell and Christman 1982). The remaining individuals were detected by turning over logs, rocks and other surface objects. All specimens included in the genetic analyses were morphologically identified according to Savage (1955, 1960), Cisneros-Heredia (2005), Passos et al. (2009a), Arteaga et al. (2013), Schargel et al. (2013) and Salazar-Valenzuela et al. (2014). We generated sequence data for samples marked with an asterisk under Appendix I, which includes museum vouchers at the Museo de Zoología de la Universidad Tecnológica Indoamérica (MZUTI), the División de Herpetología del Museo Ecuatoriano de Ciencias Naturales (DHMECN) and the Fundación Herpetológica Gustavo Orcés (FHGO).

Laboratory techniques

Genomic DNA was extracted from 96% ethanol-preserved tissue samples (liver, muscle tissue or scales) using a modified salt precipitation method based on the Puregene DNA purification kit (Gentra Systems). We amplified the 16S gene using the primers 16Sar-L and 16Sbr-H-R from Palumbi et al. (1991). Additionally, the Cytb gene was obtained with the primers L14910 and H16064 developed by Burbrink et al. (2000), whereas the gene coding for the subunit 4 of the NADH dehydrogenase was amplified with the primers ND4 and Leu developed by Arévalo et al. (1994). PCR reactions contained 2 mM (Cytb and ND4) or 3 mM (16S) MgCl2, 200 µM dNTP mix, 0.2 µM (16S and Cytb) or 0.8 µM (ND4) of each primer and 1.25 U (16S and Cytb) or 0.625 U (ND4) Taq DNA Polymerase Recombinant (Thermo Fisher Scientific) in a 25 µL total volume. The nucleotide sequences of the primers and the PCR conditions applied to each primer pair are detailed in Appendix II. PCR products were cleaned with Exonuclase I and Alkaline Phosphatase (Illustra ExoProStar by GE Healthcare) before they were sent to Macrogen Inc (Korea) for sequencing. All PCR products were sequenced in both forward and reverse directions with the same primers that were used for amplification. The edited sequences were deposited in GenBank (Appendix I).

DNA sequence analyses

A total of 126 mtDNA sequences were used to build a mitochondrial phylogenetic tree of the genus Atractus. 69 were generated during this work and 57 (all available sequences for the sampled gene fragments) were downloaded from GenBank. A mitochondrial marker dataset, though less powerful to study higher-level phylogenetic relationships, was chosen because it is the most effective to successfully resolve species-level phylogenies (Patwardhan 2014). Recently published works looking to resolve intrageneric relationships within Neotropical dipsadines have done so using phylogenies that are largely based on mitochondrial data (Krysko et al. 2015, Pyron et al. 2016). Specifically, we use the gene Cytochrome-b because it is reported as the most powerful in recovering phylogenetic relationships among closely related taxa (Patwardhan 2014), which is the case for the species of Atractus studied here. The mitochondrial genes 16S and ND4 were used to be able to compare with Atractus sequences available in GenBank. Novel sequences were edited and assembled using the program Geneious ProTM 5.4.7 (Drummond et al. 2010) and aligned with those downloaded from Genbank (Appendix I) using MAFFT v.7 (Katoh and Standley 2013) under the default parameters in Geneious ProTM 5.4.7. Genes were combined into a single matrix with seven partitions, one per non-coding gene and three per protein coding gene corresponding to each codon position. The best partition strategies along with the best-fit models of evolution were obtained in PartitionFinder 1.1.1 (Lanfear et al. 2012) and jModeltest (Darriba et al. 2012) under the Bayesian information criterion. Phylogenetic relationships were assessed under a Bayesian approach in MrBayes 3.2.0 (Ronquist and Huelsenbeck 2013). Four independent analyses were performed to reduce the chance of converging on a local optimum. Each analysis consisted of 6.7 million generations and four Markov chains with default heating settings. GenBank accession numbers are listed in Appendix I. Trees were sampled every 1,000 generations, resulting in 5,000 saved trees per analysis after 25% of those were arbitrarily discarded as ‘‘burn-in.” Stationarity was confirmed by plotting the–ln L per generation in the program Tracer 1.2 (Rambaut and Drummond 2003). Genetic distances between A. esepe and its closest morphological relatives were calculated using the uncorrected distance matrix in PAUP 4.0 (Swofford 2002).

Morphological data

Our terminology for Atractus cephalic shields follows Savage (1960), diagnoses and descriptions generally follow Passos et al. (2009a), and ventral and subcaudal counts follow Dowling (1951). We examined comparative alcohol-preserved specimens from the herpetology collections at the MZUTI, DHMECN, Fundación Herpetológica Gustavo Orcés (FHGO), Museum d’Histoire Naturelle de la Ville de Genève (MHNG), Museo de Historia Natural de la Escuela Politécnica Nacional (EPN), Museo de Zoología de la Pontificia Universidad Católica del Ecuador (QCAZ), National Museum of Natural History (USNM), Muséum National d’Histoire Naturelle (MNHN) and Museo de Zoología de la Universidad San Francisco de Quito (ZSFQ). (Table 1). Morphological measurements were taken with measuring tapes to the nearest 1 mm. When providing the standard deviation, we use the ± symbol. Sex was determined by noting the presence or absence of hemipenes through a subcaudal incision at the base of the tail.

Locality data for specimens examined in this study. Coordinates represent georeferencing attempts from gazetteers under standard guidelines, though some variation from the exact collecting locality will be present. Similarly, elevations are taken from Google Earth, and may not exactly match the elevations as originally reported.

Species Voucher Locality Latitude Longitude Elev.
A. carrioni DHMECN 4697 Loja, Utuana -4.36642 -79.72483 2517
A. carrioni DHMECN 76 Esmeraldas, Copa Quininde (in error) 0.06181 -78.72641 1688
A. carrioni DHMECN 7668 Loja, Utuana -4.36642 -79.72483 2517
A. carrioni MZUTI 4194 Loja, Utuana -4.36642 -79.72483 2517
A. carrioni MZUTI 4195 Loja, Utuana -4.36642 -79.72483 2517
A. duboisi MHNG 2457.093 Napo, Chiriboga (in error) - - -
A. duboisi MNHN 0.6147 Ecuador - - -
A. duboisi MZUTI 3640 Napo, Yanayacu -0.60071 -77.88927 1924
A. duboisi MZUTI 62 Napo, Yanayacu -0.59939 -77.89050 2064
A. dunni DHMECN 12769 Carchi, Gualpi 0.86439 -78.22435 2104
A. dunni DHMECN 2215 Pichincha, Río Cambugán 0.17697 -78.50779 1828
A. dunni DHMECN 3527 Imbabura, Junín 0.27009 -78.64975 1688
A. dunni DHMECN 3900 Pichincha, Tambo Quinde 0.00967 -78.66906 1870
A. dunni DHMECN 4159 Pichincha, Pahuma 0.02757 -78.63208 1914
A. dunni EPN 3127 Santo Domingo, Chiriboga -0.22841 -78.76725 1813
A. dunni EPN 3128 Santo Domingo, Chiriboga -0.22841 -78.76725 1813
A. dunni FHGO 375 Santo Domingo, La Favorita -0.22833 -78.76503 1810
A. dunni FHGO 376 Santo Domingo, La Favorita -0.22833 -78.76503 1810
A. dunni FHGO 379 Santo Domingo, La Favorita -0.22833 -78.76503 1810
A. dunni FHGO 91 Santo Domingo, La Favorita -0.22833 -78.76503 1810
A. dunni MHNG 2441.043 Cotopaxi, Cutzualo -0.54497 -78.91891 1952
A. dunni MHNG 2457.091 Santo Domingo, La Favorita -0.22841 -78.76725 1813
A. dunni MHNG 2464.03 Cotopaxi, Otonga -0.41549 -79.00480 2095
A. dunni MZUTI 2189 Pichincha, Tandayapa–Bellavista -0.00843 -78.67619 1919
A. dunni MZUTI 3031 Pichincha, Tandayapa Lodge 0.00268 -78.68131 1757
A. dunni MZUTI 4097 Imbabura, Santa Rosa de Intag 0.37616 -78.46054 2077
A. dunni MZUTI 4098 Imbabura, Santa Rosa de Intag 0.37616 -78.46054 2077
A. dunni MZUTI 4099 Imbabura, Santa Rosa de Intag 0.37616 -78.46054 2077
A. dunni MZUTI 4100 Imbabura, Below of Siempre Verde 0.37782 -78.46901 1974
A. dunni MZUTI 4318 Imbabura, Toisán 0.53297 -78.52924 2286
A. dunni MZUTI 4319 Imbabura, Toisán 0.53297 -78.52924 2286
A. dunni ZSFQ 1513 Santo Domingo, Guajalito -0.22875 -78.82248 1801
A. ecuadorensis DHMECN 5101 Tungurahua, Río Verde -1.40344 -78.30099 1507
A. elaps DHMECN 10179 Morona Santiago, Tundayme -3.57244 -78.46982 790
A. gaigeae MHNG 2397.044 Morona Santiago, Macas -2.31670 -78.11670 972
A. gigas MHNG 2250.035 Santo Domingo, Chiriboga -0.22841 -78.76725 1813
A. gigas MHNG 2441.02 Cotopaxi, Otonga -0.41549 -79.00480 2095
A. gigas MZUTI 3286 Pichincha, Las Gralarias -0.00807 -78.73238 1985
A. iridescens DHMECN 2932 Esmeraldas, Canande 0.52993 -79.03541 594
A. iridescens DHMECN 5663 Esmeraldas, Tundaloma 1.18236 -78.75250 74
A. iridescens DHMECN 9633 Esmeraldas, Canande 0.52993 -79.03541 594
A. iridescens EPN 13920 Carchi, Río Blanco 1.18993 -78.50413 223
A. iridescens FHGO 10443 Esmeraldas, Tsejpi 0.79930 -78.84527 152
A. iridescens MZUTI 3548 Esmeraldas, Tundaloma 1.18166 -78.74945 74
A. iridescens MZUTI 3680 Esmeraldas, Tundaloma 1.18166 -78.74945 74
A. iridescens MZUTI 4178 Pichincha, Puerto Quito 0.11667 -79.26661 143
A. iridescens MZUTI 4697 Esmeraldas, Canande 0.52993 -79.03541 594
A. iridescens ZSFQ 191.101109 Esmeraldas, Tundaloma 1.18166 -78.74945 74
A. lehmanni DHMECN 7644 Azuay, Reserva Yunguilla -3.22684 -79.27520 1748
A. lehmanni DHMECN 7645 Azuay, Reserva Yunguilla -3.22684 -79.27520 1748
A. major ANF 1545 Orellana, Estación Científica Yasuní -0.67781 -76.39819 246
A. major DHMECN 8343 Sucumbíos, Bloque 27 0.32273 -76.19369 272
A. major MNHN 0.6149 Ecuador - - -
A. major MZUTI 4973 Zamora Chinchipe, Maycu -4.38030 -78.74584 981
A. microrhynchus DHMECN 2536 El Oro, Buenaventura -3.65467 -79.76794 524
A. microrhynchus DHMECN 2586 El Oro, Buenaventura -3.65467 -79.76794 524
A. microrhynchus FHGO 897 El Oro, Zambo Tambo -3.67861 -79.68001 1014
A. microrhynchus MHNG 2307.017 El Oro, El Progreso -3.26998 -79.73452 176
A. microrhynchus MHNG 2397.019 El Oro, El Progreso -3.26998 -79.73452 176
A. microrhynchus MHNG 2397.02 El Oro, El Progreso -3.26998 -79.73452 176
A. microrhynchus MHNG 2397.021 El Oro, El Progreso -3.26998 -79.73452 176
A. microrhynchus MHNG 2459.052 El Oro, El Progreso -3.26998 -79.73452 176
A. microrhynchus MZUTI 4122 Manabí, Jama Coaque -0.11556 -80.12472 299
A. microrhynchus MZUTI 5109 Los Ríos, Río Palenque -0.59273 -79.36369 163
A. microrhynchus QCAZ 1219 Loja, Olmedo -3.94994 -79.66667 1545
A. microrhynchus USNM 285473 Los Ríos, Rio Palenque -0.58333 -79.36667 173
A. microrhynchus USNM 285474 Los Ríos, Rio Palenque -0.58333 -79.36667 173
A. modestus DHMECN 3859 El Oro, Piñas -3.68041 -79.68253 1019
A. modestus EPN 13916 Carchi, Chical 0.90327 -78.16201 1437
A. modestus FHGO 2936 Pichincha, Maquipucuna 0.11757 -78.67446 1490
A. modestus FHGO 44 Pichincha, Maquipucuna 0.11757 -78.67446 1490
A. modestus MHNG 2397.041 Cotopaxi, Las Pampas -0.44036 -78.96663 1590
A. modestus MZUTI 4760 Pichincha, Gualea 0.08536 -78.74092 1557
A. multicinctus MZUTI 5106 Esmeraldas, Canandé 0.52581 -79.2088 310
A. occidentalis EPN 13077 Pichincha, Mindo -0.04872 -78.77520 1277
A. occidentalis FHGO 385 Santo Domingo, La Favorita -0.22833 -78.76503 1810
A. occidentalis MHNG 2252.079 Cotopaxi, Las Pampas -0.44036 -78.96663 1590
A. occidentalis MHNG 2307.068 Pichincha, Tandapi -0.41522 -78.79728 1455
A. occidentalis MHNG 2397.028 Cotopaxi, Las Pampas -0.44036 -78.96663 1590
A. occidentalis MHNG 2411.085 Pichincha, Tandapi -0.41522 -78.79728 1455
A. occidentalis MHNG 2411.086 Pichincha, Tandapi -0.41522 -78.79728 1455
A. occidentalis MHNG 2441.044 Pichincha, Nanegalito 0.06181 -78.72641 1688
A. occidentalis MZUTI 1385 Pichincha, Yellow House -0.04492 -78.75843 1504
A. occidentalis MZUTI 2649 Pichincha, Yellow House -0.05199 -78.76923 1325
A. occidentalis MZUTI 2650 Pichincha, Yellow House -0.04371 -78.75351 1520
A. occidentalis MZUTI 3323 Pichincha,Las Gralarias -0.00615 -78.73381 1985
A. paucidens DHMECN 11980 Pichincha, Pedro Vicente Maldonado 0.05361 -78.92109 938
A. paucidens DHMECN 3975 Santa Elena, Comuna Loma Alta -1.83442 -80.70291 72
A. paucidens EPN 8729 Santo Domingo, Finca La Esperanza -0.27160 -79.10568 616
A. paucidens EPN 8730 Santo Domingo, Finca La Esperanza -0.27160 -79.10568 616
A. paucidens EPN 8731 Santo Domingo, Finca La Esperanza -0.27160 -79.10568 616
A. paucidens EPN 8732 Santo Domingo, Finca La Esperanza -0.27160 -79.10568 616
A. paucidens MHNG 2309.065 Pichincha, Puerto Quito 0.11667 -79.26661 143
A. paucidens MNHN 1906.245 Santo Domingo, Santo Domingo -0.25351 -79.17297 554
A. paucidens MZUTI 5102 Pichincha, Río Cinto -0.09070 -78.80299 1409
A. paucidens MZUTI 5104 El Oro, Buenaventura -3.65467 -79.76794 524
A. paucidens MZUTI 5105 Pichincha, Río Cinto -0.09070 -78.80299 1409
A. resplendens MZUTI 3996 Tungurahua, Puntzan -1.41359 -78.40951 1962
A. roulei MZUTI 4503 Chimborazo, Vicinity of Tixán -2.16174 -78.81227 2892
A. roulei MZUTI 4544 Chimborazo, Vicinity of Tixán -2.16174 -78.81227 2892
A. roulei QCAZ 6256 Azuay, Hierba Mala -2.76439 -79.43816 3029
A. roulei QCAZ 7887 El Oro, Guanazán -3.44139 -79.49417 2596
A. roulei QCAZ 7902 El Oro, Guanazán -3.44139 -79.49417 2596
A. roulei QCAZ 9643 El Oro, Guanazán -3.44139 -79.49417 2596
A. roulei QCAZ 9652 El Oro, Guanazán -3.44139 -79.49417 2596
A. savagei DHMECN 3800 Carchi, Río la Plata 0.82381 -78.04584 2256
A. savagei MZUTI 4916 Carchi, Chilma Bajo 0.86495 -78.04978 2058
A. snethlageae MNHN 1906.244 Morona Santiago, Gualaquiza -3.39914 -78.57859 835
A. snethlageae MNHN 1994.1171 Morona Santiago, Gualaquiza -3.39914 -78.57859 835
A. touzeti ANF 2390 Pastaza, Tzarentza -1.35696 -78.05814 1355
A. trilineatus MNHN 1898.313 Imbabura, Paramba (in error) 0.81671 -78.35002 698
A. trilineatus MNHN 1898.314 Imbabura, Paramba (in error) 0.81671 -78.35002 698
A. typhon DHMECN 9632 Esmeraldas, Canandé 0.52993 -79.03541 594
A. typhon FHGO 10438 Esmeraldas, Gualpi 0.78173 -79.15993 63
A. typhon FHGO 10439 Esmeraldas, Gualpi 0.78173 -79.15993 63
A. typhon MZUTI 3284 Esmeraldas, Itapoa 0.51307 -79.13400 321

Nomenclatural acts

The electronic edition of this article conforms to the requirements of the amended International Code of Zoological Nomenclature, and hence the new names contained herein are available under that Code from the electronic edition of this article. This published work and the nomenclatural acts it contains have been registered in ZooBank, the online registration system for the ICZN. The ZooBank LSIDs (Life Science Identifiers) can be resolved and the associated information viewed through any standard web browser by appending the LSID to the prefix “http://zoobank.org/”. The LSID for this publication is: urn:lsid:zoobank.org:pub:7CBF7FB1-EFEA-4DC1-8F64-5BF862694AA0. The electronic edition of this work was published in a journal with an ISSN, and has been archived and is available from the following digital repositories: PubMed Central, LOCKSS.

Results

Molecular phylogeny

The overall topology and support (Fig. 1) is similar to that of Pyron et al. (2015). We consider strong support to be posterior probability values >95%, following Felsenstein (2004). Overall, there is low support for many backbone nodes. Strong support was found for the clade colored in yellow under Fig. 1.

Figure 1.

Bayesian consensus phylogeny depicting relationships within colubrid snakes of the genus Atractus, summarized from 5 million post-burnin generations in MrBayes 3.2.0. The topology was derived from analysis of 2,564 bp of mitochondrial DNA (gene fragments 16S, Cytb and ND4). Numbers next to branches correspond to posterior probability values. PP values on intraspecific branches are not shown for clarity. Voucher numbers for sequences are indicated for each terminal when available.

The resulting hypotheses of species relationships for our mitochondrial phylogenetic tree supports Savage’s (1960) assumption suggesting independent evolution of the 15 dorsal scale row lineage within Atractus, since species with this number of dorsal scale rows, like A. elaps, A. roulei and A. duboisi, belong to different lineages. However, the tree does show that A. carrioni (Parker 1930), A. lehmanni (Boettger 1898), A. roulei (Despax, 1910) and A. pyroni sp. n., species with 15 scale rows, form a monophyletic group that includes two more species than was suggested by Passos et al. (2013) when naming the A. roulei species group (Fig. 1).

Atractus gigas (Myers and Schargel, 2006), A. modestus, A. paucidens, A. savagei (Salazar-Valenzuela et al. 2014), A. typhon (Passos et al., 2009a) and A. zidoki (Gasc and Rodrigues, 1979) form a poorly supported clade that does not include A. microrhynchus and A. iridescens, as was suggested by Passos et al. (2009a) when naming the A. paucidens species group (Fig. 1). Six species, Atractus cerberus sp. n., A. dunni, A. esepe sp. n., A. iridescens A. microrhynchus, and A. occidentalis, form a strongly supported clade sister to the A. paucidens species group. Here, we name this lineage as the A. iridescens species group (Fig. 1).

Atractus occidentalis forms a strongly supported distinct lineage, sister to A. microrhynchus. Together, these two species are sister to A. dunni. Atractus typhon is shown to be the strongly supported sister lineage of A. gigas, as is the case for a relationship between A. roulei and A. pyroni sp. n.

New taxa and systematic arrangements derived from the analyses

We seek here to only name or redelimit Atractus species groups that are supported in our molecular phylogeny and share features of their coloration pattern and lepidosis. The first such groups is the clade comprising A. cerberus sp. n., A. dunni, A. esepe sp. n., A. iridescens, A. microrhynchus and A. occidentalis. The other is the one comprising A. carrioni, A. lehmanni, A. pyroni sp. n. and A. roulei.

Atractus iridescens species group

Diagnosis. 200–360 mm SVL Atractus with brown dorsal ground color bearing a pattern of dots or stripes (Fig. 2), generally 17/17/17 smooth dorsals, and 125–163 ventrals (Table 2).

Figure 2.

Photographs of some Ecuadorian species of Atractus in life: A. carrioni MZUTI 4194 (a), MZUTI 4195 (b), A. duboisi MZUTI 3640 (c), A. dunni MZUTI 4318 (d), A. dunni MZUTI 2189 (e), A. elaps AMARU SN (f), A. gigas MZUTI 3286 (g), A. iridescens MZUTI 3680 (h), A. iridescens QCAZ 8072 (i), A. iridescens MZUTI 4697 (j), A. iridescens MZUTI 3548 (k), A. major MZUTI 4973 (l), A. microrhynchus MZUTI 5109 (m), A. modestus (n), A. multicinctus MZUTI 5106 (o), A. occidentalis MZUTI 1385 (p), A. occidentalis MZUTI 3323 (q), A. paucidens MZUTI 5102 (r), A. resplendens MZUTI 3996 (s), A. roulei MZUTI 4503 (t), A. savagei MZUTI 4916 (u), A. snethlageae (v), A. touzeti ANF 2390 (w), and A. typhon MZUTI 5110.

Figure 2. Continued.

Figure 2. Continued.

Figure 2. Continued.

Content. Atractus cerberus sp. n., A. dunni, A. echidna, A. esepe sp. n., A. iridescens, A. microrhynchus and A. occidentalis.

Morphometric data for members of the Atractus iridescens species group. Codes are: V=ventrals; SC=subcaudals; D=dorsal scale rows at midbody; PO=postoculars; SL=supralabials; IL=infralabials; MT=maxillary teeth. Data is derived from Appendix III and from the literature.

Species V SC D PO SL IL MT
Males Females Males Females
A. cerberus 152–157 25–26 17 2 7 7 7
A. dunni 125–136 138–150 26–39 19–26 17 2 6–7 6–8 5–7
A. echidna 127 36 15 2 7 7 6
A. esepe 149 156 41 30 17 2 7 7 5
A. iridescens 127–150 135–144 33–42 25–37 17 2 6–7 6–7 5–6
A. microrhynchus 133–150 144–163 32–40 24–29 17 1–2 7 6–7 5–7
A. occidentalis 129–141 128–149 33–39 20–37 17 2 6–7 6–7 5–7

Distribution. Pacific lowlands and western Andean slopes in Ecuador and Colombia (Fig. 3).

Figure 3.

Distribution of Ecuadorian snakes of the Atractus iridescens species group. Dots represent known localities.

Comment. Passos et al. (2009a) included Atractus echidna, A. iridescens and A. microrhynchus in the phenetic A. paucidens species group. Later, Passos et al. (2012) placed A. microrhynchus in the A. multicinctus group based on hemipenial characters. Unlike A. paucidens or A. multicinctus (Jan, 1865), however, the former three species have a brownish color pattern (Fig. 2) and also a lower number of ventral scales (Appendix III). These differences, together with the phylogenetic placement of A. iridescens and A. microrhynchus support the allocation of these species in the newly formed A. iridescens group.

Atractus roulei species group

Diagnosis. 300–450 mm SVL Atractus with olive to grayish brown dorsal ground color lacking dots and stripes, 15/15/15 smooth dorsals (occasionally 17/17/17), generally 6 supralabials (sometimes 5), and 135–161 ventrals (Table 3).

Morphometric data for members of the Atractus roulei species group. Codes are: V=ventrals; SC=subcaudals; D=dorsal scale rows at midbody; PO=postoculars; SL=supralabials; IL=infralabials; MT=maxillary teeth. Data is derived from Appendix III and from the literature.

Species V SC D PO SL IL MT
Males Females Males Females
A. carrioni 136–151 143–161 25–34 18–32 15 1 6 6 7–10
A. lehmanni 141–144 148–153 25–29 20–21 15–17 1 5 6 8–11
A. pyroni 143 16 15 1 6 5 8
A. roulei 135–146 143–156 20–27 14–23 15 1 5–6 6–7 9–13

Content. Atractus carrioni, A. lehmanni, A. pyroni sp. n. and A. roulei (Fig. 1).

Distribution. Western slopes of the Andes and inter-Andean valleys in central and southern Ecuador (Fig. 4).

Figure 4.

Distribution of Ecuadorian snakes of the Atractus roulei species group. Dots represent known localities.

Comment. Passos et al. (2013) created the Atractus roulei species group to accommodate A. roulei and its closest morphological relative A. carrioni, based mainly on their unusual combination of 15/15/15 dorsals and 6 supralabials. Our examination of new material belonging to these two species, and material belonging to A. pyroni and A. roulei (Appendix III), shows that although the majority of specimens have indeed 6 supralabials, some specimens may have 5, compared with most Ecuadorian Atractus which have 7 (Appendix III). One specimen of A. roulei from the type locality (MZUTI 4544; Table 1) lacks a loreal scale, which was long thought (Savage 1960; Passos et al. 2013) to be the main feature separating this species from A. carrioni. The syntype of A. lehmanni (MC 33513) revised by Savage (1960) has 17/17/17 dorsal scale rows. Specimens assignable to A. lehmanni have been found only in the vicinity of the type locality (hoya de Cuenca; see Table 1).

Atractus cerberus sp. n.

Proposed standard English name

Cerberus Groundsnake

Proposed standard Spanish name

Tierrera cancerbera

Holotype

MZUTI 4330 (Fig. 5a), adult male collected by José L. Vieira-Fernandes and Alejandro Arteaga on November 06, 2015 at Pacoche, province of Manabí, Ecuador (S1.06664, W80.88123; 280 m).

Figure 5.

Adult male holotype MZUTI 4330 (a) and adult male paratopotype (b) of Atractus cerberus MZUTI 5108.

Paratopotype

MZUTI 5108 (Fig. 5b), adult male collected by Alejandro Arteaga on September 04, 2016.

Diagnosis

Atractus cerberus is placed in the genus Atractus as diagnosed by Savage (1960), based on phylogenetic evidence (Fig. 1). It is included in the A. iridescens group due to its brown dorsal ground color (Fig. 5) and its phylogenetic position (Fig. 1). The species is diagnosed based on the following combination of characters: (1) 17/17/17 smooth dorsals; (2) two postoculars; (3) loreal moderate; (4) temporals 1+2; (5) seven supralabials, third and fourth contacting orbit; (6) seven infralabials, first four contacting chinshields (7) seven maxillary teeth; (8) three gular scale rows; (9) three preventrals; (10) 152–157 ventrals; (11) 25–26 subcaudals; (12) dorsal ground color brown with faint black longitudinal bands (Fig. 5); (13) venter light yellow faintly speckled with brownish pigment; (14) 212–309 mm SVL; (15) 23–36 mm TL.

Comparisons

Atractus cerberus is included in the A. iridescens species group and compared to other Pacific lowland congeners that have a brownish ground color (Fig. 2): A. boulengerii, A. dunni, A. echidna, A. esepe sp. n., A. iridescens, A. medusa, A. microrhynchus, and A. occidentalis. From A. boulengerii and A. medusa, it differs in having a striped pattern as opposed to bold black blotches (Fig. 5). From all others, it differs in having yellow ventral surfaces (as opposed to cream or dingy white) and having more than 150 ventrals in males. Finally, the dorsal pattern of A. cerberus is less clearly marked than in the majority of the known specimens of the species included in the A. iridescens group. Instead of having conspicuous spots, blotches or lines, A. cerberus has a series of feebly visible dashes made of pigment slightly darker than the surrounding ground color.

Color pattern

The dorsal ground color is brown with five feebly visible dark-brown to black longitudinal lines that are not continuous throughout the length of the body but broken into spots along some sections (Fig. 5). Between the dark longitudinal lines on each side of the body, there are fields of lighter pigment that on some sections of the body correspond to lines. The head is darker than the rest of the dorsal surfaces and is marked by a dark, irregular postocular stripe that reaches the corner of the mouth (Fig. 5). The top of the supralabials is tinged with black. The ventral surfaces are yellowish cream with scattered brownish speckling that becomes more concentrated towards the tail, which is almost completely brown. The iris is carmine and the pupil is black.

Description of holotype

Adult male, SVL 212 mm, tail length 23 mm (10.8% SVL); body diameter 6.5 mm; head length 7.9 mm (3.7% SVL); head width 4.8 mm (2.3% SVL); interocular distance 3.1 mm; head slightly distinct from body; snout–orbit distance 2.8 mm; rostral 1.6 mm wide, about one time broader than high; internasals 1.0 mm wide; internasal suture sinistral relative to prefrontal suture; prefrontals 1.7 mm wide; frontal 2.3 mm wide, with a curvilinear triangle shape in dorsal view; parietals 2.1 mm wide, about twice as long as wide; nasal divided; loreal 1.5 mm long, about 2 times longer than high; eye diameter 1.4 mm; pupil round; supraoculars 1.4 mm wide; two postoculars; temporals 1+2, upper posterior temporal elongate, about four times longer than high, and three times as long as first temporal; seven supralabials, 3rd–4th contacting orbit; symphisial 1.0 mm wide, about twice as broad as long, separated from chin shields by first pair of infralabials; seven infralabials, 1st–4th contacting chin shields; anterior chin shields about three times as long as broad, posterior chin shields absent; three series of gular scales; dorsal scales 17/17/17 rows, smooth without apical pits; preventrals 3; ventrals 157; anal plate single; paired subcaudals 26.

Natural history

The two known specimens of Atractus cerberus were found in an isolated patch of deciduous lowland forest surrounded by dry lowland shrubland. MZUTI 4330 was found active on leaf litter at 19h29, in 80% closed canopy secondary forest far from streams. The night was warm and there was drizzle the night before. MZUTI 5108 was found crossing a forest trail close to an open area at 10h00 during a sunny morning after a rainy night.

Distribution

Known only from the type locality, Pacoche, in the Ecuadorian province of Manabí at 280–324 m (Fig. 3). This locality is 3 km airline distance from the shoreline.

Etymology

The specific epithet “cerberus” is derived from the name of the Greek monster Kérberos. In Greek mythology, Kérberos is a monstrous multi-headed dog that guards the gates of the underworld, preventing the dead from leaving. Here, we use this word in allusion to the type locality, at the gates of the newly formed “Refinería del Pacífico”, a massive industrial oil-processing plant that can easily be likened to the underworld.

Conservation status

Although Atractus cerberus belongs to a poorly studied genus of snakes and is known only from two specimens collected recently in a single locality, we consider this species to be Critically Endagered following B1a,b(iii) IUCN criteria because: i) its extent of occurrence is estimated to be less than 50 km2 (i.e. total area of continous semideciduous forest in the Refugio de Vida Silvestre Pacoche); ii) it has not been detected in any other locality in the province of Manabí despite numerous surveys (Almendáriz and Carr 2007, Cisneros-Heredia 2004, MECN et al. 2013); and iii) and its habitat is severely fragmented, isolated from other such habitats and declining in extent and quality due to deforestation.

Atractus esepe sp. n.

Proposed standard English name

Indistinct Groundsnake

Proposed standard Spanish name

Tierrera indistinta

Holotype

MZUTI 3758 (Fig. 6), adult male collected by Alejandro Arteaga on September 12, 2014 at Caimito, Esmeraldas Province, Ecuador (N0.69620, W80.090472; 102 m).

Figure 6.

Adult male holotype of Atractus esepe MZUTI 3758 in dorsal (a) and ventral (b) view. Scale = 1 cm.

Paratopotype

MZUTI 3759, adult female collected by Jaime Culebras.

Diagnosis

Atractus esepe is placed in the genus Atractus as diagnosed by Savage (1960), based on phylogenetic evidence (Fig. 1). It is included in the A. iridescens group due to its brown dorsal ground color and its phylogenetic position (Figs 1, 6). The species is diagnosed based on the following combination of characters: (1) 17/17/17 smooth dorsals; (2) two postoculars; (3) loreal long; (4) temporals 1+2; (5) seven supralabials, third and fourth contacting orbit; (6) seven infralabials, first four contacting chinshields (7) seven maxillary teeth; (8) 2–3 gular scale rows; (9) 2–3 preventrals; (10) 149 ventrals in the male holotype, 156 in the female paratype; (11) 41 subcaudals in the male holotype, 30 in the female paratype; (12) dorsal ground color brown with a pattern of complete (MZUTI 3759) or broken (MZUTI 3758) (Fig. 6a) dark lines running parallel along each side of the body and separated from each other by a cream line, but rendering the appearance of a row of dorso-lateral blotches in the broken pattern (MZUTI 3758); (13) venter cream faintly speckled with brownish pigment (Fig. 6b); (14) 232–241 mm SVL; (15) 34–53 mm TL.

Comparisons

Atractus esepe is included in the A. iridescens species group and compared to other Pacific lowland congeners who have a brownish ground color (Figs 2, 5): A. boulengerii, A. cerberus, A. dunni, A. echidna, A. iridescens, A. medusa, A. microrhynchus, and A. occidentalis. From these, A. microrhynchus and A. occidentalis have striped pattern and cream ventral surfaces similar to that of A. esepe, but they occur parapatrically (Fig. 3) and can be distinguished from A. esepe by a genetic divergence of 5.3–5.7% in a 506 bp long fragment of the mitochondrial Cytb gene and by having a greater number of subcaudal scales in males (Table 2). Furthermore, adult specimens of A. microrhynchus have light brown dorsal surfaces instead of dark brown, and their pattern can be better described as a series of blotches rather than broken longitudinal lines. Specimens of both A. esepe and A. occidentalis have a pattern of longitudinal lines, but A. esepe has a greater number of ventral plus caudal scales than A. occidentalis (more than 180 in A. esepe) (Table 2).

Color pattern

The dorsal ground color is dark brown with either six longitudinal black lines separated by lighter areas or a pattern of dark brown longitudinally arranged spots that correspond to the longitudinal lines. On each side, the line or series of dark spots along the 2nd and 3rd dorsal scale row is feebly visible, but the other lines or spots are conspicuous. The dorsal surface of the head is dark brown and there is a clearly marked dark postocular stripe running from behind the eye to the edge of the mouth (Fig. 6). The ventral surfaces are dingy white, finely speckled with brown pigment that becomes more concentrated towards the tail. The iris is carmine and the pupil is black.

Description of holotype

Adult male, SVL 232 mm, tail length 53 mm (22.8% SVL); body diameter 7.0 mm; head length 7.9 mm (3.4% SVL); head width 4.8 mm (2.2% SVL); interocular distance 3.4 mm; head slightly distinct from body; snout–orbit distance 3.3 mm; rostral 1.8 mm wide, about one time broader than high; internasals 0.9 mm wide; internasal suture sinistral relative to prefrontal suture; prefrontals 1.9 mm wide; frontal 2.2 mm wide, with a curvilinear triangle shape in dorsal view; parietals 2.1 mm wide, about twice as long as wide; nasal divided; loreal 2.5 mm long, about 3 times longer than high; eye diameter 1.5 mm; pupil round; supraoculars 1.2 mm wide; two postoculars; temporals 1+2, upper posterior temporal elongate, about four times longer than high, and three times as long as first temporal; seven supralabials, 3rd–4th contacting orbit; symphisial 0.8 mm wide, separated from chin shields by first pair of infralabials; seven infralabials, 1st–4th contacting chin shields; anterior chin shields about three times as long as broad, posterior chin shields absent; three series of gular scales; dorsal scales 17/17/17 rows, smooth without apical pits; preventrals 3; ventrals 149; anal plate single; paired subcaudals 41.

Natural history

The two known specimens of Atractus esepe were found actively foraging among soil and roots in secondary evergreen lowland forest at least 400 m from the nearest natural body of water. They were found by night at 20h00 after a warm, sunny day.

Distribution

Known only from the type locality, Caimito, in the Ecuadorian province of Esmeraldas at 102 m (Fig. 3). This locality is 1.3 km airline distance from the shoreline.

Etymology

The specific epithet esepe is derived from the Spanish pronunciation of “sp.”, which is the abbreviation for the Latin word species. Here, we use this word in allusion to how the majority of Ecuadorian researchers refer to Atractus specimens found in the field.

Conservation status

We consider Atractus esepe to be Data Deficient following IUCN criteria because it is known only from its type locality but its occurrence in the biogeographic Choco suggests that it might as well be present in other localities. The Chocoan forests of Caimito do not appear to be isolated from other similar habitat by geographical or ecological barriers. Therefore, we consider there is inadequate information to make a direct, or indirect, assessment of its extinction risk based on its scarce distribution data.

Atractus pyroni sp. n.

Proposed standard English name

Pyron’s Groundsnake

Proposed standard Spanish name

Tierrera de Pyron

Holotype

MZUTI 5107 (Fig. 7), adult male collected by José L. Vieira-Fernandes and Carlos Durán on May 23, 2016 between Balzapamba and Bilován, province of Bolívar, Ecuador (S1.83601, W79.13322; 2026 m).

Figure 7.

Adult female holotype of Atractus pyroni. MZUTI 5107. Scale = 1 cm.

Diagnosis

Atractus pyroni is placed in the genus Atractus as diagnosed by Savage (1960), based on phylogenetic (Fig. 1) and morphological (Table 3) evidence. It is included in the A. roulei group due to its 15/15/15 dorsal scale rows and its phylogenetic position (Fig. 1). The species is diagnosed based on the following combination of characters: (1) 15/15/15 smooth dorsals; (2) one postocular; (3) loreal long; (4) temporals 1+2; (5) six supralabials, third and fourth contacting orbit; (6) five infralabials, first four contacting chinshields (7) eight maxillary teeth; (8) 3 gular scale rows; (9) 2 preventrals; (10) 143 ventrals; (11) 16 subcaudals; (12) dorsal ground color dark brown with a series of light golden brown paravertebral scales running along the entire dorsum (Fig. 7); (13) venter dark brown with scattered scales of a lighter color; (14) 443 mm SVL; (15) 34 mm TL.

Comparisons

Atractus pyroni is compared to members of the A. roulei species group: A. carrioni, A. lehmanni, and A. roulei (Fig. 2). From A. carrioni, it differs by having a loreal. From A. lehmanni and A. roulei, it differs in size and color pattern. Atractus pyroni is 443 mm in SVL; whereas A. lehmanni is 262–321 in SVL, and A. roulei is 230–396. Both A. lehmanni and A. roulei have uniform dorsal ground color, whereas A. pyroni has a distinct dorsal bicolored pattern (Fig. 7). Finally, in life, A. pyroni is darker than the remaining members of the A. roulei species group and has a ventral pattern that, instead of having fine speckles, has conspicuous scattered blotches of a contrasting color.

Color pattern

The dorsal ground color is blackish with a dark vertebral (mid-dorsal) scale row flanked by a dark yellow scale row on either side (the 7th dorsal scale row), irregularly adjoined by one to few additional yellow scales on the 6th dorsal scale row, rendering an appearance of an irregularly edged mid-dorsal striped pattern (Fig. 7). The dorsal and lateral surfaces of the head are dark grayish brown and the labials are dark mustard yellow. All ventral surfaces are glossy grayish black except for the throat and some scattered blotches, which are dark mustard yellow.

Description of holotype

Adult female, SVL 443 mm, tail length 34 mm (7.7% SVL); body diameter 11.6 mm; head length 14.4 mm (3.3% SVL); head width 9.8 mm (2.2% SVL); interocular distance 5.1 mm; head slightly distinct from body; snout–orbit distance 5.7 mm; rostral 2.8 mm wide, about two times broader than high; internasals 1.5 mm wide; internasal suture sinistral relative to prefrontal suture; prefrontals 2.8 mm wide; frontal 3.5 mm wide, with a curvilinear triangle shape in dorsal view; parietals 4.0 mm wide, about twice as long as wide; nasal divided; loreal 3.7 mm long, about 3 times longer than high; eye diameter 1.8 mm; pupil round; supraoculars 2.1 mm wide; one postocular; temporals 1+2, upper posterior temporal elongate, about five times longer than high, and twice as long as first temporal; six supralabials, 3rd–4th contacting orbit; symphisial 2.4 mm wide, separated from chin shields by first pair of infralabials; five infralabials, 1st–4th contacting chin shields; anterior chin shields about three times as long as broad, posterior chin shields absent; three series of gular scales; dorsal scales 15/15/15 rows, smooth without apical pits; preventrals 2; ventrals 143; anal plate single; paired subcaudals 16.

Natural history

The only known specimen of Atractus pyroni was found dead on a dirt road surrounded by silvopastures and remnants of native montane cloudforest.

Distribution

Known only from the type locality, between Balzapamba and Bilován, in the Ecuadorian province of Bolívar at 2026 m (Fig. 7).

Etymology

Named after R. Alexander Pyron, one of the most prolific contemporary herpetologists, in recognition of his invaluable contribution to systematics and evolution of the world’s reptiles.

Conservation status

We consider Atractus pyroni to be to be Data Deficient following IUCN because there is inadequate information to make a direct, or indirect, assessment of its extinction risk based on its scarce distribution data.

Discussion

Species relationships and taxonomy in the colubrid snake genus Atractus are still far from being resolved, and many infrageneric groups are either non-monophyletic, or poorly supported and weakly placed, which may reflect inadequate sampling of taxa (only 30 out of 140 species are included) or characters (only 1 locus is used). No monophyly was found for the groups defined by Savage (1960), which, until further phylogenetic evidence is accumulated or unambiguous diagnostic characters are defined, should not be used.

From the five members of the A. paucidens species groups of Passos et al. (2009a) that were sampled in our phylogeny, only A. paucidens, A. savagei, and A. typhon cluster together. Atractus microrhynchus and A. iridescens belong to another lineage, which is here named the A. iridescens species group. This group includes the aforementioned two species plus A. cerberus, A. dunni, A. echidna, A. esepe, and A. occidentalis. From the species included in this group, we expand the known distribution of all their members (Fig. 3). However, we do not include the specimens ANSP 18114 nor ANSP 26316, from the vicinity of Huigra and identified as A. occidentalis by Savage (1960), because their description disagrees with the observed morphological variation reported for A. occidentalis in this work. Upon a visit to Huigra, a dry valley dominated by xeric vegetation and rocky outcrops, it became clear to us that it is unlikely for a species like A. occidentalis, which is found in evergreen lower-montane forests (Arteaga et al. 2013), to occur in an isolated dry habitat type ca. 250 km airline distance south of the type locality.

We also re-delimit the A. roulei species group of Passos et al. (2013) to include A. carrioni, A. lehmanni, A. roulei and A. pyroni. We expand the known distribution of A. roulei (Fig. 4), but do not include specimen AMNH 17492 from San José de Chimbo (Savage 1960) in the map because this specimen might actually be A. pyroni given the morphological similarities between the two species and the geographical proximity to the type locality of A. pyroni. Reports of A. lehmanni from Colombia (Passos et al. 2009b) are likely misidentifications since A. lehmanni has not been registered in Ecuador outside the type locality.

To further clarify the landscape of Atractus taxonomy in Ecuador, we analyze the presence of A. medusa, A. melas, A. typhon, A. badius, and A. bocourti in the country. Cisneros-Heredia and Romero (2015) presented the first country record of A. medusa in Ecuador (specimen DFCH-USFQ 191.101109 at Universidad San Francisco de Quito), based on similarities in scalation and coloration between that specimen and the holotype of A. medusa, form Gorgona island, Colombia. Certainly, the characters of scalation of the Ecuadorian specimen fit the diagnosis of A. medusa. However, they fit just as well the diagnosis of A. iridescens provided by Passos et al. (2009a), with the difference that the dorsal pattern of the Ecuadorian specimen resembles more the A. iridescens specimen, ICN 10902, pictured in Passos et al. (2009a). The dark brown ground color (as opposed to light cream), the light bordered brown blotches (as opposed to solid black blotches), and the absence of a black nape band are all characteristics shared by DFCH-USFQ 191.101109 and the other nine specimens of A. iridescens presented in Appendix III, with ICN 10902 of Passos et al. (2009a). Therefore, we consider that DFCH-USFQ 191.101109 actually represents the first country record of A. iridescens for Ecuador. Based on this new information and re-examination of museum material, we report on 9 additional specimens (Table 1) that expand the current known distribution of this species. Cisneros-Heredia and Romero (2015) suggest that a photographic record of Atractus cf. melas from the Bilsa Biological Station, province of Esmeraldas, northwestern Ecuador (Ortega-Andrade et al. 2010) corresponds to A. multicinctus. The specimen differs from other material assigned to A. multicinctus in having whitish rings as opposed to red rings throughout the body (Fig. 2). Although photographic vouchers of A. typhon have been presented in MECN et al. (2013), we report on the first museum vouchers of the species in Ecuador (Table 1).

Finally, although Hoogmoed (1980) restricted the type locality of A. badius and pointed out that the upper Amazon basin specimens were misidentifications, the species has remained in Ecuadorian faunal lists (Torres-Carvajal et al. 2016), even after Schargel et al. (2013) made compelling cases to exclude this species from the upper Amazon Basin. Other snake, A. bocourti was included in the herpetofauna of Ecuador by Pérez-Santos and Moreno (1991) without pointing out to any museum voucher. These authors stated that although they have no information about the distribution of the species in Ecuador, its distribution in Colombia would suggest that it also occurs in Ecuador. Since there is no evidence that neither A. badius nor A. bocourti occur in Ecuador, we remove them from this country’s herpetofauna.

Our analysis of new Atractus material supports the evolutionary phylogenetic distinctiveness of at least 22 of the total taxa currently recognized to occur in Ecuador. To include the remaining taxa in future phylogenetic analyses will certainly help resolve species relationships and taxonomic arrangements of cis-Andean Ecuadorian Atractus, since the five species that were not included in the phylogeny occur in the Amazonian slopes of the Andes. However, besides including more taxa in future phylogenetic analyses, we feel that a more adequate sampling of molecular markers is needed to overcome the difficulties that mitochondrial-based phylogenies have to capture higher-lever evolutionary relationships. Certainly, future studies can benefit from a phylogeny based on both a nuclear and a mitochondrial dataset.

With these changes, the species number reported in Ecuador increases to 27: A. carrioni (Parker, 1930), A. cerberus, A. collaris (Peracca, 1897), A. duboisi (Boulenger, 1880), A. dunni (Savage, 1955), A. ecuadorensis (Savage, 1955), A. elaps (Günther, 1858), A. esepe, A. gaigeae (Savage, 1955), A. gigas (Myers and Schargel, 2006), A. iridescens (Peracca, 1860), A. lehmanni (Boettger, 1898), A. major (Boulenger, 1894), A. microrhynchus (Cope, 1868), A. modestus (Boulenger, 1894), A. multicinctus (Jan, 1865), A. occidentalis (Savage, 1955), A. occipitoalbus (Jan, 1862), A. orcesi (Savage, 1955), A. paucidens (Despax, 1910), A. pyroni, A. resplendens (Werner, 1901), A. roulei (Despax, 1910), A. savage (Salazar-Valenzuela et al., 2014), A. snethlageae (Da Cunha & Do Nascimento, 1983), A. touzeti (Schargel et al., 2013) and A. typhon (Passos et al., 2009).

We hope that the novel genetic and morphological data provided herein will promote future researchers to examine species boundaries in Atractus, as additional work clearly is waiting.

Author contributions

Conceived and designed the work: AA. Performed the analyses: AA NP. Gathered morphological data: KB JHV DFCH CRP JLVF AA. Analyzed the data: AA KM DFCH JMG. Contributed reagents/materials/analysis tools: JMG NP. Wrote the paper: AA KM JHV DFCH NP CRP JLVF JMG.

Acknowledgments

This article was greatly improved by comments of three anonymous reviewers. For granting access to their protected forests, we are grateful to Francisco Sornoza and Martin Schaefer of Fundación Jocotoco, Ana Cristina de la Torre of Pacoche Lodge, and Andrés Chiriboga of Tundaloma Lodge. Special thanks to Lucas Bustamante, Alex Pyron, Gabriela Morales, Carlos Durán, Carlos Gómez, Gabriela Aguiar, James Muchmore, Ryan Lynch, Rita Hidalgo, Ángela León, Silvia Cevallos, Paulina Romero, Jaime Culebras, Carlos Londoño, Andy Proaño, and Daniel Romero for their assistance and companionship in the field. For providing the picture of Atractus iridescens QCAZ 8072, we are grateful to Luis A. Coloma. For granting access to specimens under their care, we are grateful to Mario H. Yánez-Muñoz (DHMECN), Ana Almendáriz (EPN), Katty Garzón-Tello and Maria Helena Barragán (FHGO), Andreas Schmitz (MHNG), Nicolas Vidal (MNHN), David Salazar-Valenzuela (MZUTI), Omar Torres-Carvajal (QCAZ), Kevin de Queiroz (USNM), and Juan Carlos Sánchez-Nivicela (UDA). Fieldwork was made possible with the support of Tropical Herping and Universidad Tecnológica Indoamérica. Laboratory work was carried out at Universidad Tecnológica Indoamérica in Quito. Sequencing was made possible with support of the George Washington University, Universidad Tecnológica Indoamérica, and the U.S. National Science Foundation.

References

  • Almendáriz A, Carr JL (2007) Lista actualizada de los anfibios y reptiles registrados en los remanentes de bosque de la Cordillera de la Costa y áreas adyacentes del suroeste de Ecuador. Escuela Politécnica Nacional, Quito, 11 pp.
  • Arévalo E, Davis SK, Sites JW (1994) Mitochondrial DNA-sequence divergence and phylogenetic relationships among eight chromosome races of the Sceloporus grammicus complex (Phrynosomatidae) in Central Mexico. Systematic Biology 43: 387–418. https://doi.org/10.1093/sysbio/43.3.387
  • Arteaga A, Bustamante L, Guayasamin JM (2013) The amphibians and reptiles of Mindo. Universidad Tecnológica Indoamérica, Quito, 257 pp.
  • Boettger O (1898) Katalog der Reptilien-Sammlung im Museum der Senckenbergischen Naturforschenden Gesellschaft in Frankfurt. II Teil (Schlangen). Gebrüder Knauer, Frankfrut, 160 pp.
  • Boulenger GA (1880) Reptiles et Batraciens recueillis par M. Emile de Ville dans les Andes de l’équateur. Bulletin de la Société Zoologique de France 5: 41–48.
  • Boulenger GA (1894) Catalogue of the snakes in the British Museum (Natural History), Volume II. Trustees of the British Museum, London, 382 pp.
  • Burbrink FT, Lawson R, Slowinski JB (2000) Mitochondrial DNA phylogeography of the polytypic North American rat snake (Elaphe obsoleta): A critique of the subspecies concept. Evolution 54: 2107–2188. https://doi.org/10.1111/j.0014-3820.2000.tb01253.x
  • Campbell HW, Christman SP (1982) Field techniques for herpetofaunal community analysis. In: Scott NJ (Ed.) Herpetological communities: a symposium of the Society for the Study of Amphibians and Reptiles and the Herpetologists League. United States Fish and Wildlife Service, Washington D.C., 193–200.
  • Cisneros-Heredia DF (2004) Amphibians, Machalilla National Park, province of Manabí, western Ecuador. Check List 2: 45–54. https://doi.org/10.15560/2.1.45
  • Cisneros-Heredia DF (2005) Rediscovery of the Ecuadorian snake Atractus dunni Savage, 1955 (Serpentes: Colubridae). Journal of the National Museum (Prague), Natural History Series 174: 87–94.
  • Cisneros-Heredia DF, Romero A (2015) First country record of Atractus medusa (Serpentes, Dipsadidae) in Ecuador. Herpetology Notes 8: 417–420.
  • Cope ED (1868) An examination of the Reptilia and Batrachia obtained by the Orton Expedition to Equador and the Upper Amazon, with notes on other species. Proceedings of the Academy of Natural Sciences of Philadelphia 20: 96–140.
  • da Cunha OR, do Nascimento FP (1983) Ofidios da Amazonia. As especies de Atractus Wagler, 1828, na Amazonia oriental & Maranhao (Ophidia, Colubridae). Boletim do Museu Paraense Emilio Goeldi 123: 1–38.
  • De Oliveira EA, Hernández-Ruz EJ (2016) Morphological variation in Atractus tartarus (Snake: Dipsadidae) from the Xingu River, east Amazon, Brazil and preliminary phylogenetic relationship in Atractus. International Journal of Research Studies in Biosciences 4: 1–7.
  • Despax R (1910) Mission géodésique de l’Équateur. Collections recueillies par M. le Dr Rivet. Liste des ophidiens et descriptions des espèces nouvelles. Bulletin du Muséum National d’Histoire Naturelle 16: 368–376.
  • Dowling HG (1951) A proposed standard system of counting ventrals in snakes. British Journal of Herpetology 1: 97–99.
  • Drummond AJ, Ashton B, Buxton S, Cheung M, Cooper A, Heled J, Kearse M, Moir R, Stones-Havas S, Sturrock S, Thierer T, Wilson A (2010) Geneious v5.5. Biomatters. http://www.geneious.com
  • Dunn ER, Bailey JR (1939) Snakes from the uplands of the Canal Zone and of Darien. Bulletin of the Museum of Comparative Zoology at Harvard College 86: 1–22.
  • Felsenstein J (2004) Inferring Phylogenies. Sinauer Associates, Sunderland, 664 pp.
  • Gasc JP, Rodrigues MT (1979) Une nouvelle espèce du genre Atractus (Colubridae, Serpentes) de la Guyane française. Bulletin du Muséum national d’Histoire naturelle 2: 547–557.
  • Günther A (1858) Catalogue of Colubrine snakes of the British Museum. Taylor and Francis, London, 281 pp.
  • Hoogmoed MS (1980) Revision of the genus Atractus in Surinam, with the ressurection of two species (Colubridae, Reptilia). Notes on the Herpetofauna of Surinam VII. Zoologische Verhandelingen 175: 1–47.
  • Jan G (1862) Enumerazione sistematico delle specie d’ofidi del gruppo Calamaridae. Archivio per la zoologia, l’anatomia e la fisiologia 2: 1–76.
  • Jan G (1865) Iconographie générale des ophidiens. 10. JB Baillière et fils, Paris, 42 pp.
  • Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution 30: 772–780. https://doi.org/10.1093/molbev/mst010
  • Krysko KL, Steadman DW, Nuñez LP, Lee DS (2015) Molecular phylogeny of Caribbean dipsadid (Xenodontinae: Alsophiini) snakes, including identification of the first record from the Cay Sal Bank, The Bahamas. Zootaxa 4028: 441–450. https://doi.org/10.11646/zootaxa.4028.3.9
  • Lanfear R, Calcott B, Ho SY, Guindon S (2012) PartitionFinder: combined selection of partitioning schemes and substitution models for phylogenetic analyses. Molecular Biology and Evolution 29(6): 1695–1701. https://doi.org/10.1093/molbev/mss020
  • MECN, JOCOTOCO, ECOMINGA (2013) Herpetofauna en áreas prioritarias para la conservación: El sistema de reservas Jocotoco y Ecominga. Museo Ecuatoriano de Ciencias Naturales, Quito, 408 pp.
  • Ortega-Andrade HM, Bermingham J, Aulestia C, Paucar C (2010) Herpetofauna of the Bilsa Biological Station, province of Esmeraldas, Ecuador. Check List 6: 119–154. https://doi.org/10.15560/6.1.119
  • Palumbi SR, Martin A, Romano S, McMillan WO, Stice L, Grabowski G (1991) The simple fool’s guide to PCR, version 2.0. University of Hawaii, Honolulu, 94 pp.
  • Passos P, Arredondo JC, Fernandes R, Lynch JD (2009b) Three new Atractus (Serpentes: Dipsadidae) from the Andes of Colombia. Copeia 2009: 425–436. https://doi.org/10.1643/CH-08-063
  • Passos P, Cisneros-Heredia D, Rivera DE, Aguilar C, Schargel WE (2012) Rediscovery of Atractus microrhynchus and reappraisal of the taxonomic status of A. emersoni and A. natans (Serpentes: Dipsadidae). Herpetologica 68: 375–392. https://doi.org/10.1655/HERPETOLOGICA-D-11-00078.1
  • Passos P, Echevarría LY, Venegas PJ (2013) Morphological Variation of Atractus carrioni (Serpentes: Dipsadidae). South American Journal of Herpetology 2: 109–120. https://doi.org/10.2994/SAJH-D-12-00025.1
  • Passos P, Lynch JD (2010) Revision of Atractus (Serpentes: Dipsadidae) from Middle and Upper Magdalena Drainage of Colombia. Herpetological Monographs 24: 149–173. https://doi.org/10.1655/09-041.1
  • Passos P, Mueses-Cisneros JJ, Lynch JD, Fernandes R (2009a) Pacific lowland snakes of the genus Atractus (Serpentes: Dipsadidae), with description of three new species. Zootaxa 2293: 1–34.
  • Passos P, Prudente ALC, Lynch JD (2016) Redescription of Atractus punctiventris and description of two new Atractus (Serpentes: Dipsadidae) from Brazilian Amazonia. Herpetological Monographs 30: 1–20. https://doi.org/10.1655/HERPMONOGRAPHS-D-14-00009
  • Patwardhan A, Ray S, Roy A (2014) Molecular markers in phylogenetic studies-A review. J Phylogen Evolution Biol 2: 1–9.
  • Peracca MG (1896) Sopra alcuni Ofidii nuovi o poco noti dell’America meridionale. Bollettino dei Musei di Zoologia e Anatomia Comparata della R. Università di Torino 11: 1–4.
  • Peracca MG (1897) Intorna ad una piccola raccolta di Rettili di Cononacco (Perù orientale). Bollettino dei Musei di Zoologia e Anatomia Comparata della R. Università di Torino 12: 1–7.
  • Pérez-Santos C and Moreno AG (1991) Serpientes de Ecuador. Museo Regionale di Scienze Naturali, Torino, 538 pp.
  • Pyron RA, Guayasamin JM, Peñafiel N, Bustamante L, Arteaga A (2015) Systematics of Nothopsini (Serpentes, Dipsadidae), with a new species of Synophis from the Pacific Andean slopes of southwestern Ecuador. ZooKeys 541: 109–147. https://doi.org/10.3897/zookeys.541.6058
  • Pyron RA, Arteaga A, Echevarría LY, Torres-Carvala O (2016) A revision and key for the tribe Diaphorolepidini (Serpentes: Dipsadidae) and checklist for the genus Synophis. Zootaxa 4171: 293–320. https://doi.org/10.11646/zootaxa.4171.2.4
  • Savage JM (1955) Descriptions of new colubrid snakes, genus Atractus, from Ecuador. Proceedings of the Biological Society of Washington 68: 11–20.
  • Savage JM (1960) A revision of the Ecuadorian snakes of the colubrid genus Atractus. Miscellaneous Publications, Museum of Zoology, University of Michigan 112: 1–86.
  • Schargel WE, Lamar WW, Passos P, Valencia JH, Cisneros-Heredia DF, Campbell JA (2013) A new giant Atractus (Serpentes: Dipsadidae) from Ecuador, with notes on some other large Amazonian congeners. Zootaxa 3721: 455–474. https://doi.org/10.11646/zootaxa.3721.5.2
  • Torres-Carvajal O, Salazar-Valenzuela D, Merino-Viteri A, Nicolalde DA (2016) ReptiliaWebEcuador. Versión 2016.0. http://zoologia.puce.edu.ec [accessed 12 Nov 2016]
  • Werner F (1901) Über Reptilien und Batrachier aus Ecuador und Neu-Guinea. Verhandlungen der Zoologisch-Botanischen Gesellschaft in Wien 51: 593–614. https://doi.org/10.5962/bhl.part.4586

Appendix I

GenBank accession numbers for loci and terminals of taxa and outgroups sampled in this study. Novel sequence data produced in this study are marked with an asterisk (*).

Species Voucher 16S CYTB ND4
A. albuquerquei GQ457726 JQ598918
A. badius AF158485
A. carrioni MZUTI 4195 KY610046* KY610094*
A. cerberus MZUTI 4330 KY610047* KY610073* KY610095*
A. duboisi MZUTI 62 KT944041 KT944059
A. dunni MZUTI 2189 KY610048* KY610096*
A. dunni MZUTI 3031 KY610049* KY610097*
A. dunni MZUTI 4318 KY610050* KY610074* KY610098*
A. dunni MZUTI 4319 KY610051* KY610075* KY610099*
A. ecuadorensis DHMECN 5105 KY610100*
A. elaps DHMECN 10179 KY610052* KY610076* KY610101*
A. elaps KU 214837 EF078536 EF078584
A. esepe MZUTI 3758 KY610053* KT944052 KY610102*
A. esepe MZUTI 3759 KT944039 KT944051 KT944058
A. flammigerus MNHN 1997.2145 AF158471
A. gigas MZUTI 3286 KT944043 KT944053 KT944061
A. iridescens DHMECN 9633 KY610054* KY610077*
A. iridescens MZUTI 3548 KY610055* KY610078*
A. iridescens MZUTI 3680 KY610056* KY610079*
A. iridescens MZUTI 4178 KT944040 KY610080*
A. iridescens MZUTI 4697 KY610057* KY610081*
A. lehmanni DHMECN 7644 KY610058* KY610082* KY610103*
A. major ANF 1545 KT944045 KY610104*
A. major DHMECN 8343 KY610059* KY610105*
A. microrhynchus MZUTI 5109 KY610060* KY610083* KY610106*
A. microrhynchus MZUTI 4122 KT944037 KT944049 KT944056
A. modestus MZUTI 4760 KY610061* KY610084* KY610107*
A. multicinctus MZUTI 5106 KY610062* KY610085* KY610108*
A. occidentalis MZUTI 1385 KY610063* KY610086* KY610109*
A. occidentalis MZUTI 2649 KY610064* KY610087* KY610110*
A. occidentalis MZUTI 2650 KT944038 KT944050 KT944057
A. occidentalis MZUTI 3323 KY610065* KY610088* KY610111*
A. paucidens MZUTI 5102 KY610066* KY610112*
A. paucidens MZUTI 5104 KY610113*
A. paucidens MZUTI 5105 KY610067* KY610114*
A. pyroni MZUTI 5107 KY610068* KY610089* KY610115*
A. resplendens MZUTI 3996 KT944042 KT944055 KT944060
A. roulei MZUTI 4503 KY610090* KY610116*
A. roulei MZUTI 4544 KY610069* KY610091* KY610117*
A. savagei MZUTI 4916 KY610070* KY610092* KY610118*
A. schach AF158486
A. touzeti ANF 2390 KY610071* KY610093* KY610119*
A. trihedrurus GQ457727 JQ598919
A. typhon DHMECN 9632 KY610072* KY610120*
A. typhon MZUTI 3284 KT944044 KT944054 KT944062
A. wagleri MHUA 14368 GQ334480 GQ334581
A. zebrinus JQ598861
A. zidocki MNHN 1997.2046 AF158487
Outgroups
Geophis godmani JQ598877 JQ598932
Sibon nebulatus MVZ 233298 EU728583 EU728583 EU728583

Appendix II

List of PCR and sequencing primers and their respective PCR conditions (denaturation, annealing, extension and number of corresponding cycles) used in this study. All PCR protocols included an initial 3-min step at 94 °C and a final extension of 10 min at 72 °C.

Locus Primer name Sequence (5’-3’) Reference PCR profile:
16S 16Sar-L CGCCTGTTTATCAAAAACAT Palumbi et al. (1991) 94 °C (45 sec), 53 or 56 °C (45 sec), 72 °C (1 min) [x25-30]
16Sbr-H-R CCGGTCTGAACTCAGATCACGT
Cytb L14910 GACCTGTGATMTGAAAACCAYCGTTGT Burbrink et al. (2000) 94 °C (1 min), 58 °C (1 min), 72 °C (2 min) [x30-36]
H16064 CTTTGGTTTACAAGAACAATGCTTTA
ND4 ND4 CACCTATGACTACCAAAAGCTCATGTAGAAGC Arévalo et al. (1994) 94 °C (25 sec), 58 or 60 °C (1 min), 72 °C (2 min) [x25-30]
Leu CATTACTTTTACTTGGATTTGCACCA

Appendix III

Morphometric data and sex for specimens of Atractus species examined. Codes are: V=ventrals; SC=subcaudals; D1–3=dorsal scale rows at neck, midbody, and vent; PO=postoculars; SL=supralabials; IL=infralabials; MT=maxillary teeth; SVL=snout-vent length (mm); TL=tail length (mm); M=Male, F=Female.

Species Voucher V SC D1 D2 D3 PO SL IL MT SVL TL Sex
A. carrioni DHMECN 4697 144 32 15 15 15 1 6 6 7 361 59 F
A. carrioni DHMECN 76 157 23 15 15 15 1 6 6 8 333 39 F
A. carrioni DHMECN 7668 149 28 15 15 15 1 6 6 7 354 58 M
A. carrioni MZUTI 4195 144 31 15 15 15 1 6 6 8 371 53 M
A. cerberus MZUTI 5108 152 25 17 17 17 2 7 7 7 309 36 M
A. cerberus MZUTI 4330 157 26 17 17 17 2 7 7 7 212 23 M
A. duboisi MHNG 2457.093 166 22 15 15 15 2 7 6 6 455 34 F
A. duboisi MNHN 0.6147 164 17 15 15 15 2 8 7 131 11 F
A. dunni DHMECN 12769 141 36 17 17 17 2 6 7 7 279 39
A. dunni DHMECN 2215 144 24 17 17 17 2 7 7 6 278 35 F
A. dunni DHMECN 3527 141 24 17 17 17 2 6 6 6 352 48 F
A. dunni DHMECN 3900 143 21 17 17 17 2 6 6 101 19
A. dunni DHMECN 4159 129 35 17 17 17 2 5 6 6 266 65
A. dunni EPN 3127 355 46 F
A. dunni EPN 3128 295 63 M
A. dunni FHGO 375 128 36 17 17 17 2 7 7 6 219 48 M
A. dunni FHGO 376 143 26 17 17 17 2 7 7 5 278 33 F
A. dunni FHGO 379 132 35 17 17 17 2 7 7 6 297 61 M
A. dunni FHGO 91 125 35 17 17 17 2 7 7 6 231 52 M
A. dunni MHNG 2441.043 145 20 17 17 17 2 7 7 6 205 22 F
A. dunni MHNG 2457.091 129 34 17 17 17 2 7 6 5 197 39 M
A. dunni MHNG 2464.03 136 39 16 17 17 2 7 6 5 114 22 M
A. dunni MZUTI 2189 134 29 17 17 17 2 7 7 6 189 28 M
A. dunni MZUTI 3031 139 24 17 17 17 2 7 7 5 329 36 F
A. dunni MZUTI 4097 149 21 17 17 17 2 7 7 6 152 17
A. dunni MZUTI 4098 130 37 17 17 17 2 7 7 6 126 19
A. dunni MZUTI 4099 140 25 17 17 17 2 7 7 118 15 F
A. dunni MZUTI 4100 138 24 17 17 17 2 7 7 335 36 F
A. dunni MZUTI 4318 136 34 17 18 17 2 7 7 6 242 53 M
A. dunni MZUTI 4319 129 35 15 17 17 2 7 7 5 242 53 M
A. esepe MZUTI 3758 149 41 17 17 17 2 7 7 5 232 53 M
A. esepe MZUTI 3759 156 30 17 17 17 2 7 7 5 241 34 F
A. gaigeae MHNG 2397.044 136 34 17 17 17 2 7 7 5 129 23 M
A. gigas MHNG 2250.035 168 34 19 17 17 2 6 6 3 272 40 F
A. gigas MHNG 2441.02 177 31 17 17 17 2 6 6 5 1060 116 F
A. iridescens DHMECN 2932 138 28 17 17 17 2 6 7 6 252 36 F
A. iridescens DHMECN 5663 141 32 17 17 17 2 6 6 6 272 46 F
A. iridescens DHMECN 9633 129 42 16 17 17 2 6 6 6 219 62 M
A. iridescens FHGO 10443 139 32 17 17 17 2 7 7 5 204 32 F
A. iridescens MZUTI 3548 131 34 17 17 17 2 7 7 6 200 44 M
A. iridescens MZUTI 3680 140 40 17 17 17 2 7 7 6 210 46 M
A. iridescens MZUTI 4178 148 17 17 17 2 7 5 211 37 M
A. iridescens MZUTI 4697 127 38 17 17 17 2 7 7 5 209 46 M
A. lehmanni DHMECN 7644 144 29 15 15 15 1 5 6 11 300 35 M
A. lehmanni DHMECN 7645 144 23 15 15 15 1 5 7 10 321 42
A. major MNHN 0.6149 174 35 17 17 17 2 7 7 6 586 86 F
A. microrhynchus DHMECN 2586 144 39 17 17 17 1 7 6 6 239 45 M
A. microrhynchus FHGO 897 149 37 17 17 17 2 7 7 7 239 51 M
A. microrhynchus MHNG 2307.017 133 34 18 17 17 2 7 6 5 269 55 M
A. microrhynchus MHNG 2397.019 144 25 17 17 17 2 7 7 6 300 F
A. microrhynchus MHNG 2397.02 147 26 17 17 17 2 7 6 5 225 28 F
A. microrhynchus MHNG 2397.021 144 24 17 17 17 2 7 6 5 217 28 F
A. microrhynchus MHNG 2459.052 137 36 17 17 17 2 7 6 5 239 53 M
A. microrhynchus MZUTI 4122 163 29 17 17 17 2 7 7 7 222 27 F
A. microrhynchus QCAZ 1219 147 40 17 17 17 2 7 7 7 178 37 M
A. microrhynchus USNM 285473 152 26 17 17 17 2 7 7 335 45 F
A. microrhynchus USNM 285474 163 28 17 17 17 2 7 7 212 21 F
A. modestus DHMECN 3859 45 17 17 17 2 7 6 344 41
A. modestus FHGO 2936 165 41 17 17 17 2 7 7 5 110 20 M
A. modestus FHGO 44 186 27 17 17 17 2 7 7 6 294 38 F
A. modestus MHNG 2397.041 146 21 15 15 15 2 7 6 6 200 23 M
A. modestus MZUTI 4760 147 42 17 17 17 2 6 7 5 273 59 M
A. occidentalis FHGO 385 128 37 17 17 17 2 7 7 7 188 40 F
A. occidentalis MHNG 2252.079 145 20 17 17 17 2 6 7 5 262 25 F
A. occidentalis MHNG 2307.068 141 35 17 17 17 2 6 7 5 272 55 M
A. occidentalis MHNG 2397.028 137 38 17 17 17 2 6 7 5 117 21 M
A. occidentalis MHNG 2411.085 138 35 17 17 17 2 7 7 5 253 55 M
A. occidentalis MHNG 2411.086 129 33 17 17 17 2 7 6 5 122 23 M
A. occidentalis MHNG 2441.044 134 37 17 17 17 2 7 7 274 68 M
A. occidentalis MZUTI 2649 134 36 17 17 16 2 7 7 6 223 35 F
A. occidentalis MZUTI 2650 149 24 17 17 17 2 7 7 191 21 F
A. occidentalis MZUTI 3323 134 39 17 17 17 2 7 7 7 332 67 M
A. paucidens DHMECN 11980 171 43 17 17 17 2 7 7 7 290 50 M
A. paucidens DHMECN 3975 163 43 17 17 17 2 7 7 249 50 M
A. paucidens EPN 8730 246 53 M
A. paucidens EPN 8731 237 51 M
A. paucidens MHNG 2309.065 156 46 15 15 15 2 7 6 6 196 45 M
A. paucidens MNHN 1906.245 186 40 17 17 17 2 7 7 262 42 M
A. pyroni MZUTI 5107 143 16 15 15 15 1 6 5 8 443 34 F
A. roulei QCAZ 6256 135 27 15 15 15 1 6 6 9 337 48 M
A. roulei QCAZ 7887 146 25 15 15 15 1 5 6 9 309 39 M
A. roulei QCAZ 7902 156 19 15 15 15 1 6 7 11 392 37 F
A. roulei QCAZ 9643 149 17 15 15 15 1 6 6 11 139 13 F
A. roulei QCAZ 9652 143 19 15 15 15 1 6 6 13 230 21 F
A. savagei DHMECN 3800 166 25 17 17 17 2 6 7 7 214 23 F
A. snethlageae MNHN 1906.244 151 29 17 17 17 2 7 7 7 283 35 F
A. snethlageae MNHN 1994.1171 160 27 17 17 17 2 7 7 8 315 35 F
A. touzeti ANF 2390 176 31 17 17 17 2 7 7 7 652 71 F
A. trilineatus MNHN 1898.313 141 19 15 15 15 2 7 7 8 179 19 M
A. trilineatus MNHN 1898.314 132 21 15 15 15 2 7 7 7 182 20 M
A. typhon DHMECN 9632 153 47 15 15 15 2 7 6 7 187 31 M
A. typhon FHGO 10438 166 41 15 15 15 2 7 7 6 370 68 M
A. typhon FHGO 10439 158 48 16 16 16 2 7 7 7 349 87 F